The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ali, A.
Right arrow Articles by Yang, O. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ali, A.
Right arrow Articles by Yang, O. O.
The Journal of Immunology, 2003, 171: 3999-4005.
Copyright © 2003 by The American Association of Immunologists

Broadly Increased Sensitivity to Cytotoxic T Lymphocytes Resulting from Nef Epitope Escape Mutations 1

Ayub Ali*, Satish Pillai{dagger}, Hwee Ng*, Rachel Lubong*, Douglas D. Richman{dagger}, Beth D. Jamieson*, Yan Ding{ddagger}, M. Juliana McElrath{ddagger}, John C. Guatelli{ddagger} and Otto O. Yang2,*

* Department of Medicine and AIDS Institute, Center for Health Sciences, University of California, Los Angeles, CA 90095; {dagger} Department of Medicine, University of California San Diego, La Jolla, CA 92093; and {ddagger} Fred Hutchinson Cancer Research Center, University of Washington, Seattle, WA 98109


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nef is an HIV-1 protein that is absent in most retroviruses, yet its reading frame is highly maintained despite frequent targeting by CD8+ CTL in vivo. Because Nef is not necessarily required for viral replication, this consistent maintenance suggests that Nef plays an important role(s) and substantial fitness constraints prevent its loss in vivo. The ability of Nef to down-regulate cell surface MHC class I (MHC-I) molecules and render infected cells resistant to CTL in general is likely to be an important contributing function. We demonstrate that mutational escape of HIV-1 from Nef-specific CTL in vitro leads to progeny virions that are increased in their susceptibility to CTL of specificities for proteins other than Nef. The escape mutants contain multiple nef mutations that impair the ability of the virus to down-regulate MHC-I through disruption of its reading frame as well as epitope point mutations. Given the rarity of nef frameshifts in vivo, these data support the concept that the ability to down-regulate MHC-I could be a key constraint for preservation of Nef in vivo.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Clinical and experimental observations strongly suggest that Nef is a crucial factor in HIV-1 immunopathogenesis. A cohort of persons with transfusion-acquired HIV-1 infection from a single donor were found to be infected with a Nef-defective virus and to have a slowly progressing clinical course (1, 2). Interestingly, these subjects had vigorous cellular immune responses against HIV-1 (3). This was consistent with experimental data in macaques; nef-deleted SIV induced an attenuated infection associated with immunity that was subsequently protective against wild-type SIV (4). These data strongly suggest that Nef has a central role in determining immunity and the course of infection.

Among the many functions attributed to Nef, down-regulation of MHC-I molecules on infected cells is one of the most clearly defined (5, 6, 7). Given the role of MHC-I in the function of CD8+ CTL and the growing evidence that HIV-1-specific CTL are a determinant of immune control, it has been speculated that Nef potentiates persistence of HIV-1 in the face of the CTL response by down-regulating MHC-I to render infected cells less susceptible to clearance in vivo (6, 8, 9). In vitro studies have indicated that cells infected with Nef-containing virus are relatively resistant to cytolysis by CTL (6, 9), and that replication of Nef-deleted virus is markedly more susceptible to inhibition by CTL than wild-type virus (8). These findings provide indirect evidence for the hypothesis that Nef contributes to the pathogenicity of HIV-1 infection by interfering with immunity against infected cells.

Nef is frequently targeted by MHC class I (MHC-I) 3-restricted CTL in vivo, disproportionately for its size relative to other viral proteins (10, 11). As an accessory protein, Nef is not necessarily required for HIV-1 replication, and Nef-deficient virus replicates efficiently in some cell types (8, 12). The pressures imposed by immune responses should therefore favor deletions within or disruption of the nef reading frame in vivo, given the often dominant immune pressure on the protein. However, the nef reading frame is highly maintained in vivo (2), and significant deletions or frameshifts are very rarely observed. Because viral sequence depends on the net balance between selective pressure favoring mutation and fitness costs favoring conservation (13), the fitness constraints for Nef maintenance outweigh the advantage of evading Nef-specific CTL through loss of the reading frame in vivo.

Here we hypothesize that a constraint that favors the maintenance of nef in the face of Nef-specific CTL in vivo is its role in down-regulating MHC-I and rendering infected cells relatively resistant to clearance by other CTL. We demonstrate that mutational escape of HIV-1 from Nef-specific CTL in vitro leads to progeny virions that are increased in their susceptibility to CTL-recognizing epitopes in other proteins. Evaluation of viral sequences shows that these escape mutants contain multiple nef mutations that impair the ability of the virus to down-regulate MHC-I, mostly through disruption of its reading frame. Given the rarity of such mutations in vivo, these data suggest that the ability of Nef to down-regulate MHC-I may be a key constraint for preservation of the nef reading frame in vivo.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytotoxic T lymphocytes

HIV-1-specific CTL clones were obtained by limiting dilution cloning from PBMC of infected individuals, characterized for specificity and HLA restriction, and maintained as previously described (14, 15). Clones STD11 and KM3 recognized the HLA B60-restricted epitope KEKGGLEGL in Nef (Nef aa 92–100 in relation to HXB2 sequences). 68A62 (15) recognized the A2-restricted epitope ILKEPVHGV in reverse transcriptase (aa 309–317). 161JxA14 and 18030D23 (15) recognized the HLA A2-restricted epitope SLYNTVATL in p17 Gag (p17 aa 77–85).

An HIV-1-specific CTL cell line was obtained after enrichment of CD8+ PBMC producing IFN-{gamma} in response to the peptide TQGYFPDWQNY (surface IFN-{gamma} capture kit, Miltenyi Biotec (Auburn, CA), according to the manufacturer’s protocol). These PBMC were obtained from an HLA B*1501 HIV-1-infected person who had previously been found to respond to this B*1501-restricted epitope (Nef 117–127). The line was maintained as described above and was cytolytic for H9 cells (expressing B*1501) labeled with this peptide (not shown).

HIV-1-permissive cell lines

The cell lines H9, T1, and T2 were maintained as previously described (16).

HIV-1 stocks

NL4-3 (17) variants were produced by coelectroporation of H9 cells with p83-2 and p83-10 plasmid variants linearized with EcoRI, according to the method described by Gibbs and Desrosiers (18). All plasmids were confirmed by sequencing. This approach allowed the production of a panel of NL4-3 Nef mutants (by cotransfecting p83-10 nef variants) with or without the murine CD24 reporter gene in the vpr reading frame (by cotransfecting p83-2.1CD24 or p83-2.1). Low passage virus stocks were produced by electroporation and expansion in H9 cells, harvested, and frozen in aliquots at -80°C until use. Viral titer (50% tissue culture-infectious dose (TCID50) per milliliter) was determined by end-point dilution with C8166 indicator cells as previously described (19).

Variants of p83-2

The p83-2.1 plasmid contained the consensus sequence (differences are underlined) for the commonly recognized Gag p17 epitope SLYNTVATL (20), but was otherwise identical with p83-2 (containing the sequence SLYNTIAVL) (17). The p83-2.1CD24 plasmid was produced by swapping the PflmI-EcoRI restriction fragment from the NL-r-HSAS (NL4-3-based) reporter virus containing murine CD24 in the vpr reading frame (21) into p83-2.1 (NL4-3 positions 5624–5743).

Variants of p83-10

Variants bearing different nef point mutations were produced by swapping of HpaI-AccIII fragments in the open reading frame of nef into p83-10 (positions 8651–9384). The p83-10 Nef point mutants contained PCR-amplified nef of NL4-3 variants under selective pressure from Nef-specific CTL clones STD11 and KM3, subcloned through the pCR2.1-TOPO cloning vector (Invitrogen, San Diego, CA). A p83-10 variant containing a large deletion in nef, p210–5 (18), was obtained from the National Institutes of Health AIDS Research and Reference Reagent Repository and was used to produce Nef 1–12 (containing a truncation of Nef after the first 12 aa). A p83-10 variant containing a truncation of Nef after 51 residues, Nef 1–51, was produced by a PCR-induced error. This variant contained a deletion of nucleotide 154 in nef, resulting in a frameshift after aa 51 and an early stop at aa 58.

Selection and sequencing of escape mutants

Two passages of 1 wk each were performed with HIV-1 NL4-3.1 under selective pressure from the Nef-specific CTL clones (20). T1 cells (5 x 106; HLA-matched at the HLA A2 and B60 restricting alleles of the CTL) or control cells (5 x 106; unable to present Ag to the CTL) were acutely infected and cultured with 5 x 105 CTL for each of two serial passages of 7 days each. After each passage, DNA was isolated from the cell pellets, and proviral sequences were amplified using nested PCR (25 cycles each for two amplifications) under limiting dilution. A sequence spanning nearly complete nef was amplified using outer primers AGAGCTATTCGCCACATACC (NEF8736) and TAGTTAGCCAGAGAGCTCCCA (NEF9589R), and inner primers CTATAAGATGGGTGGCAAGTG (NEF8780F) and TTATATGCAGCATCTGAGGGC (NEF9495R). Positive reactions were then PCR-sequenced using the inner primer set.

Fluorescent Abs

FITC-conjugated murine CD24-specific Ab M1/69, FITC-conjugated control IgG2b Ab clone 27-35, PE-conjugated anti-pan class I Ab clone G46-2.6, biotin-conjugated control murine IgM, and streptavidin-PE were obtained from BD PharMingen (San Diego, CA). Biotin-conjugated anti-HLA A2 IgM Ab (BIH0648) was obtained from One Lambda (Canoga Park, CA).

Assay for total class I down-regulation by Nef alone

Expression vectors expressing Nef variants were constructed using the TAP Express Fragment System (Gene Therapy Systems, San Diego, CA) according to the manufacturer’s protocol. Briefly, two-step recombinant PCR was used to link the nef alleles from the limiting dilution sequencing reactions to CMV promoter and terminator sequences. These vectors (2 µg each) were then colipofected (GenePORTER, Gene Therapy Systems) with the green fluorescence protein (GFP)-expressing vector phGFP-S65T (Clontech, Palo Alto, CA) into 293 cells. Pan MHC-I expression was determined by flow cytometric analysis of GFP-expressing cells 48 h after lipofection. Down-regulation of MHC-I was calculated by comparison to a nef negative control containing two premature stop codons.

Assay for HLA A2-down-regulation by Nef in HIV-1-infected cells

HLA A2 expression in infected cells was measured as previously described (21). T1 cells were acutely infected with NL4-3 Nef mutants containing the murine CD24 reporter gene at a multiplicity of 1 TCID50/cell. Four days after infection, the cells were costained for murine CD24 and HLA A2. Negative control isotype Abs were used to establish compensation and the negative quadrant. HLA A2 expression on infected cells was measured by calculation of the mean fluorescence intensity of A2 staining on the murine CD24-expressing cells. The effect of Nef on A2 expression was calculated by the ratio of A2 mean fluorescence intensity to that of NL4-3{Delta}Nef-infected cells. Flow cytometry and analysis were performed on a FACScan using CellQuest software (BD Biosciences, Mountain View, CA) on a G4 Power Macintosh (Apple Computer, Redmond, WA).

Inhibition of HIV-1 with varying Nef by CTL

Viral suppression assays were performed as previously described (15). Briefly, T1 cells were acutely infected with HIV-1 at a multiplicity of 0.01 TCID50/cell, followed by coculture of 5 x 105 T1 cells with 1.25 x 105 CTL clone 68A62. Supernatant was harvested for quantitative p24 Ag ELISA (DuPont, Boston, MA) and was replaced at the indicated time points.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HIV-1 escape from the selective pressure of Nef-specific CTL is associated with increased susceptibility to other CTL

Because Nef has been proposed to mediate resistance of HIV-1 to CTL by down-modulating class I molecules (6, 8, 9), we investigated whether escape of virus from Nef-specific CTL in vitro altered viral susceptibility to CTL of other specificities. The molecular clone HIV-1 NL4-3.1 was passaged under selective pressure in the presence of two Nef-specific CTL clones (KM3 and STD11, isolated from different infected individuals). Viruses that had been passaged in T1 cells under selection for 7 or 14 days and parallel negative control virus (cultured in the TAP-deficient derivative of T1 cells, T2 cells unable to present Ag to the clones) were then tested for susceptibility to the same Nef-specific clones and to CTL recognizing epitopes in reverse transcriptase and Gag (Fig. 1). The four viruses (two time points for each CTL clone) that had been passaged under selection by either Nef-specific clone were almost entirely resistant to inhibition by both Nef-specific clones, whereas control viruses were highly suppressed (Fig. 1, KM3 and STD11), indicating selective resistance to the selecting CTL. In contrast, these viruses were ~10-fold more susceptible to inhibition by Gag- and reverse transcriptase-specific CTL clones compared with negative control viruses (Fig. 1, 161JxA14, 18030D23, and 68A62). Because Nef reduces the susceptibility of HIV-1 to suppression by CTL in this assay (8), these data suggested that the escape mutations may interfere with the ability of Nef to mediate viral resistance to CTL of other specificities.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. Susceptibility of Nef-specific CTL-selected HIV-1 to other CTL. HIV-1 NL4-3.1 that was previously passaged under selective pressure by two Nef-specific CTL clones (KM3 and STD11) for 7 or 14 days in vitro and parallel negative control viruses were tested for susceptibility to inhibition by the Nef-specific CTL (KM3 and STD11) and three other CTL clones recognizing epitopes in reverse transcriptase (68A62) and Gag (161JxA14 and 18030D23). Inhibition of these viruses (compared with no added CTL, in log10 units) on day 7 is plotted. The results reflect the mean values for tests of each of these four experimental and four control viruses (selection by two clones for two time points each); error bars represent 1 SD. Replication of the escape and negative control viruses was similar (4.71 ± 0.46 vs 4.52 ± 0.28 log10 units of p24 Ag in picograms per milliliter on day 7 after infection).

 
Virions escaped from Nef-specific CTL in vitro tend to have nef reading frame disruptions as well as epitope mutations

To evaluate the cause of this functional alteration after selection by Nef-specific CTL, we examined the nef reading frame in these escaped viruses. Clonal sequencing was performed for the viruses passaged under pressure by the Nef-specific CTL clones STD11 and KM3 as well as the negative control viruses. Virus passaged under selective pressure by the two clones (tested in Fig. 1) contained numerous nef mutations (Table I), while the parallel negative control viruses contained none (24 of 24 sequences). Nearly all nef sequences in virus passaged under selection for 7 days were variant (94.4%, 34 of 36 sequences after the first passage), and all contained mutations after 14 days (100%, 36 of 36 sequences after the second passage).


View this table:
[in this window]
[in a new window]
 
Table I. Nef mutations selected by CTL clones KM3 and STD11 within 14 days of passagea

 
Several classes of Nef mutations emerged under selection by these clones (Table I). Multiple sequences contained substitution point mutations within the epitope targeted by the Nef-specific CTL (33.3%, 24 of 72 sequences obtained) that altered residues in the MHC-binding anchor residues (glutamic acid at the second or leucine at the ninth epitope positions, 20.8%, 15 of 72) or the central TCR-binding region (12.5%, 9 of 72). The most frequent changes observed were frameshift deletion and insertion mutations exclusively upstream of the epitope (62.5%, 45 of 72), the majority of which were single additions or deletions in stretches of multiple adenosines or thymidines (not shown). This group of mutations was dominated by a single deletion, leading to a frameshift and stop codon just before the epitope (38.9%, 28 of 72). All the frameshifts resulted in functional deletion of the entire epitope and much of Nef. An early stop substitution mutation upstream of the epitope was also identified (1.4%, 1 of 72).

The percentage of epitope point mutations appeared to increase over time. Nef sequences after the first 7 days of selection contained 8 of 36 (22%) point mutations and 26 of 36 (72%) reading frame disruptions, while sequences after 14 days of selection contained 16 of 36 (44%) point mutations and 20 of 36 (56%) reading frame disruptions (not shown). This suggested a possible selective advantage for point mutants vs gross Nef disruption in our system.

A CTL line recognizing a different Nef epitope also selected escape virus containing nef reading frame disruptions (Table II). Of 15 clonal sequences evaluated, 7 demonstrated upstream frameshifts or stop substitutions after 1 wk of passaging. The most common mutation selected by CTL recognizing this epitope was the same as the most common escape mutation selected by the two above clones: a deletion inducing an early stop codon at position 91 of Nef. Another mutation observed for the other CTL clones, a nonsense mutation leading to an early stop at position 35, was also selected. The negative control sequences remained unchanged (10 of 10). Thus, changes selected by the tested Nef-specific CTL in vitro generally specifically favored either epitope alteration or its functional deletion by truncating/frameshifting nef.


View this table:
[in this window]
[in a new window]
 
Table II. Nef mutations selected by a TY11 Nef-specific CTL line after 7 days of passagea

 
Nef mediates down-regulation of MHC-I in HIV-1-infected cells

Nef has been proposed in several studies to decrease MHC-I expression in infected cells, and this effect was evaluated in our system by comparing molecular clones based on NL4-3. T1 cells (expressing the MHC-I molecule A2) were acutely infected with reporter HIV-1 containing wild-type Nef or Nef truncated after the first 12 residues (Nef 1–12), and costained for the reporter protein and A2 (Fig. 2). Compared with uninfected cells and Nef 1–12-infected cells, wild-type Nef induced heavy loss of cell surface A2 (86.4 ± 4.0%). Three other Nef variants were tested in parallel. Two substitution point mutants, including E93G (glutamic acid to glycine change at aa 93) and E93K (glutamic acid to lysine change at aa 93), and another truncation mutant, Nef 1–51, were also tested. Using infection with Nef 1–12 as the baseline for A2 expression, wild-type Nef down-regulated A2 by 73.8 ± 7.2%, E93G by 48.1 ± 16.8%, E93K by 42.9 ± 8.2%, and Nef 1–51 by 12.5 ± 16.8%. These data demonstrated that expression of Nef in the context of HIV-1 expression of T cells reduces MHC-I expression by infected cells, and that this effect is highly dependent on the intact nef reading frame.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 2. Down-regulation of HLA A2 by Nef in 1-infected T1 cells. HLA A2 expression was monitored in T1 cells infected by reporter viruses containing wild-type Nef and Nef deletion (Nef 1–12) by two-color flow cytometric measurement of cell surface murine CD24 reporter and MHC-I A2 molecules. Dot plots of cells stained 4 days after high multiplicity infection are shown.

 
The majority of escape virions are impaired in Nef-mediated down-regulation of MHC-I

In light of the potentially important role of MHC-I down-regulation by Nef for mediating resistance of HIV-1 to the antiviral effects of CTL (6, 8, 9), we used a rapid screening assay to evaluate several of the Nef mutations listed in Table I. This assay measured total MHC-I expression in acutely nef-transfected cells. As might be expected, most tested nef insertion and deletion frameshift mutations demonstrated markedly reduced MHC-I down-regulation compared with wild type, although surprisingly one insertion frameshift (leading to truncation after 110 aa) maintained ~73% activity compared with intact nef. Interestingly, a glutamic acid to arginine substitution at position 93 in this mutant apparently potentiated preservation of activity by truncated Nef, because this was the only difference from the other insertion frameshift mutation that maintained only ~13% activity. The most commonly noted frameshift (38.9%, 28 of 72 sequences), a deletion, was associated with a loss of activity to 19%. Notably, two of the seven tested point mutations within the epitope (G99E and G99R) also disrupted MHC-I down-regulation to 50% or less that of wild-type Nef despite the fact that this region of Nef (aa 92–100) is not known to have a direct role in class I effects (22, 23, 24). The E93G and E93K mutants were unimpaired in their MHC-I effects in this system, somewhat in contrast to our above results using whole HIV-1 constructs (differences probably due to overexpression of Nef and pan-MHC-I staining in this assay). Of all the Nef-specific CTL-selected variant sequences tested, ~62% (37 of 60) of the variants lost at least 50% of MHC-I down-modulatory function compared with wild type, indicating that viral escape from these CTL in vitro was commonly associated with functional impairment in this respect.

Loss of Nef renders HIV-1 relatively susceptible to suppression by CTL

To confirm the impact of Nef on the ability of CTL to suppress HIV-1 replication in acutely infected cells, we cocultured cells infected with the panel of NL4-3-based viruses expressing intact or truncated Nef tested above for A2 down-regulation. The three viruses containing intact Nef (wild type, E93K, and E98K) each were inhibited by ~10-fold by a reverse transcriptase-specific CTL clone (Fig. 3, A–C). The two viruses containing truncated Nef (Nef 1–12 and Nef 1–51) were inhibited by ~1000-fold (Fig. 3, D and E). Overall, the Nef-intact viruses were suppressed by 1.18 ± 0.10 log10 units compared with 2.93 ± 0.08 log10 units for the Nef-disrupted viruses (mean ± SD on day 8), confirming the direct impact of Nef on the antiviral activity of CTL (6, 8, 9) that depends on an intact nef reading frame.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 3. Role of Nef in HIV-1 suppression by CTL. Several HIV-1 NL4-3 Nef variants were tested for their susceptibility to inhibition by a reverse transcriptase-specific CTL clone. Those with an intact nef reading frame included wild type, E to K mutation at position 93 (E93K), and E to K mutation at position 98 (E98K). Those with disrupted nef included a virus with a large deletion leading to truncation after the first 12 aa (Nef 1–12) and one with a frameshift leading to truncation after the first 51 aa (Nef 1–51). Viral replication of each virus as reflected by p24 Ag production over time, with and without CTL, is shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although HIV-1-specific CTL are believed to be a key component of protective immunity (reviewed in Ref.25), the mechanisms of CTL failure are poorly understood. Despite vigorous HIV-1-specific CTL responses in most infected subjects, viral replication generally persists and eventually overwhelms the host. Among proposed contributors to immune failure of viral containment are escape mutations in CTL epitopes (25) and Nef-mediated resistance of infected cells to CTL (6, 8, 9). This study addresses the concept that these two mechanisms may have an interaction in the case of Nef-specific CTL.

CTL pressure in vivo has been shown to result in specific HIV-1 mutations resulting in reduced recognition and therefore escape. Because the interaction of the TCR with the epitope/MHC-I complex is highly specific, minor alterations of the epitope sequence can ablate recognition easily (26). However, fitness costs for such potential escape mutations limit the observed escape variants selected by CTL (27). In the case of structural proteins such as Gag, these fitness costs are obvious, because viral replication is constrained by the physical requirements for these proteins. Single amino acid substitutions in Gag, for example, can completely ablate HIV-1 replication (28), yet structural protein epitope escape mutations observed in vivo are usually oligo- or monoclonal (29, 30).

The fitness costs and constraints are less obvious in the case of changes in Nef. Although a relatively small HIV-1 protein, Nef is disproportionately targeted by CTL (10, 11). However, its requirement for replication is not absolute, and virus lacking Nef replicates efficiently in several culture systems (8, 12). Yet, the nef reading frame is highly maintained in vivo (2, 31). Escape from CTL appears to occur predominantly through sequence variation (32), and even in a case where reinfusion of expanded autologous Nef-specific CTL resulted in extreme selective pressure that favored epitope deletion, the reading frame was maintained (33). This suggests that changes in Nef are also highly constrained, and since Nef does not play a direct important structural role for HIV-1, some function(s) of this protein must be important for viral persistence in vivo.

Among the effects attributed to Nef, down-modulation of MHC-I molecules on the surface of infected cells is well documented and has been proposed to have a significant impact on the function of HIV-1-specific CTL. Although the precise mechanism remains elusive, Nef appears to selectively reduce the MHC-I A and B molecules used most frequently for epitope presentation to CTL (while leaving levels of C molecules unperturbed, presumably protecting infected cells from clearance by NK lymphocytes) (7). Experimental models of the interaction of HIV-1-specific CTL and infected cells have shown that this down-modulation renders infected cells relatively resistant to cytolysis (6, 9), and that Nef reduces the antiviral efficiency of CTL (20). Nef is therefore believed to mediate the evasion of HIV-1-infected cells from clearance by CTL, thereby promoting the persistence of the virus despite cellular immunity. Through its effects on MHC-I, Nef probably reduces the overall cellular immune pressure of CTL on the virus. This could thus be an important enhancement of viral fitness and a reason for the maintenance of the nef reading frame in vivo.

When we applied Nef-specific CTL-mediated immune pressure in HIV-1 in vitro, the majority of the escape mutations disrupted the MHC-I down-regulatory function of Nef. Many of these mutations were deletional or insertional frameshifts that disrupted the nef reading frame, including the recognized epitope. Given that this gene is not needed for efficient viral replication in our in vitro culture system (8), the gross disruption of its reading frame is a direct method to escape the Nef-specific CTL with little or no fitness cost. As might be expected, this strategy resulted in loss of Nef-mediated down-regulation of MHC-I, because many of these disruptions deleted known motifs in Nef reported to be important for this function (22, 23, 24). Interestingly, some epitope point mutations in Nef appeared to have effects on MHC-I down-regulation despite the fact that neither of the CTL epitopes studied contained motifs known to be functionally important (22, 23, 24). A rapid screening assay expected to be less sensitive (due to overexpression of Nef and measurement of pan MHC-I expression including C molecules) still revealed that some of these point mutants were impaired by 50% or more. Using a more physiologic system based on whole HIV-1 infection and measurement of the A2 molecule, we also found that some Nef mutants that appeared normal by the rapid assay were still less efficient than wild-type Nef. These data therefore suggested that many potential escape mutations that occur in vitro impair the ability of Nef to down-regulate MHC-I. The majority of these mutations (nef reading frame disruptions) tend not to occur in vivo (31), suggesting that this function of Nef may be an important selective pressure for its maintenance in vivo. The markedly increased susceptibility of the escaped viruses to in vitro suppression by CTL observed here provides further support for this hypothesis.

Evaluation of the sequences of HIV-1 escaping Nef-specific CTL also suggested that escaped Nef point mutants might have an advantage over those with grossly disrupted Nef, even in the absence of selective pressure by CTL of non-Nef specificity. Over two rounds of selection by Nef-specific CTL, the polyclonal population of escaped virus appeared to evolve to favor point mutants. Although more comparisons would be required to confirm this finding, it suggests that either Nef provides a slight direct growth advantage in our in vitro system, or that Nef-mediated MHC-I down-regulation affects recognition by Nef-specific CTL. The latter case would imply that despite likely earlier recognition of infected cells by Nef-specific CTL (compared with CTL recognizing later proteins such as Gag and Pol), infected cell clearance still does not precede Nef-mediated down-regulation of MHC-I.

One of the escape point mutants (E93K) from CTL clone STD11 that was among the least impaired in MHC-I down-regulation predominates in vivo in the subject from whom the selecting clone was isolated (2) despite being a minor variant among escape sequences in vitro. Several of the other point mutants selected by the same clone were more highly impaired in MHC-I effects, suggesting a possible selective advantage to maintaining this function in vivo. It is not clear to what extent other factors might play a role in determining the predominance of this particular variant, such as the degree of cross-recognition by STD11 or other clones. Our in vitro suppression assay did not detect a difference between suppression of virus with wild-type or E93K Nef by a reverse transcriptase-specific CTL clone, indicating either that the assay was not sensitive enough to detect a functional survival disadvantage from the difference in MHC-I down-regulation, or that the difference in MHC-I down-regulation is not functionally significant.

It is important to note that Nef has also been reported to mediate numerous other functions, including down-regulation of CD4 (34, 35), enhancement of virion infectivity (36, 37), and interaction with cellular activation pathways (38, 39, 40, 41, 42, 43, 44). The use of transformed cells in our studies reduces or bypasses the contributions of these functions to viral replication compared with those in primary cells. For example, in primary T cells, Nef clearly augments viral replication (45), in contrast to the immortalized cell lines used in our study. Thus, our data do not exclude a role for other functions in providing selective pressure to maintain Nef in vivo, and it is, in fact, most likely that the preservation of Nef is multifactorial. It is therefore likely that MHC-I down-regulation is one of several contributing factors to the pressure to conserve nef.

As a whole, these data suggest that Nef-mediated MHC-I down-regulation is an important factor in reducing CTL pressure against HIV-1, and that escape from Nef-specific CTL is constrained by loss of MHC-I down-regulatory function and increased susceptibility to other CTL. A possible implication of these findings is that Nef may be an attractive target for vaccines or immunotherapies. Other recent data (46) have suggested that Nef-specific CTL may exert greater antiviral effects than CTL recognizing later proteins and may therefore provide greater pressure against HIV-1. Coupled with the importance of Nef in viral evasion of the CTL response in general, directing CTL toward Nef may be a means to focus greater pressure on regions with crucial fitness constraints due to its central importance for HIV-1 persistence in vivo.


    Acknowledgments
 
We thank Phuong Thi Nguyen Sarkis for her expert technical assistance, and Bruce D. Walker and Spyros A. Kalams for providing CTL clones. Recombinant IL-2 was provided by the National Institutes of Health AIDS Research and Reference Reagent Repository.


    Footnotes
 
1 This work was supported by National Institute of Allergy and Infectious Disease Grants AI051970 and AI043203, and a seed grant from the University of California-Los Angeles AIDS Institute. Back

2 Address correspondence and reprint requests to Dr. Otto O. Yang, Division of Infectious Diseases, 37-121 CHS, University of California Medical Center, 10833 LeConte Avenue, Los Angeles, CA 90095. E-mail address: oyang{at}mednet.ucla.edu Back

3 Abbreviations used in this paper: MHC-I, MHC class I; GFP, green fluorescence protein; TCID50, 50% tissue culture-infectious dose. Back

Received for publication June 13, 2003. Accepted for publication August 14, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Oelrichs, R., A. Tsykin, D. Rhodes, A. Solomon, A. Ellett, D. McPhee, N. Deacon. 1998. Genomic sequence of HIV type 1 from four members of the Sydney Blood Bank Cohort of long-term nonprogressors. AIDS Res. Hum. Retroviruses 14:811.[Medline]
  2. Alexander, L., E. Weiskopf, T. C. Greenough, N. C. Gaddis, M. R. Auerbach, M. H. Malim, S. J. O’Brien, B. D. Walker, J. L. Sullivan, R. C. Desrosiers. 2000. Unusual polymorphisms in human immunodeficiency virus type 1 associated with nonprogressive infection. J. Virol. 74:4361.[Abstract/Free Full Text]
  3. Dyer, W. B., G. S. Ogg, M. A. Demoitie, X. Jin, A. F. Geczy, S. L. Rowland-Jones, A. J. McMichael, D. F. Nixon, J. S. Sullivan. 1999. Strong human immunodeficiency virus (HIV)-specific cytotoxic T-lymphocyte activity in Sydney Blood Bank Cohort patients infected with nef-defective HIV type 1. J. Virol. 73:436.[Abstract/Free Full Text]
  4. Kestler, H. W. d., D. J. Ringler, K. Mori, D. L. Panicali, P. K. Sehgal, M. D. Daniel, R. C. Desrosiers. 1991. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 65:651.[Medline]
  5. Schwartz, O., V. Marechal, S. Le Gall, F. Lemonnier, J. M. Heard. 1996. Endocytosis of major histocompatibility complex class I molecules is induced by the HIV-1 Nef protein. Nat. Med. 2:338.[Medline]
  6. Collins, K. L., B. K. Chen, S. A. Kalams, B. D. Walker, D. Baltimore. 1998. HIV-1 Nef protein protects infected primary cells against killing by cytotoxic T lymphocytes. Nature 391:397.[Medline]
  7. Cohen, G. B., R. T. Gandhi, D. M. Davis, O. Mandelboim, B. K. Chen, J. L. Strominger, D. Baltimore. 1999. The selective downregulation of class I major histocompatibility complex proteins by HIV-1 protects HIV-infected cells from NK cells. Immunity 10:661.[Medline]
  8. Yang, O. O., P. T. Nguyen, S. A. Kalams, T. Dorfman, H. G. Gottlinger, S. Stewart, I. S. Chen, S. Threlkeld, B. D. Walker. 2002. Nef-mediated resistance of human immunodeficiency virus type 1 to antiviral cytotoxic T lymphocytes. J. Virol. 76:1626.[Abstract/Free Full Text]
  9. Tomiyama, H., H. Akari, A. Adachi, M. Takiguchi. 2002. Different effects of Nef-mediated HLA class I down-regulation on human immunodeficiency virus type 1-specific CD8+ T-cell cytolytic activity and cytokine production. J. Virol. 76:7535.[Abstract/Free Full Text]
  10. Altfeld, M., M. M. Addo, R. L. Eldridge, X. G. Yu, S. Thomas, A. Khatri, D. Strick, M. N. Phillips, G. B. Cohen, S. A. Islam, et al 2001. Vpr is preferentially targeted by CTL during HIV-1 infection. J. Immunol. 167:2743.[Abstract/Free Full Text]
  11. Addo, M. M., M. Altfeld, E. S. Rosenberg, R. L. Eldridge, M. N. Philips, K. Habeeb, A. Khatri, C. Brander, G. K. Robbins, G. P. Mazzara, et al 2001. The HIV-1 regulatory proteins Tat and Rev are frequently targeted by cytotoxic T lymphocytes derived from HIV-1-infected individuals. Proc. Natl. Acad. Sci. USA 98:1781.[Abstract/Free Full Text]
  12. Cullen, B. R.. 1998. HIV-1 auxiliary proteins: making connections in a dying cell. Cell 93:685.[Medline]
  13. Coffin, J. M.. 1995. HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy. Science 267:483.
  14. Walker, B. D., C. Flexner, K. Birch-Limberger, L. Fisher, T. J. Paradis, A. Aldovini, R. Young, B. Moss, R. T. Schooley. 1989. Long-term culture and fine specificity of human cytotoxic T-lymphocyte clones reactive with human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA 86:9514.[Abstract/Free Full Text]
  15. Yang, O. O., S. A. Kalams, A. Trocha, H. Cao, A. Luster, R. P. Johnson, B. D. Walker. 1997. Suppression of human immunodeficiency virus type 1 replication by CD8+ cells: evidence for HLA class I-restricted triggering of cytolytic and noncytolytic mechanisms. J. Virol. 71:3120.[Abstract]
  16. Yang, O. O., S. A. Kalams, M. Rosenzweig, A. Trocha, N. Jones, M. Koziel, B. D. Walker, R. P. Johnson. 1996. Efficient lysis of human immunodeficiency virus type 1-infected cells by cytotoxic T lymphocytes. J. Virol. 70:5799.[Abstract]
  17. Adachi, A., H. E. Gendelman, S. Koenig, T. Folks, R. Willey, A. Rabson, M. A. Martin. 1986. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol. 59:284.[Abstract/Free Full Text]
  18. Gibbs, J. S., D. A. Regier, R. C. Desrosiers. 1994. Construction and in vitro properties of HIV-1 mutants with deletions in "nonessential" genes. AIDS Res. Hum. Retroviruses 10:343.[Medline]
  19. Johnson, V. A., B. D. Walker. 1990. HIV-infected cell fusion assay. A. Aldovini, and B. D. Walker, eds. Techniques in HIV Research 92. Stockton Press, New York.
  20. Yang, O. O., P. T. Nguyen-Sarkis, A. Ali, J. D. Harlow, C. Brander, S. A. Kalams, B. D. Walker. 2003. Determinants of HIV-1 mutational escape from cytotoxic T lymphocytes. J. Exp. Med. 197:1365.-1375. [Abstract/Free Full Text]
  21. Jamieson, B. D., J. A. Zack. 1998. In vivo pathogenesis of a human immunodeficiency virus type 1 reporter virus. J. Virol. 72:6520.[Abstract/Free Full Text]
  22. Greenberg, M. E., A. J. Iafrate, J. Skowronski. 1998. The SH3 domain-binding surface and an acidic motif in HIV-1 Nef regulate trafficking of class I MHC complexes. EMBO J. 17:2777.[Medline]
  23. Mangasarian, A., V. Piguet, J. K. Wang, Y. L. Chen, D. Trono. 1999. Nef-induced CD4 and major histocompatibility complex class I (MHC-I) down-regulation are governed by distinct determinants: N-terminal {alpha} helix and proline repeat of Nef selectively regulate MHC-I trafficking. J. Virol. 73:1964.[Abstract/Free Full Text]
  24. Piguet, V., D. Trono. 1999. A structure-function analysis of the nef protein of primate lentiviruses. C. Kuiken, and B. Foley, and B. Hahn, and P. Marx, and F. McCutchan, and J. Mellors, and J. Mullins, and S. Wolinsky, and B. Korber, eds. Human Retroviruses and AIDS 1999 448. Los Alamos National Laboratory, Los Alamos.
  25. Yang, O. O., B. D. Walker. 1997. CD8+ cells in human immunodeficiency virus type I pathogenesis: cytolytic and noncytolytic inhibition of viral replication. Adv. Immunol. 66:273.[Medline]
  26. Eisen, H. N., Y. Sykulev, T. J. Tsomides. 1996. Antigen-specific T-cell receptors and their reactions with complexes formed by peptides with major histocompatibility complex proteins. Adv. Protein Chem. 49:1.[Medline]
  27. Kelleher, A. D., C. Long, E. C. Holmes, R. L. Allen, J. Wilson, C. Conlon, C. Workman, S. Shaunak, K. Olson, P. Goulder, et al 2001. Clustered mutations in HIV-1 gag are consistently required for escape from HLA-B27-restricted cytotoxic T lymphocyte responses. J. Exp. Med. 193:375.[Abstract/Free Full Text]
  28. Freed, E. O., J. M. Orenstein, A. J. Buckler-White, M. A. Martin. 1994. Single amino acid changes in the human immunodeficiency virus type 1 matrix protein block virus particle production. J. Virol. 68:5311.[Abstract/Free Full Text]
  29. Phillips, R. E., S. Rowland-Jones, D. F. Nixon, F. M. Gotch, J. P. Edwards, A. O. Ogunlesi, J. G. Elvin, J. A. Rothbard, C. R. Bangham, C. R. Rizza, et al 1991. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature 354:453.[Medline]
  30. Borrow, P., H. Lewicki, X. Wei, M. S. Horwitz, N. Peffer, H. Meyers, J. A. Nelson, J. E. Gairin, B. H. Hahn, M. B. Oldstone, et al 1997. Antiviral pressure exerted by HIV-1-specific cytotoxic T lymphocytes (CTLs) during primary infection demonstrated by rapid selection of CTL escape virus. Nat. Med. 3:205.[Medline]
  31. Kuiken, C. L., B. Foley, B. Hahn, B. Korber, P. A. Marx, F. McCutchan, J. W. Mellors, S. Wolinsky. 2001. HIV Sequence Compendium 2001 Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, LA-UR 02–2877.
  32. Couillin, I., B. Culmann-Penciolelli, E. Gomard, J. Choppin, J. P. Levy, J. G. Guillet, S. Saragosti. 1994. Impaired cytotoxic T lymphocyte recognition due to genetic variations in the main immunogenic region of the human immunodeficiency virus 1 NEF protein. J. Exp. Med. 180:1129.[Abstract/Free Full Text]
  33. Koenig, S., A. J. Conley, Y. A. Brewah, G. M. Jones, S. Leath, L. J. Boots, V. Davey, G. Pantaleo, J. F. Demarest, C. Carter, et al 1995. Transfer of HIV-1-specific cytotoxic T lymphocytes to an AIDS patient leads to selection for mutant HIV variants and subsequent disease progression. Nat. Med. 1:330.[Medline]
  34. Aiken, C., J. Konner, N. R. Landau, M. E. Lenburg, D. Trono. 1994. Nef induces CD4 endocytosis: requirement for a critical dileucine motif in the membrane-proximal CD4 cytoplasmic domain. Cell 76:853.[Medline]
  35. Bandres, J. C., A. S. Shaw, L. Ratner. 1995. HIV-1 Nef protein downregulation of CD4 surface expression: relevance of the lck binding domain of CD4. Virology 207:338.[Medline]
  36. Chowers, M. Y., M. W. Pandori, C. A. Spina, D. D. Richman, J. C. Guatelli. 1995. The growth advantage conferred by HIV-1 nef is determined at the level of viral DNA formation and is independent of CD4 downregulation. Virology 212:451.[Medline]
  37. Miller, M. D., M. T. Warmerdam, I. Gaston, W. C. Greene, M. B. Feinberg. 1994. The human immunodeficiency virus-1 nef gene product: a positive factor for viral infection and replication in primary lymphocytes and macrophages. J. Exp. Med. 179:101.[Abstract/Free Full Text]
  38. Baur, A. S., E. T. Sawai, P. Dazin, W. J. Fantl, C. Cheng-Mayer, B. M. Peterlin. 1994. HIV-1 Nef leads to inhibition or activation of T cells depending on its intracellular localization. Immunity 1:373.[Medline]
  39. Bodeus, M., A. Marie-Cardine, C. Bougeret, F. Ramos-Morales, R. Benarous. 1995. In vitro binding and phosphorylation of human immunodeficiency virus type 1 Nef protein by serine/threonine protein kinase. J. Gen. Virol. 76:1337.[Abstract/Free Full Text]
  40. Du, Z., S. M. Lang, V. G. Sasseville, A. A. Lackner, P. O. Ilyinskii, M. D. Daniel, J. U. Jung, R. C. Desrosiers. 1995. Identification of a nef allele that causes lymphocyte activation and acute disease in macaque monkeys. Cell 82:665.[Medline]
  41. Graziani, A., F. Galimi, E. Medico, E. Cottone, D. Gramaglia, C. Boccaccio, P. M. Comoglio. 1996. The HIV-1 nef protein interferes with phosphatidylinositol 3-kinase activation 1. J. Biol. Chem. 271:6590.[Abstract/Free Full Text]
  42. Saksela, K., G. Cheng, D. Baltimore. 1995. Proline-rich (PxxP) motifs in HIV-1 Nef bind to SH3 domains of a subset of Src kinases and are required for the enhanced growth of Nef+ viruses but not for down-regulation of CD4. EMBO J. 14:484.[Medline]
  43. Sawai, E. T., A. Baur, H. Struble, B. M. Peterlin, J. A. Levy, C. Cheng-Mayer. 1994. Human immunodeficiency virus type 1 Nef associates with a cellular serine kinase in T lymphocytes. Proc. Natl. Acad. Sci. USA 91:1539.[Abstract/Free Full Text]
  44. Smith, B. L., B. W. Krushelnycky, D. Mochly-Rosen, P. Berg. 1996. The HIV nef protein associates with protein kinase C{theta}. J. Biol. Chem. 271:16753.[Abstract/Free Full Text]
  45. Spina, C. A., T. J. Kwoh, M. Y. Chowers, J. C. Guatelli, D. D. Richman. 1994. The importance of nef in the induction of human immunodeficiency virus type 1 replication from primary quiescent CD4 lymphocytes. J. Exp. Med. 179:115.[Abstract/Free Full Text]
  46. van Baalen, C. A., C. Guillon, M. Baalen Mv, E. J. Verschuren, P. H. Boers, A. D. Osterhaus, R. A. Gruters. 2002. Impact of antigen expression kinetics on the effectiveness of HIV-specific cytotoxic T lymphocytes. Eur. J. Immunol. 32:2644.[Medline]



This article has been cited by other articles:


Home page
J. Virol.Home page
N. J. Maness, L. J. Yant, C. Chung, J. T. Loffredo, T. C. Friedrich, S. M. Piaskowski, J. Furlott, G. E. May, T. Soma, E. J. Leon, et al.
Comprehensive Immunological Evaluation Reveals Surprisingly Few Differences between Elite Controller and Progressor Mamu-B*17-Positive Simian Immunodeficiency Virus-Infected Rhesus Macaques
J. Virol., June 1, 2008; 82(11): 5245 - 5254.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. J. Lewis, A. Balamurugan, A. Ohno, S. Kilpatrick, H. L. Ng, and O. O. Yang
Functional Adaptation of Nef to the Immune Milieu of HIV-1 Infection In Vivo
J. Immunol., March 15, 2008; 180(6): 4075 - 4081.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Ueno, C. Motozono, S. Dohki, P. Mwimanzi, S. Rauch, O. T. Fackler, S. Oka, and M. Takiguchi
CTL-Mediated Selective Pressure Influences Dynamic Evolution and Pathogenic Functions of HIV-1 Nef
J. Immunol., January 15, 2008; 180(2): 1107 - 1116.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. M. Noviello, S. L. K. Pond, M. J. Lewis, D. D. Richman, S. K. Pillai, O. O. Yang, S. J. Little, D. M. Smith, and J. C. Guatelli
Maintenance of Nef-Mediated Modulation of Major Histocompatibility Complex Class I and CD4 after Sexual Transmission of Human Immunodeficiency Virus Type 1
J. Virol., May 1, 2007; 81(9): 4776 - 4786.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Adnan, A. Balamurugan, A. Trocha, M. S. Bennett, H. L. Ng, A. Ali, C. Brander, and O. O. Yang
Nef interference with HIV-1-specific CTL antiviral activity is epitope specific
Blood, November 15, 2006; 108(10): 3414 - 3419.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Kan-Mitchell, M. Bajcz, K. L. Schaubert, D. A. Price, J. M. Brenchley, T. E. Asher, D. C. Douek, H. L. Ng, O. O. Yang, C. R. Rinaldo Jr., et al.
Degeneracy and Repertoire of the Human HIV-1 Gag p1777-85 CTL Response.
J. Immunol., June 1, 2006; 176(11): 6690 - 6701.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. J. Geels, S. A. Dubey, K. Anderson, E. Baan, M. Bakker, G. Pollakis, W. A. Paxton, J. W. Shiver, and J. Goudsmit
Broad Cross-Clade T-Cell Responses to Gag in Individuals Infected with Human Immunodeficiency Virus Type 1 Non-B Clades (A to G): Importance of HLA Anchor Residue Conservation
J. Virol., September 1, 2005; 79(17): 11247 - 11258.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ali, A.
Right arrow Articles by Yang, O. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ali, A.
Right arrow Articles by Yang, O. O.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS