|
|
||||||||





* Department of Medicine and AIDS Institute, Center for Health Sciences, University of California, Los Angeles, CA 90095;
Department of Medicine, University of California San Diego, La Jolla, CA 92093; and
Fred Hutchinson Cancer Research Center, University of Washington, Seattle, WA 98109
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Among the many functions attributed to Nef, down-regulation of MHC-I molecules on infected cells is one of the most clearly defined (5, 6, 7). Given the role of MHC-I in the function of CD8+ CTL and the growing evidence that HIV-1-specific CTL are a determinant of immune control, it has been speculated that Nef potentiates persistence of HIV-1 in the face of the CTL response by down-regulating MHC-I to render infected cells less susceptible to clearance in vivo (6, 8, 9). In vitro studies have indicated that cells infected with Nef-containing virus are relatively resistant to cytolysis by CTL (6, 9), and that replication of Nef-deleted virus is markedly more susceptible to inhibition by CTL than wild-type virus (8). These findings provide indirect evidence for the hypothesis that Nef contributes to the pathogenicity of HIV-1 infection by interfering with immunity against infected cells.
Nef is frequently targeted by MHC class I (MHC-I) 3-restricted CTL in vivo, disproportionately for its size relative to other viral proteins (10, 11). As an accessory protein, Nef is not necessarily required for HIV-1 replication, and Nef-deficient virus replicates efficiently in some cell types (8, 12). The pressures imposed by immune responses should therefore favor deletions within or disruption of the nef reading frame in vivo, given the often dominant immune pressure on the protein. However, the nef reading frame is highly maintained in vivo (2), and significant deletions or frameshifts are very rarely observed. Because viral sequence depends on the net balance between selective pressure favoring mutation and fitness costs favoring conservation (13), the fitness constraints for Nef maintenance outweigh the advantage of evading Nef-specific CTL through loss of the reading frame in vivo.
Here we hypothesize that a constraint that favors the maintenance of nef in the face of Nef-specific CTL in vivo is its role in down-regulating MHC-I and rendering infected cells relatively resistant to clearance by other CTL. We demonstrate that mutational escape of HIV-1 from Nef-specific CTL in vitro leads to progeny virions that are increased in their susceptibility to CTL-recognizing epitopes in other proteins. Evaluation of viral sequences shows that these escape mutants contain multiple nef mutations that impair the ability of the virus to down-regulate MHC-I, mostly through disruption of its reading frame. Given the rarity of such mutations in vivo, these data suggest that the ability of Nef to down-regulate MHC-I may be a key constraint for preservation of the nef reading frame in vivo.
| Materials and Methods |
|---|
|
|
|---|
HIV-1-specific CTL clones were obtained by limiting dilution cloning from PBMC of infected individuals, characterized for specificity and HLA restriction, and maintained as previously described (14, 15). Clones STD11 and KM3 recognized the HLA B60-restricted epitope KEKGGLEGL in Nef (Nef aa 92100 in relation to HXB2 sequences). 68A62 (15) recognized the A2-restricted epitope ILKEPVHGV in reverse transcriptase (aa 309317). 161JxA14 and 18030D23 (15) recognized the HLA A2-restricted epitope SLYNTVATL in p17 Gag (p17 aa 7785).
An HIV-1-specific CTL cell line was obtained after enrichment of CD8+ PBMC producing IFN-
in response to the peptide TQGYFPDWQNY (surface IFN-
capture kit, Miltenyi Biotec (Auburn, CA), according to the manufacturers protocol). These PBMC were obtained from an HLA B*1501 HIV-1-infected person who had previously been found to respond to this B*1501-restricted epitope (Nef 117127). The line was maintained as described above and was cytolytic for H9 cells (expressing B*1501) labeled with this peptide (not shown).
HIV-1-permissive cell lines
The cell lines H9, T1, and T2 were maintained as previously described (16).
HIV-1 stocks
NL4-3 (17) variants were produced by coelectroporation of H9 cells with p83-2 and p83-10 plasmid variants linearized with EcoRI, according to the method described by Gibbs and Desrosiers (18). All plasmids were confirmed by sequencing. This approach allowed the production of a panel of NL4-3 Nef mutants (by cotransfecting p83-10 nef variants) with or without the murine CD24 reporter gene in the vpr reading frame (by cotransfecting p83-2.1CD24 or p83-2.1). Low passage virus stocks were produced by electroporation and expansion in H9 cells, harvested, and frozen in aliquots at -80°C until use. Viral titer (50% tissue culture-infectious dose (TCID50) per milliliter) was determined by end-point dilution with C8166 indicator cells as previously described (19).
Variants of p83-2
The p83-2.1 plasmid contained the consensus sequence (differences are underlined) for the commonly recognized Gag p17 epitope SLYNTVATL (20), but was otherwise identical with p83-2 (containing the sequence SLYNTIAVL) (17). The p83-2.1CD24 plasmid was produced by swapping the PflmI-EcoRI restriction fragment from the NL-r-HSAS (NL4-3-based) reporter virus containing murine CD24 in the vpr reading frame (21) into p83-2.1 (NL4-3 positions 56245743).
Variants of p83-10
Variants bearing different nef point mutations were produced by swapping of HpaI-AccIII fragments in the open reading frame of nef into p83-10 (positions 86519384). The p83-10 Nef point mutants contained PCR-amplified nef of NL4-3 variants under selective pressure from Nef-specific CTL clones STD11 and KM3, subcloned through the pCR2.1-TOPO cloning vector (Invitrogen, San Diego, CA). A p83-10 variant containing a large deletion in nef, p2105 (18), was obtained from the National Institutes of Health AIDS Research and Reference Reagent Repository and was used to produce Nef 112 (containing a truncation of Nef after the first 12 aa). A p83-10 variant containing a truncation of Nef after 51 residues, Nef 151, was produced by a PCR-induced error. This variant contained a deletion of nucleotide 154 in nef, resulting in a frameshift after aa 51 and an early stop at aa 58.
Selection and sequencing of escape mutants
Two passages of 1 wk each were performed with HIV-1 NL4-3.1 under selective pressure from the Nef-specific CTL clones (20). T1 cells (5 x 106; HLA-matched at the HLA A2 and B60 restricting alleles of the CTL) or control cells (5 x 106; unable to present Ag to the CTL) were acutely infected and cultured with 5 x 105 CTL for each of two serial passages of 7 days each. After each passage, DNA was isolated from the cell pellets, and proviral sequences were amplified using nested PCR (25 cycles each for two amplifications) under limiting dilution. A sequence spanning nearly complete nef was amplified using outer primers AGAGCTATTCGCCACATACC (NEF8736) and TAGTTAGCCAGAGAGCTCCCA (NEF9589R), and inner primers CTATAAGATGGGTGGCAAGTG (NEF8780F) and TTATATGCAGCATCTGAGGGC (NEF9495R). Positive reactions were then PCR-sequenced using the inner primer set.
Fluorescent Abs
FITC-conjugated murine CD24-specific Ab M1/69, FITC-conjugated control IgG2b Ab clone 27-35, PE-conjugated anti-pan class I Ab clone G46-2.6, biotin-conjugated control murine IgM, and streptavidin-PE were obtained from BD PharMingen (San Diego, CA). Biotin-conjugated anti-HLA A2 IgM Ab (BIH0648) was obtained from One Lambda (Canoga Park, CA).
Assay for total class I down-regulation by Nef alone
Expression vectors expressing Nef variants were constructed using the TAP Express Fragment System (Gene Therapy Systems, San Diego, CA) according to the manufacturers protocol. Briefly, two-step recombinant PCR was used to link the nef alleles from the limiting dilution sequencing reactions to CMV promoter and terminator sequences. These vectors (2 µg each) were then colipofected (GenePORTER, Gene Therapy Systems) with the green fluorescence protein (GFP)-expressing vector phGFP-S65T (Clontech, Palo Alto, CA) into 293 cells. Pan MHC-I expression was determined by flow cytometric analysis of GFP-expressing cells 48 h after lipofection. Down-regulation of MHC-I was calculated by comparison to a nef negative control containing two premature stop codons.
Assay for HLA A2-down-regulation by Nef in HIV-1-infected cells
HLA A2 expression in infected cells was measured as previously described (21). T1 cells were acutely infected with NL4-3 Nef mutants containing the murine CD24 reporter gene at a multiplicity of 1 TCID50/cell. Four days after infection, the cells were costained for murine CD24 and HLA A2. Negative control isotype Abs were used to establish compensation and the negative quadrant. HLA A2 expression on infected cells was measured by calculation of the mean fluorescence intensity of A2 staining on the murine CD24-expressing cells. The effect of Nef on A2 expression was calculated by the ratio of A2 mean fluorescence intensity to that of NL4-3
Nef-infected cells. Flow cytometry and analysis were performed on a FACScan using CellQuest software (BD Biosciences, Mountain View, CA) on a G4 Power Macintosh (Apple Computer, Redmond, WA).
Inhibition of HIV-1 with varying Nef by CTL
Viral suppression assays were performed as previously described (15). Briefly, T1 cells were acutely infected with HIV-1 at a multiplicity of 0.01 TCID50/cell, followed by coculture of 5 x 105 T1 cells with 1.25 x 105 CTL clone 68A62. Supernatant was harvested for quantitative p24 Ag ELISA (DuPont, Boston, MA) and was replaced at the indicated time points.
| Results |
|---|
|
|
|---|
Because Nef has been proposed to mediate resistance of HIV-1 to CTL by down-modulating class I molecules (6, 8, 9), we investigated whether escape of virus from Nef-specific CTL in vitro altered viral susceptibility to CTL of other specificities. The molecular clone HIV-1 NL4-3.1 was passaged under selective pressure in the presence of two Nef-specific CTL clones (KM3 and STD11, isolated from different infected individuals). Viruses that had been passaged in T1 cells under selection for 7 or 14 days and parallel negative control virus (cultured in the TAP-deficient derivative of T1 cells, T2 cells unable to present Ag to the clones) were then tested for susceptibility to the same Nef-specific clones and to CTL recognizing epitopes in reverse transcriptase and Gag (Fig. 1). The four viruses (two time points for each CTL clone) that had been passaged under selection by either Nef-specific clone were almost entirely resistant to inhibition by both Nef-specific clones, whereas control viruses were highly suppressed (Fig. 1, KM3 and STD11), indicating selective resistance to the selecting CTL. In contrast, these viruses were
10-fold more susceptible to inhibition by Gag- and reverse transcriptase-specific CTL clones compared with negative control viruses (Fig. 1, 161JxA14, 18030D23, and 68A62). Because Nef reduces the susceptibility of HIV-1 to suppression by CTL in this assay (8), these data suggested that the escape mutations may interfere with the ability of Nef to mediate viral resistance to CTL of other specificities.
|
To evaluate the cause of this functional alteration after selection by Nef-specific CTL, we examined the nef reading frame in these escaped viruses. Clonal sequencing was performed for the viruses passaged under pressure by the Nef-specific CTL clones STD11 and KM3 as well as the negative control viruses. Virus passaged under selective pressure by the two clones (tested in Fig. 1) contained numerous nef mutations (Table I), while the parallel negative control viruses contained none (24 of 24 sequences). Nearly all nef sequences in virus passaged under selection for 7 days were variant (94.4%, 34 of 36 sequences after the first passage), and all contained mutations after 14 days (100%, 36 of 36 sequences after the second passage).
|
The percentage of epitope point mutations appeared to increase over time. Nef sequences after the first 7 days of selection contained 8 of 36 (22%) point mutations and 26 of 36 (72%) reading frame disruptions, while sequences after 14 days of selection contained 16 of 36 (44%) point mutations and 20 of 36 (56%) reading frame disruptions (not shown). This suggested a possible selective advantage for point mutants vs gross Nef disruption in our system.
A CTL line recognizing a different Nef epitope also selected escape virus containing nef reading frame disruptions (Table II). Of 15 clonal sequences evaluated, 7 demonstrated upstream frameshifts or stop substitutions after 1 wk of passaging. The most common mutation selected by CTL recognizing this epitope was the same as the most common escape mutation selected by the two above clones: a deletion inducing an early stop codon at position 91 of Nef. Another mutation observed for the other CTL clones, a nonsense mutation leading to an early stop at position 35, was also selected. The negative control sequences remained unchanged (10 of 10). Thus, changes selected by the tested Nef-specific CTL in vitro generally specifically favored either epitope alteration or its functional deletion by truncating/frameshifting nef.
|
Nef has been proposed in several studies to decrease MHC-I expression in infected cells, and this effect was evaluated in our system by comparing molecular clones based on NL4-3. T1 cells (expressing the MHC-I molecule A2) were acutely infected with reporter HIV-1 containing wild-type Nef or Nef truncated after the first 12 residues (Nef 112), and costained for the reporter protein and A2 (Fig. 2). Compared with uninfected cells and Nef 112-infected cells, wild-type Nef induced heavy loss of cell surface A2 (86.4 ± 4.0%). Three other Nef variants were tested in parallel. Two substitution point mutants, including E93G (glutamic acid to glycine change at aa 93) and E93K (glutamic acid to lysine change at aa 93), and another truncation mutant, Nef 151, were also tested. Using infection with Nef 112 as the baseline for A2 expression, wild-type Nef down-regulated A2 by 73.8 ± 7.2%, E93G by 48.1 ± 16.8%, E93K by 42.9 ± 8.2%, and Nef 151 by 12.5 ± 16.8%. These data demonstrated that expression of Nef in the context of HIV-1 expression of T cells reduces MHC-I expression by infected cells, and that this effect is highly dependent on the intact nef reading frame.
|
In light of the potentially important role of MHC-I down-regulation by Nef for mediating resistance of HIV-1 to the antiviral effects of CTL (6, 8, 9), we used a rapid screening assay to evaluate several of the Nef mutations listed in Table I. This assay measured total MHC-I expression in acutely nef-transfected cells. As might be expected, most tested nef insertion and deletion frameshift mutations demonstrated markedly reduced MHC-I down-regulation compared with wild type, although surprisingly one insertion frameshift (leading to truncation after 110 aa) maintained
73% activity compared with intact nef. Interestingly, a glutamic acid to arginine substitution at position 93 in this mutant apparently potentiated preservation of activity by truncated Nef, because this was the only difference from the other insertion frameshift mutation that maintained only
13% activity. The most commonly noted frameshift (38.9%, 28 of 72 sequences), a deletion, was associated with a loss of activity to 19%. Notably, two of the seven tested point mutations within the epitope (G99E and G99R) also disrupted MHC-I down-regulation to 50% or less that of wild-type Nef despite the fact that this region of Nef (aa 92100) is not known to have a direct role in class I effects (22, 23, 24). The E93G and E93K mutants were unimpaired in their MHC-I effects in this system, somewhat in contrast to our above results using whole HIV-1 constructs (differences probably due to overexpression of Nef and pan-MHC-I staining in this assay). Of all the Nef-specific CTL-selected variant sequences tested,
62% (37 of 60) of the variants lost at least 50% of MHC-I down-modulatory function compared with wild type, indicating that viral escape from these CTL in vitro was commonly associated with functional impairment in this respect.
Loss of Nef renders HIV-1 relatively susceptible to suppression by CTL
To confirm the impact of Nef on the ability of CTL to suppress HIV-1 replication in acutely infected cells, we cocultured cells infected with the panel of NL4-3-based viruses expressing intact or truncated Nef tested above for A2 down-regulation. The three viruses containing intact Nef (wild type, E93K, and E98K) each were inhibited by
10-fold by a reverse transcriptase-specific CTL clone (Fig. 3, AC). The two viruses containing truncated Nef (Nef 112 and Nef 151) were inhibited by
1000-fold (Fig. 3, D and E). Overall, the Nef-intact viruses were suppressed by 1.18 ± 0.10 log10 units compared with 2.93 ± 0.08 log10 units for the Nef-disrupted viruses (mean ± SD on day 8), confirming the direct impact of Nef on the antiviral activity of CTL (6, 8, 9) that depends on an intact nef reading frame.
|
| Discussion |
|---|
|
|
|---|
CTL pressure in vivo has been shown to result in specific HIV-1 mutations resulting in reduced recognition and therefore escape. Because the interaction of the TCR with the epitope/MHC-I complex is highly specific, minor alterations of the epitope sequence can ablate recognition easily (26). However, fitness costs for such potential escape mutations limit the observed escape variants selected by CTL (27). In the case of structural proteins such as Gag, these fitness costs are obvious, because viral replication is constrained by the physical requirements for these proteins. Single amino acid substitutions in Gag, for example, can completely ablate HIV-1 replication (28), yet structural protein epitope escape mutations observed in vivo are usually oligo- or monoclonal (29, 30).
The fitness costs and constraints are less obvious in the case of changes in Nef. Although a relatively small HIV-1 protein, Nef is disproportionately targeted by CTL (10, 11). However, its requirement for replication is not absolute, and virus lacking Nef replicates efficiently in several culture systems (8, 12). Yet, the nef reading frame is highly maintained in vivo (2, 31). Escape from CTL appears to occur predominantly through sequence variation (32), and even in a case where reinfusion of expanded autologous Nef-specific CTL resulted in extreme selective pressure that favored epitope deletion, the reading frame was maintained (33). This suggests that changes in Nef are also highly constrained, and since Nef does not play a direct important structural role for HIV-1, some function(s) of this protein must be important for viral persistence in vivo.
Among the effects attributed to Nef, down-modulation of MHC-I molecules on the surface of infected cells is well documented and has been proposed to have a significant impact on the function of HIV-1-specific CTL. Although the precise mechanism remains elusive, Nef appears to selectively reduce the MHC-I A and B molecules used most frequently for epitope presentation to CTL (while leaving levels of C molecules unperturbed, presumably protecting infected cells from clearance by NK lymphocytes) (7). Experimental models of the interaction of HIV-1-specific CTL and infected cells have shown that this down-modulation renders infected cells relatively resistant to cytolysis (6, 9), and that Nef reduces the antiviral efficiency of CTL (20). Nef is therefore believed to mediate the evasion of HIV-1-infected cells from clearance by CTL, thereby promoting the persistence of the virus despite cellular immunity. Through its effects on MHC-I, Nef probably reduces the overall cellular immune pressure of CTL on the virus. This could thus be an important enhancement of viral fitness and a reason for the maintenance of the nef reading frame in vivo.
When we applied Nef-specific CTL-mediated immune pressure in HIV-1 in vitro, the majority of the escape mutations disrupted the MHC-I down-regulatory function of Nef. Many of these mutations were deletional or insertional frameshifts that disrupted the nef reading frame, including the recognized epitope. Given that this gene is not needed for efficient viral replication in our in vitro culture system (8), the gross disruption of its reading frame is a direct method to escape the Nef-specific CTL with little or no fitness cost. As might be expected, this strategy resulted in loss of Nef-mediated down-regulation of MHC-I, because many of these disruptions deleted known motifs in Nef reported to be important for this function (22, 23, 24). Interestingly, some epitope point mutations in Nef appeared to have effects on MHC-I down-regulation despite the fact that neither of the CTL epitopes studied contained motifs known to be functionally important (22, 23, 24). A rapid screening assay expected to be less sensitive (due to overexpression of Nef and measurement of pan MHC-I expression including C molecules) still revealed that some of these point mutants were impaired by 50% or more. Using a more physiologic system based on whole HIV-1 infection and measurement of the A2 molecule, we also found that some Nef mutants that appeared normal by the rapid assay were still less efficient than wild-type Nef. These data therefore suggested that many potential escape mutations that occur in vitro impair the ability of Nef to down-regulate MHC-I. The majority of these mutations (nef reading frame disruptions) tend not to occur in vivo (31), suggesting that this function of Nef may be an important selective pressure for its maintenance in vivo. The markedly increased susceptibility of the escaped viruses to in vitro suppression by CTL observed here provides further support for this hypothesis.
Evaluation of the sequences of HIV-1 escaping Nef-specific CTL also suggested that escaped Nef point mutants might have an advantage over those with grossly disrupted Nef, even in the absence of selective pressure by CTL of non-Nef specificity. Over two rounds of selection by Nef-specific CTL, the polyclonal population of escaped virus appeared to evolve to favor point mutants. Although more comparisons would be required to confirm this finding, it suggests that either Nef provides a slight direct growth advantage in our in vitro system, or that Nef-mediated MHC-I down-regulation affects recognition by Nef-specific CTL. The latter case would imply that despite likely earlier recognition of infected cells by Nef-specific CTL (compared with CTL recognizing later proteins such as Gag and Pol), infected cell clearance still does not precede Nef-mediated down-regulation of MHC-I.
One of the escape point mutants (E93K) from CTL clone STD11 that was among the least impaired in MHC-I down-regulation predominates in vivo in the subject from whom the selecting clone was isolated (2) despite being a minor variant among escape sequences in vitro. Several of the other point mutants selected by the same clone were more highly impaired in MHC-I effects, suggesting a possible selective advantage to maintaining this function in vivo. It is not clear to what extent other factors might play a role in determining the predominance of this particular variant, such as the degree of cross-recognition by STD11 or other clones. Our in vitro suppression assay did not detect a difference between suppression of virus with wild-type or E93K Nef by a reverse transcriptase-specific CTL clone, indicating either that the assay was not sensitive enough to detect a functional survival disadvantage from the difference in MHC-I down-regulation, or that the difference in MHC-I down-regulation is not functionally significant.
It is important to note that Nef has also been reported to mediate numerous other functions, including down-regulation of CD4 (34, 35), enhancement of virion infectivity (36, 37), and interaction with cellular activation pathways (38, 39, 40, 41, 42, 43, 44). The use of transformed cells in our studies reduces or bypasses the contributions of these functions to viral replication compared with those in primary cells. For example, in primary T cells, Nef clearly augments viral replication (45), in contrast to the immortalized cell lines used in our study. Thus, our data do not exclude a role for other functions in providing selective pressure to maintain Nef in vivo, and it is, in fact, most likely that the preservation of Nef is multifactorial. It is therefore likely that MHC-I down-regulation is one of several contributing factors to the pressure to conserve nef.
As a whole, these data suggest that Nef-mediated MHC-I down-regulation is an important factor in reducing CTL pressure against HIV-1, and that escape from Nef-specific CTL is constrained by loss of MHC-I down-regulatory function and increased susceptibility to other CTL. A possible implication of these findings is that Nef may be an attractive target for vaccines or immunotherapies. Other recent data (46) have suggested that Nef-specific CTL may exert greater antiviral effects than CTL recognizing later proteins and may therefore provide greater pressure against HIV-1. Coupled with the importance of Nef in viral evasion of the CTL response in general, directing CTL toward Nef may be a means to focus greater pressure on regions with crucial fitness constraints due to its central importance for HIV-1 persistence in vivo.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Otto O. Yang, Division of Infectious Diseases, 37-121 CHS, University of California Medical Center, 10833 LeConte Avenue, Los Angeles, CA 90095. E-mail address: oyang{at}mednet.ucla.edu ![]()
3 Abbreviations used in this paper: MHC-I, MHC class I; GFP, green fluorescence protein; TCID50, 50% tissue culture-infectious dose. ![]()
Received for publication June 13, 2003. Accepted for publication August 14, 2003.
| References |
|---|
|
|
|---|
helix and proline repeat of Nef selectively regulate MHC-I trafficking. J. Virol. 73:1964.
. J. Biol. Chem. 271:16753.This article has been cited by other articles:
![]() |
N. J. Maness, L. J. Yant, C. Chung, J. T. Loffredo, T. C. Friedrich, S. M. Piaskowski, J. Furlott, G. E. May, T. Soma, E. J. Leon, et al. Comprehensive Immunological Evaluation Reveals Surprisingly Few Differences between Elite Controller and Progressor Mamu-B*17-Positive Simian Immunodeficiency Virus-Infected Rhesus Macaques J. Virol., June 1, 2008; 82(11): 5245 - 5254. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Lewis, A. Balamurugan, A. Ohno, S. Kilpatrick, H. L. Ng, and O. O. Yang Functional Adaptation of Nef to the Immune Milieu of HIV-1 Infection In Vivo J. Immunol., March 15, 2008; 180(6): 4075 - 4081. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ueno, C. Motozono, S. Dohki, P. Mwimanzi, S. Rauch, O. T. Fackler, S. Oka, and M. Takiguchi CTL-Mediated Selective Pressure Influences Dynamic Evolution and Pathogenic Functions of HIV-1 Nef J. Immunol., January 15, 2008; 180(2): 1107 - 1116. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Noviello, S. L. K. Pond, M. J. Lewis, D. D. Richman, S. K. Pillai, O. O. Yang, S. J. Little, D. M. Smith, and J. C. Guatelli Maintenance of Nef-Mediated Modulation of Major Histocompatibility Complex Class I and CD4 after Sexual Transmission of Human Immunodeficiency Virus Type 1 J. Virol., May 1, 2007; 81(9): 4776 - 4786. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Adnan, A. Balamurugan, A. Trocha, M. S. Bennett, H. L. Ng, A. Ali, C. Brander, and O. O. Yang Nef interference with HIV-1-specific CTL antiviral activity is epitope specific Blood, November 15, 2006; 108(10): 3414 - 3419. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kan-Mitchell, M. Bajcz, K. L. Schaubert, D. A. Price, J. M. Brenchley, T. E. Asher, D. C. Douek, H. L. Ng, O. O. Yang, C. R. Rinaldo Jr., et al. Degeneracy and Repertoire of the Human HIV-1 Gag p1777-85 CTL Response. J. Immunol., June 1, 2006; 176(11): 6690 - 6701. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Geels, S. A. Dubey, K. Anderson, E. Baan, M. Bakker, G. Pollakis, W. A. Paxton, J. W. Shiver, and J. Goudsmit Broad Cross-Clade T-Cell Responses to Gag in Individuals Infected with Human Immunodeficiency Virus Type 1 Non-B Clades (A to G): Importance of HLA Anchor Residue Conservation J. Virol., September 1, 2005; 79(17): 11247 - 11258. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |