The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meusel, T. R.
Right arrow Articles by Imani, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meusel, T. R.
Right arrow Articles by Imani, F.
The Journal of Immunology, 2003, 171: 3768-3774.
Copyright © 2003 by The American Association of Immunologists

Viral Induction of Inflammatory Cytokines in Human Epithelial Cells Follows a p38 Mitogen-Activated Protein Kinase-Dependent but NF-{kappa}B-Independent Pathway1

Tiffany R. Meusel and Farhad Imani2

Division of Clinical Immunology, Department of Medicine, Johns Hopkins University School of Medicine, Asthma and Allergy Center, Baltimore, MD 21224


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The initial step in an immune response toward a viral infection is the induction of inflammatory cytokines. This innate immune response is mediated by expression of a variety of cytokines exemplified by TNF-{alpha} and IL-1{beta}. A key signal for the recognition of intracellular viral infections is the presence of dsRNA. Viral infections and dsRNA treatment can activate several signaling pathways including the protein kinase R pathway, mitogen-activated protein kinase (MAPK) pathways, and NF-{kappa}B, which are important in the expression of inflammatory cytokines. We previously reported that activation of protein kinase R was required for dsRNA induction of TNF-{alpha}, but not for IL-1{beta}. In this study, we report that activation of the p38 MAPK pathway by respiratory viral infections is necessary for induction of inflammatory cytokines in human bronchial epithelial cells. Inhibition of p38 MAPK by two different pharmacological inhibitors showed that expression of both TNF-{alpha} and IL-1{beta} required activation of this signaling pathway. Interestingly, inhibition of NF-{kappa}B did not significantly reduce viral induction of either cytokine. Our data show that, during the initial infections of epithelial cells with respiratory viruses, activation of the p38 MAPK pathway is associated with induction of inflammation, and NF-{kappa}B activation may be less important than previously suggested.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The bronchial epithelium is the primary target for respiratory viruses. Consequently, these cells are likely to play a pivotal role in virus-induced lung inflammation and in the initiation of innate and subsequently adaptive immune responses. Viral infections of epithelial cells induce expression of several inflammatory cytokines and chemokines that can participate in immune responses (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11). Multiple intracellular pathways including protein kinase R (PKR),3 IFN regulatory factors, p38 mitogen-activated protein kinase (MAPK), and NF-{kappa}B are necessary for viral induction of inflammatory cytokines (12, 13, 14).

A common viral factor that is recognized by host cells and can lead to initiation of innate immune responses is dsRNA. dsRNA (>100 bp) is not present within normally growing cells but is almost universally present as a genomic fragment, a replicative intermediate, or a stem-and-loop structure during viral infections. Regardless of its source, dsRNA is a potent inducer of several cytokines and chemokines in a variety of cell types (3, 15, 16, 17, 18, 19, 20, 21). Thus far, the exact mechanisms that are required for viral and dsRNA induction of inflammatory cytokines in human epithelial cells are not completely understood. We recently reported that dsRNA induction of TNF-{alpha} required PKR activation, but that IL-1{beta} induction followed a PKR-independent pathway (22).

Activation of PKR by dsRNA has been shown in several cell types, including airway epithelial cells, to result in phosphorylation of I{kappa}B and therefore activation of NF-{kappa}B (23, 24, 25, 26). Inasmuch as NF-{kappa}B activation is known to lead to the induction of several inflammatory genes (27), it is reasonable to hypothesize that this pathway may lead to the expression of inflammatory cytokines in virally infected human airway epithelial cells.

Another signaling pathway that is important in early events leading to up-regulation of inflammatory cytokines is the p38 MAPK (28, 29, 30). A variety of stimuli including LPS, osmotic shock, and growth factors can activate the p38 MAPK pathway (31, 32, 33, 34). Recently, studies by Goh et al. (35) showed that PKR was necessary for dsRNA activation of p38 MAPK. These data suggest that intracellular viral activation of PKR may also lead to the activation of p38 MAPK. Because p38 MAPK is an important signaling molecule in the induction of inflammation, it may provide a pathway distinct from NF-{kappa}B for viral induction of inflammatory cytokines.

TNF-{alpha} and IL-1{beta} are key regulatory factors in the early induction of inflammation and innate immune responses. They induce other cytokines and chemokines and can up-regulate adhesion molecules, induce cell activation, and recruit and enhance cytotoxicity of macrophages and neutrophils (36, 37, 38, 39, 40). In addition, TNF-{alpha} can directly control viral infections and participate in both Th1 and Th2 immune responses (41, 42, 43, 44). In this study, we report that treatment of human epithelial cells with dsRNA or infection with respiratory viruses such as reovirus and respiratory syncytial virus (RSV) induces inflammatory cytokines by activation of p38 MAPK pathways. Notably, NF-{kappa}B does not appear to play a significant role in the virus and dsRNA induction of inflammatory cytokines.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture conditions, viral infections, and reagents

Primary human bronchial epithelial cells were generously provided by Dr. R. Schleimer (Johns Hopkins University, Baltimore, MD) or were purchased from Cambrex BioScience (Walkersville, MD), and were grown as monolayers in serum-free medium BEBM-2 (Cambrex BioScience). The human epithelial cell lines BEAS-2B and A549 were grown as monolayers in RPMI 1640 supplemented with 5% FCS and 10 µg/ml gentamicin at 37°C in a 5% CO2-humidified chamber. The dsRNA poly(I:C) was purchased from Sigma-Aldrich (St. Louis, MO), dissolved in PBS, and used at the concentrations indicated in the figures. Because we have observed significant differences in the capability of synthetic dsRNA poly(I:C) to activate PKR, we routinely test the fidelity of poly(I:C) by in vitro kinase assays detecting autophosphorylation of PKR as described (45).

The wild-type reovirus type 3 (T3) was grown in our laboratory, and human RSV A2 subtype was originally a generous gift from Dr. B. Graham (National Institutes of Health, Bethesda, MD). Primary epithelial cells and the cell lines were infected at 70% confluency, at a multiplicity of infection (MOI) of 2.5 PFU/cell, in serum-free medium. After 1 h of incubation at 37°C, complete medium was added, and the cells were incubated further for indicated times before harvesting. The p38 MAPK inhibitor SB203580 was purchased from Tocris Cookson (Ellisville, MO), and SB239063 was a generous gift from Dr. D. Underwood (GalaxoSmithKline, King of Prussia, PA).

RNA extraction and RT-PCR

RNA was isolated using the TRIzol total RNA isolation reagent (Life Technologies, Rockville, MD). First-strand cDNA was synthesized using SuperScript reverse transcriptase (Life Technologies); the cDNA was then amplified in the presence of 2 µg/ml primers, 100 µM dNTPs, 0.25 U of Taq polymerase (AmpliTaq; Applied Biosystems, Foster City, CA), 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 1.0–2.5 mM MgCl2 (optimized for each primer set), and 0.001% gelatin in a final volume of 25 µl. The sequences of primers were as follows: IL-1{beta}, forward, AAACAGATGAAGTGCTCCTTCAGG; IL-1{beta}, reverse, TGGAGAACACCACTTGTTGCTCCA; TNF-{alpha}, forward, CAGAGGGAAGAGTTCCCCAG; and TNF-{alpha}, reverse, CCTTGGTCTGGTAGGAGACG; and for GAPDH, forward primer, CACAGTCCATGCCATCACTG, and reverse primer, TACTCCTTGGAGGCCATGTG, were used in the PCR. To collect the PCR products at the linear range, the number of PCR cycles was optimized for each primer set.

Western blot analysis

After each of the treatments indicated in the figures, cells were washed one time in PBS, and equal numbers of cells were lysed using 1x SDS-sample buffer containing 2.5% 2-ME. The proteins were denatured and reduced by heating the samples at 95°C for 5 min. The chromosomal DNA was then sheared by passing the samples through a 26-gauge needle. The proteins were resolved on a 12% SDS-PAGE and were electrotransferred onto nitrocellulose membranes. Polyclonal rabbit anti-p38 MAPK and anti-phospho-p38 MAPK (Cell Signaling, Beverly, MA) were used according to the manufacturer’s instructions. The immunoblotted proteins were visualized using the ECL Western blot detection system (Amersham, Arlington Heights, IL).

For stripping, the blots were placed in a buffer containing 1% SDS, 62.5 mM Tris-HCl (pH 6.8), and 100 mM DTT. The blots were then heated to 65°C for 15 min. The buffer was then removed, and the blots were washed extensively before reprobing with appropriate Abs.

EMSA

Cell extracts for EMSA were prepared according to Schreiber et al. (46). EMSAs were performed using {gamma}-32P-end-labeled NF-{kappa}B (from {kappa} L chain) consensus oligonucleotide (Promega, Madison, WI). The reactions (20 µl) consisted of 2 µl of nuclear extract in buffer containing 20 mM HEPES (pH 7.5), 50 mM KCl, 0.2 mM EDTA, 10% glycerol, 40 µg/ml poly(dI.C:dI.C), and 0.5 µl of labeled probe. After 30 min of incubation at 37°C, the protein/DNA complexes were resolved on 4.5% nondenaturing polyacrylamide gel and were visualized by autoradiography of the dried gels. The protein concentration was determined by the bicinchoninic acid assay (Pierce, Rockford, IL).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RSV and reovirus infections induce inflammatory cytokines in bronchial epithelial cells

With the synthetic dsRNA poly(I:C), which is commonly used as a viral mimetic, we previously reported that dsRNA treatment of primary epithelial cells or the BEAS-2 epithelial cell line induced TNF-{alpha} and IL-1{beta}. To examine the effects of respiratory virus infections on epithelial cells, we infected primary bronchial human epithelial cells with RSV and reovirus. Primary epithelial cells were isolated from human bronchi and grown as monolayers. The cells were infected at an MOI of 2.5 PFU/cell with RSV strain A2 and reovirus T3. At indicated times postinfection, cells were harvested, and total cellular RNA was extracted. To assess the level of cytokines, we then subjected the RNA to semiquantitative RT-PCR by using specific primers to human TNF-{alpha}, IL-1{beta}, or GAPDH, as a control. As shown in Fig. 1, similar to our previous experiments with dsRNA, infection of epithelial cells with RSV or reovirus induced inflammatory cytokines in a time-dependent manner. Cytokines are induced more rapidly by reovirus than by RSV, perhaps because the genomic structure of reovirus is composed of dsRNA. In contrast, RSV is a single-stranded virus that may require more time to replicate and then form dsRNA.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 1. Virus infections induce inflammatory cytokines in human bronchial epithelial cells. To establish whether virus infections induced TNF-{alpha} or IL-1{beta} in human epithelial cells, primary human bronchial epithelial cells (A), BEAS-2B epithelial cell line (B), or A549 epithelial cells (C) were infected with either reovirus or RSV at MOI of 2.5 PFU/cell. After indicated times, total cellular RNA was extracted and subjected to RT-PCRs by using specific primers to TNF-{alpha}, IL-1{beta}, or GAPDH. The amplified products were resolved on a 1.5% agarose gel, and the bands were visualized by ethidium bromide staining (n = 5).

 
Because primary cells are difficult to isolate and study in genetic manipulations, we have used two different human epithelial cell lines, BEAS-2B and A549, in our viral infections. To examine the effects of viral infections on cytokine expression in these cell lines, we infected BEAS-2B cells with reovirus, and A549 cells with RSV. We matched the virus and the cell line based on the efficiency of viral replication and cytokine induction. The MOI and incubation times were as indicated for primary epithelial cells. The data from RT-PCR show that, similar to primary epithelial cells, infection of BEAS-2B cells with reovirus and infection of A549 cells with RSV induced inflammatory cytokines in a time-dependent manner.

p38 MAPK is activated by dsRNA and viral infections

Several different stimuli including viral infections and dsRNA can activate the p38 MAPK pathway. Activation of this kinase leads to the induction of various inflammatory cytokines, initiation of innate immune responses, and activation of the adaptive immune lymphocytes (28, 29, 30, 47). To detect whether viral infections can activate p38 MAPK in human epithelial cells, we have infected primary bronchial epithelial cells with RSV and reovirus (Fig. 2A). The cells were infected at an MOI of 2.5 PFU/cell and then harvested at the indicated times; cellular proteins were extracted as described in Materials and Methods. To detect activation of p38 MAPK, the cellular proteins were separated by electrophoresis and immunoblotted by using a specific anti-phospho-p38 MAPK Ab. The level of total p38 MAPK protein in the cellular extracts was then determined by stripping the blot and reprobing with a specific anti-p38 MAPK Ab.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 2. Viral infections and dsRNA treatment activate p38 MAPK in bronchial epithelial cells. To determine the effects of viral infections (A) or dsRNA treatment (B) on p38 MAPK activation, we infected primary bronchial epithelial cells with RSV and reovirus at MOI of 2.5 PFU/cell or treated the cells with dsRNA at 1 µg/ml. The cells were then harvested at the indicated times, and cellular proteins were extracted as described in Materials and Methods. To detect activation of p38 MAPK, the cellular proteins were separated by electrophoresis and immunoblotted by using a specific anti-phospho-p38 MAPK Ab. The levels of total p38 MAPK protein in the cellular extracts were determined by stripping the blot and reprobing with a specific anti-p38 MAPK Ab (n = 5).

 
Because dsRNA acts as a viral mimetic and induces several inflammatory cytokines (3, 15, 16, 17, 18, 19, 20, 21), we tested whether dsRNA could also activate p38 MAPK in primary human epithelial cells. The cells were treated with 1 µg/ml poly(I:C), and after the indicated times, Western blots were performed as shown in Fig. 2A. We found that p38 MAPK was rapidly activated by dsRNA treatment in human epithelial cells. The initial activation of p38 MAPK after dsRNA treatment was detected at 30 min, and the maximal level was reached at 1 h after treatment (Fig. 2B).

Inhibition of p38 MAPK reduces viral and dsRNA induction of inflammatory cytokines

To determine the role of p38 MAPK in viral- and dsRNA-induced cytokine expression, we have used two relatively specific pharmacological inhibitors (SB203580 or SB239063) of p38 MAPK. We first determined the dose-response curve for inhibition of p38 MAPK in bronchial epithelial cells. BEAS-2B cells were pretreated with increasing concentrations of SB203580 and were then treated with dsRNA at 1 µg/ml. After 1 h, total cellular proteins were extracted and were subjected to Western blot analysis. The data show that IC50 for SB203580 is ~5 µM (Fig. 3). Therefore, to achieve ~80% inhibition, we have used the p38 inhibitors at 20–40 µM in our experiments.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 3. SB203580 inhibits dsRNA activation of p38 MAPK. A, To determine the dose-response curve for inhibition of p38 MAPK by SB203580, we pretreated BEAS-2B cells with increasing concentrations of this inhibitor for 30 min. dsRNA was then added at 1 µg/ml, and the cells were allowed to incubate for an additional 1 h before harvesting. Cellular proteins were extracted as described in Materials and Methods, and cellular proteins were separated by electrophoresis and immunoblotted by using a specific anti-phospho-p38 MAPK Ab. The level of total p38 MAPK protein in the cellular extracts was then determined by stripping the blot and reprobing with a specific anti-p38 MAPK Ab (n = 2). B, The level of p38 activation was determined by quantitation of the results in A using NIH Image software.

 
To test the effects of p38 inhibitors on dsRNA induction of inflammatory cytokines, bronchial epithelial cells were treated with SB203580 or SB239063 at 20 or 40 µM for 30 min, and then the cells were treated with dsRNA at 1 µg/ml (Fig. 4). The data in Fig. 4 show that dsRNA treatment of primary bronchial epithelial cells results in an ~200-fold increase in TNF-{alpha} and 6-fold increase in IL-1{beta} expression. Both p38 MAPK inhibitors inhibited dsRNA induction of inflammatory cytokines; however, SB239063 was a more potent inhibitor of TNF-{alpha} than IL-1{beta} (Fig. 4).



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 4. Inhibition of p38 MAPK blocks dsRNA induction of cytokines. The effect of p38 inhibition on dsRNA induction of proinflammatory cytokines was examined by using the relatively specific p38 inhibitors SB203580 and SB239063. Primary epithelial cells were either left untreated or treated with SB203580 or SB239063 at the indicated concentrations. The cells were then treated with dsRNA at 1 µg/ml (A). After 2 h of dsRNA treatment, RT-PCRs were performed to detect the expression of TNF-{alpha}, IL-1{beta}, or GAPDH (n = 3). B, The relative increase and inhibition of TNF-{alpha} and IL-1{beta} mRNA were then determined by quantitation of the results from the three different experiments using NIH Image software. The columns (1–6) correspond to the experimental conditions in A. The error bars indicate ±SD of the mean.

 
To examine the effect of p38 inhibition on virus-induced cytokines, primary epithelial cells were first treated as in Fig. 4 and then infected with RSV or reovirus at an MOI of 2.5 PFU/cell (Fig. 5). After the indicated times, the cells were harvested, and total cellular RNA was extracted. The data demonstrate that infections with either RSV or reovirus rapidly and potently induce TNF-{alpha} and IL-1{beta} in epithelial cells. Similar to the results obtained using dsRNA, inhibition of p38 MAPK reduced the viral induction of cytokines, and SB239063 was a more potent blocker of viral induction of TNF-{alpha} than IL-1{beta} (Fig. 5).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 5. Virus induction of cytokines is reduced by inhibitors of p38 MAPK. The effect of p38 inhibition on RSV (A and B) or reovirus (C and D) induction of proinflammatory cytokines was examined by using the p38 inhibitors SB203580 and SB239063. Primary epithelial cells were either treated with the carrier (mock) or treated with SB203580 or SB239063 at 20 µM. The cells were then infected with RSV or reovirus at an MOI of 2.5 PFU/cell. At the indicated times, total cellular RNA was extracted, and RT-PCRs were performed to detect the expression of TNF-{alpha}, IL-1{beta}, or GAPDH (n = 3).

 
At this point, the exact reason for this difference between the two p38 MAPK inhibitors is not clear, but because p38 MAPK is composed of four isotypes, {alpha}, {beta}, {gamma}, and {delta}, it is possible that, during viral infections, multiple p38 isotypes may be differentially activated to induce a specific set of cytokines. Also, this difference may reflect inhibitory effects of these pharmacological inhibitors on other signaling molecules (48, 49, 50).

Inhibition of NF-{kappa}B does not block viral-induced cytokine expression

NF-{kappa}B is a very well-studied signaling molecule that has been reported to activate many genes, including those for inflammatory cytokines. Viral infections and dsRNA are potent activators of NF-{kappa}B (23, 24, 25, 26, 51). Therefore, to determine the role of NF-{kappa}B in viral induction of cytokines in bronchial epithelial cells, we used two different inhibitors, namely sulfasalazine and N-acetylcysteine (NAC). The cells were first treated with NAC (1 mM) for 30 min and then infected with reovirus or treated with dsRNA. After the indicated times, the cells were harvested for RNA extraction and RT-PCR. The data show that treatment of cells with NAC at 1 mM resulted in a significant reduction in viral and dsRNA induction of both TNF-{alpha} and IL-1{beta} (Fig. 6A).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 6. NF-{kappa}B activation is not essential for dsRNA and virus induction of TNF-{alpha} or IL-1{beta}. To determine whether NF-{kappa}B was necessary for viral and dsRNA induction of cytokines, we first used NAC. A, BEAS-2B cells were treated with 1 mM NAC for 30 min and then mock infected or infected with reovirus, or treated with dsRNA. After 4 h of reovirus infections or 2 h of dsRNA treatment, total cellular RNA was subjected to RT-PCR to detect the expression of TNF-{alpha}, IL-1{beta}, or GAPDH (n = 2). B, To verify the effect of another NF-{kappa}B inhibitor on cytokine expression, BEAS-2B cells were first treated with increasing concentra-tions of sulfasalazine (Sulfa) for 30 min. dsRNA at 1 µg/ml was added, and after 2 h, total cellular RNA was used in RT-PCR as in A (n = 4). The effects of sulfasalazine on RSV (C) or reovirus (D) induction of cytokine in epithelial cells was determined by pretreatment of the cells with sulfasalazine as above and then with the infection of the cells with RSV or reovirus at an MOI of 2.5 PFU/cell. After an additional 8 h for RSV and 4 h for reovirus infections, the cells were harvested, and RT-PCR was performed as in A (n = 3).

 
To confirm our results obtained by using NAC, we then examined the effect of another NF-{kappa}B inhibitor, sulfasalazine, in this response. The cells were first treated with sulfasalazine at increasing concentrations, and after 30 min, dsRNA was added at 1 µg/ml, or the cells were infected with reovirus or RSV at an MOI of 2.5 PFU/cell. Total cellular RNA was extracted and subjected to RT-PCR. Interestingly, the data in Fig. 6, BD, revealed that sulfasalazine treatment did not block dsRNA or virus induction of TNF-{alpha} or IL-1{beta}. Because sulfasalazine treatment did not block the induction of TNF-{alpha} or IL-1{beta}, we next performed EMSA experiments to establish whether NF-{kappa}B was inhibited under these conditions. Primary bronchial epithelial cells were incubated with sulfasalazine and then either treated with dsRNA or infected with RSV. After 1 h of dsRNA treatment or 8 h of RSV infection, cellular proteins were extracted and used in EMSA with a specific NF-{kappa}B consensus probe. As shown in Fig. 7, both dsRNA and RSV can activate NF-{kappa}B in epithelial cells, and this activation is efficiently inhibited by sulfasalazine. Because NAC is a known antioxidant (52), taken together, our data suggest that an oxidative step, but not NF-{kappa}B activation, is necessary for viral induction of TNF-{alpha} and IL-1{beta}.



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 7. Sulfasalazine blocks dsRNA and virus activation of NF-{kappa}B. To determine the effect of sulfasalazine on NF-{kappa}B activation, we first treated BEAS-2B cells (A) or A549 cells (B) with increasing concentrations of sulfasalazine. After 30 min, the cells were treated with dsRNA at 1 µg/ml (A) or infected with RSV at MOI of 2.5 PFU/cell. Total cellular proteins were extracted after 2 h of dsRNA treatment or 8 h of RSV infection. Equal amounts of cellular proteins were used in EMSA experiments detecting NF-{kappa}B activation.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Induction of inflammation and innate immune responses toward viral infections is mediated by the early inflammatory cytokines such as TNF-{alpha} and IL-1{beta}. The initial site of viral infections is the epithelium; therefore, the induction of cytokines in epithelial cells can play an important role in the inflammatory and antiviral immune responses. Numerous investigators have identified cytokines and chemokines associated with viral infections both in mice and humans. To date, expression of TNF-{alpha}, IFN-{alpha}{beta}{gamma}, IL-1, IL-4, IL-5, IL-6, IL-8, IL-10, IL-11, IL-12, GM-CSF, and the chemokine RANTES have been associated with viral infections (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 21). The molecular mechanisms explaining how viruses induce these diverse inflammatory mediators are largely unknown.

A very well-studied transcription factor that has been reported to be involved in inflammatory cytokine expression is NF-{kappa}B (27). Previous reports have shown that activation of NF-{kappa}B by a variety of stimuli including viruses can induce several cytokines. Our data show that inhibition of NF-{kappa}B by sulfasalazine does not block the induction of TNF-{alpha} or IL-1{beta} in virus-infected epithelial cells. Interestingly, induction of both cytokines was inhibited by prior treatment of the cells with NAC, which is also an inhibitor of NF-{kappa}B activation. This molecule is also a potent antioxidant and can block intracellular oxidative processes. Taken together, the data indicate that viral induction of TNF-{alpha} and IL-1{beta} in human epithelial cells may require an oxidation step but may not require NF-{kappa}B activation. This is consistent with the previous data showing that induction of IL-6 and IL-8 by human rhinovirus infection in epithelial cells was independent of NF-{kappa}B activation (53).

To characterize further the signaling pathways that are necessary for viral induction of cytokines, we examined p38 MAPK activation. The p38 MAPK pathway can be activated by viral infections and dsRNA treatment (28, 29, 30, 54, 55). Upon stimulation, activated p38 MAPK then activates several transcription factors such as myocyte enhancer factor-2, ELK-1, and activating transcription factor-2 that are involved in inflammation and cytokine expression (56, 57). In our experiments, dsRNA treatment and viral infections activate p38 MAPK, and inhibition of this kinase reduced the dsRNA induction of TNF-{alpha} and IL-1{beta}. It is noteworthy that SB203580 was more effective in blocking both cytokines as compared with SB239063, which reduced TNF-{alpha} more efficiently than IL-1{beta} expression. At this point, the reason for the difference between the two inhibitors is not clear, but it could be due to selective inhibition of the four different isotypes of p38 MAPK or to partial inhibition of other members of the MAPK signaling pathway such as c-Jun N-terminal kinase and extracellular signal-regulated kinase (48, 58, 59, 60). In addition, the p38 MAPK inhibitor SB203580 has been reported to inhibit other signaling molecules such as c-Raf and cylooxygenase-1 and -2 (49, 50). Therefore, it is possible that inhibition of these signaling molecules by SB203580 may, in part, explain our observations.

The relevance of p38 MAPK to virus-induced inflammation was reported by Griego et al. (61) who showed that infection of the BEAS-2B cells with rhinovirus could also activate p38 MAPK. They further showed that treatment of cells with a pharmacological inhibitor of p38 MAPK (SB203580) resulted in a reduction in rhinovirus-induced IL-8, IL-6, and G-CSF expression. In the report by Griego et al. (61), p38 MAPK inhibitors were effectively used at 1–3 µM; however, in our experiments, between 10–20 µM was necessary for a robust reduction in cytokine expression. The reason for this difference is not yet clear.

We recently showed that induction of TNF-{alpha} by dsRNA was mediated by the activation of PKR, but induction of IL-1{beta} was PKR-independent (22). We report in this study that activation of p38 MAPK is necessary for both cytokines. Goh et al. (35) showed that PKR was necessary for p38 MAPK activation. Nevertheless, because there are multiple p38 MAPK subunits, the exact relationship between PKR activation and activation of p38 MAPK subunits is not yet clear. Taken together, these data suggest, but do not prove, that viral activation of PKR and subsequent activation of p38 MAPK are necessary for induction of TNF-{alpha} expression but not for IL-1{beta}.

Recently, a Toll-like receptor (TLR) molecule (TLR3) was reported to recognize dsRNA and activate NF-{kappa}B (62). This pathway could provide an alternative mechanism for dsRNA induction of cytokines. However, our data show that NF-{kappa}B activation is not required for viral or dsRNA induction of TNF-{alpha} or IL-1{beta}. There is a TLR3-mediated NF-{kappa}B-independent pathway that may be activated to induce cytokines. Our data do not exclude the possible involvement of this pathway in our observations. Recently, Jiang et al. (63) showed that dsRNA interaction with TLR3 may activate MAPK and PKR.

Innate immune responses are known to affect the adaptive immune responses by increasing adhesion molecules to recruit monocytes and lymphocytes to the site of infection. Innate responses can also affect B and T cell differentiation by inducing B cell activation and Ig class switching and T cell differentiation toward Th1 or Th2 phenotypes. We previously reported that dsRNA at low concentrations could induce IL-4 in human T cells and IgE class switching in human B cells (26, 64). Our present data are consistent with our previous work showing that dsRNA is a common link between innate and adaptive immune responses against viral infections. Future studies are necessary to delineate the other pathways that are activated by viral infections leading to immune activation and differentiation.


    Footnotes
 
1 This work was supported by Grant AI44696 from the National Institutes of Health to F.I. Back

2 Address correspondence and reprint requests to Dr. Farhad Imani, Division of Clinical Immunology, Department of Medicine, Johns Hopkins University School of Medicine, Asthma and Allergy Center, 5501 Hopkins Bayview Circle, Baltimore, MD 21224. E-mail address: fimani{at}jhmi.edu Back

3 Abbreviations used in this paper: PKR, protein kinase R; MAPK, mitogen-activated protein kinase; RSV, respiratory syncytial virus; MOI, multiplicity of infection; NAC, N-acetylcysteine; TLR, Toll-like receptor. Back

Received for publication March 31, 2003. Accepted for publication July 25, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Subauste, M. C., D. B. Jacoby, S. M. Richards, D. Proud. 1995. Infection of a human respiratory epithelial cell line with rhinovirus: induction of cytokine release and modulation of susceptibility to infection by cytokine exposure. J. Clin. Invest. 96:549.
  2. Bosch, I., K. Xhaja, L. Estevez, G. Raines, H. Melichar, R. V. Warke, M. V. Fournier, F. A. Ennis, A. L. Rothman. 2002. Increased production of interleukin-8 in primary human monocytes and in human epithelial and endothelial cell lines after dengue virus challenge. J. Virol. 76:5588.[Abstract/Free Full Text]
  3. Konno, S., K. A. Grindle, W. M. Lee, M. K. Schroth, A. G. Mosser, R. A. Brockman-Schneider, W. W. Busse, J. E. Gern. 2002. Interferon-{gamma} enhances rhinovirus-induced RANTES secretion by airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 26:594.[Abstract/Free Full Text]
  4. Helin, E., R. Vainionpaa, T. Hyypia, I. Julkunen, S. Matikainen. 2001. Measles virus activates NF-{kappa}B and STAT transcription factors and production of IFN-{alpha}/{beta} and IL-6 in the human lung epithelial cell line A549. Virology 290:1.[Medline]
  5. Message, S. D., S. L. Johnston. 2001. The immunology of virus infection in asthma. Eur. Respir. J. 18:1013.[Abstract/Free Full Text]
  6. Ammit, A. J., A. L. Lazaar, C. Irani, G. M. O’Neill, N. D. Gordon, Y. Amrani, R. B. Penn, R. A. Panettieri, Jr. 2002. Tumor necrosis factor-{alpha}-induced secretion of RANTES and interleukin-6 from human airway smooth muscle cells: modulation by glucocorticoids and {beta}-agonists. Am. J. Respir. Cell Mol. Biol. 26:465.[Abstract/Free Full Text]
  7. Tang, Y. W., B. S. Graham. 1997. T cell source of type 1 cytokines determines illness patterns in respiratory syncytial virus-infected mice. J. Clin. Invest. 99:2183.[Medline]
  8. Garofalo, R., F. Mei, R. Espejo, G. Ye, H. Haeberle, S. Baron, P. L. Ogra, V. E. Reyes. 1996. Respiratory syncytial virus infection of human respiratory epithelial cells up-regulates class I MHC expression through the induction of IFN-{beta} and IL-1{alpha}. J. Immunol. 157:2506.[Abstract]
  9. Becker, S., J. Quay, J. Soukup. 1991. Cytokine (tumor necrosis factor, IL-6, and IL-8) production by respiratory syncytial virus-infected human alveolar macrophages. J. Immunol. 147:4307.[Abstract]
  10. Ronni, T., S. Matikainen, T. Sareneva, K. Melen, J. Pirhonen, P. Keskinen, I. Julkunen. 1997. Regulation of IFN-{alpha}/{beta}, MxA, 2',5'-oligoadenylate synthetase, and HLA gene expression in influenza A-infected human lung epithelial cells. J. Immunol. 158:2363.[Abstract]
  11. Choi, A. M., D. B. Jacoby. 1992. Influenza virus A infection induces interleukin-8 gene expression in human airway epithelial cells. FEBS Lett. 309:327.[Medline]
  12. Minks, M. A., D. K. West, S. Benvin, C. Baglioni. 1979. Structural requirements of double-stranded RNA for the activation of 2',5'-oligo(A) polymerase and protein kinase of interferon-treated HeLa cells. J. Biol. Chem. 254:10180.[Free Full Text]
  13. Miyamoto, N. G., B. L. Jacobs, C. E. Samuel. 1983. Mechanism of interferon action: effect of double-stranded RNA and the 5'-O-monophosphate form of 2',5'-oligoadenylate on the inhibition of reovirus mRNA translation in vitro. J. Biol. Chem. 258:15232.[Abstract/Free Full Text]
  14. Hovanessian, A. G., I. M. Kerr. 1979. The (2'-5') oligoadenylate (pppA2'-5'A2'-5'A) synthetase and protein kinase(s) from interferon-treated cells. Eur. J. Biochem. 93:515.[Medline]
  15. Doukas, J., A. H. Cutler, J. P. Mordes. 1994. Polyinosinic: polycytidylic acid is a potent activator of endothelial cells. Am. J. Pathol. 145:137.[Abstract]
  16. Genin, P., M. Algarte, P. Roof, R. Lin, J. Hiscott. 2000. Regulation of RANTES chemokine gene expression requires cooperativity between NF-{kappa}B and IFN-regulatory factor transcription factors. J. Immunol. 164:5352.[Abstract/Free Full Text]
  17. Lin, R., C. Heylbroeck, P. Genin, P. M. Pitha, J. Hiscott. 1999. Essential role of interferon regulatory factor 3 in direct activation of RANTES chemokine transcription. Mol. Cell. Biol. 19:959.[Abstract/Free Full Text]
  18. De Clercq, E., T. C. Merigan. 1969. Requirement of a stable secondary structure for the antiviral activity of polynucleotides. Nature 222:1148.[Medline]
  19. Goldfeld, A. E., C. Doyle, T. Maniatis. 1990. Human tumor necrosis factor-{alpha} gene regulation by virus and lipopolysaccharide. Proc. Natl. Acad. Sci. USA 87:9769.[Abstract/Free Full Text]
  20. Paludan, S. R., J. Melchjorsen, L. Malmgaard, S. C. Mogensen. 2002. Expression of genes for cytokines and cytokine-related functions in leukocytes infected with herpes simplex virus: comparison between resistant and susceptible mouse strains. Eur. Cytokine Network 13:306.[Medline]
  21. Gern, J. E., D. A. French, K. A. Grindle, R. A. Brockman-Schneider, S. I. Konno, W. W. Busse. 2002. Double-stranded RNA induces the synthesis of specific chemokines by bronchial epithelial cells. Am. J. Respir. Cell Mol. Biol. 28:731.
  22. Meusel, T. R., K. E. Kehoe, F. Imani. 2002. Protein kinase R regulates double-stranded RNA induction of TNF-{alpha} but not IL-1{beta} mRNA in human epithelial cells. J. Immunol. 168:6429.[Abstract/Free Full Text]
  23. Uetani, K., S. D. Der, M. Zamanian-Daryoush, C. de La Motte, B. Y. Lieberman, B. R. Williams, S. C. Erzurum. 2000. Central role of double-stranded RNA-activated protein kinase in microbial induction of nitric oxide synthase. J. Immunol. 165:988.[Abstract/Free Full Text]
  24. Zamanian-Daryoush, M., T. H. Mogensen, J. A. DiDonato, B. R. Williams. 2000. NF-{kappa}B activation by double-stranded-RNA-activated protein kinase (PKR) is mediated through NF-{kappa}B-inducing kinase and I{kappa}B kinase. Mol. Cell. Biol. 20:1278.[Abstract/Free Full Text]
  25. Kumar, A., J. Haque, J. Lacoste, J. Hiscott, B. R. Williams. 1994. Double-stranded RNA-dependent protein kinase activates transcription factor NF-{kappa}B by phosphorylating I{kappa}B. Proc. Natl. Acad. Sci. USA 91:6288.[Abstract/Free Full Text]
  26. Rager, K. J., J. O. Langland, B. L. Jacobs, D. Proud, D. G. Marsh, F. Imani. 1998. Activation of antiviral protein kinase leads to immunoglobulin E class switching in human B cells. J. Virol. 72:1171.[Abstract/Free Full Text]
  27. Baeuerle, P. A.. 1998. I{kappa}B-NF-{kappa}B structures: at the interface of inflammation control. Cell 95:729.[Medline]
  28. Lee, J. C., J. T. Laydon, P. C. McDonnell, T. F. Gallagher, S. Kumar, D. Green, D. McNulty, M. J. Blumenthal, J. R. Heys, S. W. Landvatter, et al 1994. A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 372:739.[Medline]
  29. Hedges, J. C., C. A. Singer, W. T. Gerthoffer. 2000. Mitogen-activated protein kinases regulate cytokine gene expression in human airway myocytes. Am. J. Respir. Cell Mol. Biol. 23:86.[Abstract/Free Full Text]
  30. Fearns, C., L. Kline, H. Gram, F. Di Padova, M. Zurini, J. Han, R. J. Ulevitch. 2000. Coordinate activation of endogenous p38{alpha}, {beta}, {gamma}, and {delta} by inflammatory stimuli. J. Leukocyte Biol. 67:705.[Abstract]
  31. Han, J., J. D. Lee, L. Bibbs, R. J. Ulevitch. 1994. A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science 265:808.[Abstract/Free Full Text]
  32. Hashimoto, S., K. Matsumoto, Y. Gon, S. Maruoka, K. Kujime, S. Hayashi, I. Takeshita, T. Horie. 2000. p38 MAP kinase regulates TNF{alpha}-, IL-1{alpha}- and PAF-induced RANTES and GM-CSF production by human bronchial epithelial cells. Clin. Exp. Allergy 30:48.[Medline]
  33. Derijard, B., J. Raingeaud, T. Barrett, I. H. Wu, J. Han, R. J. Ulevitch, R. J. Davis. 1995. Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms. [Published erratum appears in 1995 Science 269:17.]. Science 267:682.[Abstract/Free Full Text]
  34. Raingeaud, J., A. J. Whitmarsh, T. Barrett, B. Derijard, R. J. Davis. 1996. MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway. Mol. Cell. Biol. 16:1247.[Abstract]
  35. Goh, K. C., M. J. deVeer, B. R. Williams. 2000. The protein kinase PKR is required for p38 MAPK activation and the innate immune response to bacterial endotoxin. EMBO J. 19:4292.[Medline]
  36. Kips, J. C., J. H. Tavernier, G. F. Joos, R. A. Peleman, R. A. Pauwels. 1993. The potential role of tumour necrosis factor-{alpha} in asthma. Clin. Exp. Allergy 23:247.[Medline]
  37. Krunkosky, T. M., B. M. Fischer, L. D. Martin, N. Jones, N. J. Akley, K. B. Adler. 2000. Effects of TNF-{alpha} on expression of ICAM-1 in human airway epithelial cells in vitro: signaling pathways controlling surface and gene expression. Am. J. Respir. Cell Mol. Biol. 22:685.[Abstract/Free Full Text]
  38. Arm, J. P., T. H. Lee. 1992. The pathobiology of bronchial asthma. Adv. Immunol. 51:323.[Medline]
  39. Doherty, P. C.. 1993. Cell-mediated cytotoxicity. Cell 75:607.[Medline]
  40. Kips, J. C., J. Tavernier, R. A. Pauwels. 1992. Tumor necrosis factor causes bronchial hyperresponsiveness in rats. Am. Rev. Respir. Dis. 145:332.[Medline]
  41. Kikuchi, K., Y. Yanagawa, T. Aranami, C. Iwabuchi, K. Iwabuchi, K. Onoe. 2003. Tumour necrosis factor-{alpha} but not lipopolysaccharide enhances preference of murine dendritic cells for Th2 differentiation. Immunology 108:42.[Medline]
  42. Gauchat, J. F., G. Aversa, H. Gascan, J. E. de Vries. 1992. Modulation of IL-4 induced germline {epsilon} RNA synthesis in human B cells by tumor necrosis factor-{alpha}, anti-CD40 monoclonal antibodies or transforming growth factor-{beta} correlates with levels of IgE production. Int. Immunol. 4:397.[Abstract/Free Full Text]
  43. Romagnani, S.. 2000. T-cell subsets (Th1 versus Th2). Ann. Allergy Asthma Immunol. 85:9.[Medline]
  44. Delespesse, G., L. P. Yang, Y. Ohshima, C. Demeure, U. Shu, D. G. Byun, M. Sarfati. 1998. Maturation of human neonatal CD4+ and CD8+ T lymphocytes into Th1/Th2 effectors. Vaccine 16:1415.[Medline]
  45. Imani, F., B. L. Jacobs. 1988. Inhibitory activity for the interferon-induced protein kinase is associated with the reovirus serotype 1 {sigma}3 protein. Proc. Natl. Acad. Sci. USA 85:7887.[Abstract/Free Full Text]
  46. Schreiber, E., P. Matthias, M. M. Muller, W. Schaffner. 1989. Rapid detection of octamer binding proteins with "mini-extracts", prepared from a small number of cells. Nucleic Acids Res. 17:6419.[Free Full Text]
  47. Dong, C., R. J. Davis, R. A. Flavell. 2002. MAP kinases in the immune response. Annu. Rev. Immunol. 20:55.[Medline]
  48. Clerk, A., A. Michael, P. H. Sugden. 1998. Stimulation of the p38 mitogen-activated protein kinase pathway in neonatal rat ventricular myocytes by the G protein-coupled receptor agonists, endothelin-1 and phenylephrine: a role in cardiac myocyte hypertrophy?. J. Cell Biol. 142:523.[Abstract/Free Full Text]
  49. Hall-Jackson, C. A., M. Goedert, P. Hedge, P. Cohen. 1999. Effect of SB 203580 on the activity of c-Raf in vitro and in vivo. Oncogene 18:2047.[Medline]
  50. Borsch-Haubold, A. G., S. Pasquet, S. P. Watson. 1998. Direct inhibition of cyclooxygenase-1 and -2 by the kinase inhibitors SB 203580 and PD 98059: SB 203580 also inhibits thromboxane synthase. J. Biol. Chem. 273:28766.[Abstract/Free Full Text]
  51. Imani, F., D. Proud, D. E. Griffin. 1999. Measles virus infection synergizes with IL-4 in IgE class switching. J. Immunol. 162:1597.[Abstract/Free Full Text]
  52. Fink, M. P.. 2002. Role of reactive oxygen and nitrogen species in acute respiratory distress syndrome. Curr. Opin. Crit. Care 8:6.[Medline]
  53. Kim, J., S. P. Sanders, E. S. Siekierski, V. Casolaro, D. Proud. 2000. Role of NF-{kappa}B in cytokine production induced from human airway epithelial cells by rhinovirus infection. J. Immunol. 165:3384.[Abstract/Free Full Text]
  54. Kyriakis, J. M., J. Avruch. 2001. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol. Rev. 81:807.[Abstract/Free Full Text]
  55. Garrington, T. P., G. L. Johnson. 1999. Organization and regulation of mitogen-activated protein kinase signaling pathways. Curr. Opin. Cell Biol. 11:211.[Medline]
  56. Enslen, H., H. Tokumitsu, P. J. Stork, R. J. Davis, T. R. Soderling. 1996. Regulation of mitogen-activated protein kinases by a calcium/calmodulin-dependent protein kinase cascade. Proc. Natl. Acad. Sci. USA 93:10803.[Abstract/Free Full Text]
  57. Yang, S. H., A. Galanis, A. D. Sharrocks. 1999. Targeting of p38 mitogen-activated protein kinases to MEF2 transcription factors. Mol. Cell. Biol. 19:4028.[Abstract/Free Full Text]
  58. Hale, K. K., D. Trollinger, M. Rihanek, C. L. Manthey. 1999. Differential expression and activation of p38 mitogen-activated protein kinase {alpha}, {beta}, {gamma}, and {delta} in inflammatory cell lineages. J. Immunol. 162:4246.[Abstract/Free Full Text]
  59. Pearson, G., F. Robinson, T. Beers Gibson, B. E. Xu, M. Karandikar, K. Berman, M. H. Cobb. 2001. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr. Rev. 22:153.[Abstract/Free Full Text]
  60. Tian, W., Z. Zhang, D. M. Cohen. 2000. MAPK signaling and the kidney. Am. J. Physiol. 279:F593.
  61. Griego, S. D., C. B. Weston, J. L. Adams, R. Tal-Singer, S. B. Dillon. 2000. Role of p38 mitogen-activated protein kinase in rhinovirus-induced cytokine production by bronchial epithelial cells. J. Immunol. 165:5211.[Abstract/Free Full Text]
  62. Alexopoulou, L., A. C. Holt, R. Medzhitov, R. A. Flavell. 2001. Recognition of double-stranded RNA and activation of NF-{kappa}B by Toll-like receptor 3. Nature 413:732.[Medline]
  63. Jiang, Z., M. Zamanian-Daryoush, H. Nie, A. M. Silva, B. R. Williams, X. Li. 2003. Poly(dI · dC)-induced Toll-like receptor 3 (TLR3)-mediated activation of NF{kappa}B and MAP kinases is through an interleukin-1 receptor-associated kinase (IRAK)-independent pathway employing signaling components TLR3-TRAF6-TAK1-TAB 2-PKR. J. Biol. Chem. 278:16713.[Abstract/Free Full Text]
  64. Kehoe, K. E., M. A. Brown, F. Imani. 2001. Double-stranded RNA regulates IL-4 expression. J. Immunol. 167:2496.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
W. T. Ji, L. H. Lee, F. L. Lin, L. Wang, and H. J. Liu
AMP-activated protein kinase facilitates avian reovirus to induce mitogen-activated protein kinase (MAPK) p38 and MAPK kinase 3/6 signalling that is beneficial for virus replication
J. Gen. Virol., December 1, 2009; 90(12): 3002 - 3009.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
A. U. Ahmed, R. L. Schmidt, C. H. Park, N. R. Reed, S. E. Hesse, C. F. Thomas, J. R. Molina, C. Deschamps, P. Yang, M. C. Aubry, et al.
Effect of Disrupting Seven-in-Absentia Homolog 2 Function on Lung Cancer Cell Growth
J Natl Cancer Inst, November 19, 2008; 100(22): 1606 - 1629.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
X. Dai, K. Sayama, M. Tohyama, Y. Shirakata, L. Yang, S. Hirakawa, S. Tokumaru, and K. Hashimoto
The NF-{kappa}B, p38 MAPK and STAT1 pathways differentially regulate the dsRNA-mediated innate immune responses of epidermal keratinocytes
Int. Immunol., July 1, 2008; 20(7): 901 - 909.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
G. V. Limmon, M. Arredouani, K. L. McCann, R. A. C. Minor, L. Kobzik, and F. Imani
Scavenger receptor class-A is a novel cell surface receptor for double-stranded RNA
FASEB J, January 1, 2008; 22(1): 159 - 167.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. M. Lundberg, S. K. Drexler, C. Monaco, L. M. Williams, S. M. Sacre, M. Feldmann, and B. M. Foxwell
Key differences in TLR3/poly I:C signaling and cytokine induction by human primary cells: a phenomenon absent from murine cell systems
Blood, November 1, 2007; 110(9): 3245 - 3252.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. L. McCann and F. Imani
Transforming Growth Factor {beta} Enhances Respiratory Syncytial Virus Replication and Tumor Necrosis Factor Alpha Induction in Human Epithelial Cells
J. Virol., March 15, 2007; 81(6): 2880 - 2886.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Steer, J. M. Moran, B. S. Christmann, L. B. Maggi Jr, and J. A. Corbett
Role of MAPK in the Regulation of Double-Stranded RNA- and Encephalomyocarditis Virus-Induced Cyclooxygenase-2 Expression by Macrophages.
J. Immunol., September 1, 2006; 177(5): 3413 - 3420.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Shinkai, G. H. Foster, and B. K. Rubin
Macrolide antibiotics modulate ERK phosphorylation and IL-8 and GM-CSF production by human bronchial epithelial cells
Am J Physiol Lung Cell Mol Physiol, January 1, 2006; 290(1): L75 - L85.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. C. W. Lee, C.-Y. Cheung, A. H. Y. Law, C. K. P. Mok, M. Peiris, and A. S. Y. Lau
p38 Mitogen-Activated Protein Kinase-Dependent Hyperinduction of Tumor Necrosis Factor Alpha Expression in Response to Avian Influenza Virus H5N1
J. Virol., August 15, 2005; 79(16): 10147 - 10154.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Arnold and W. Konig
Respiratory Syncytial Virus Infection of Human Lung Endothelial Cells Enhances Selectively Intercellular Adhesion Molecule-1 Expression
J. Immunol., June 1, 2005; 174(11): 7359 - 7367.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. W. McL. Rixon, G. Brown, J. T. Murray, and R. J. Sugrue
The respiratory syncytial virus small hydrophobic protein is phosphorylated via a mitogen-activated protein kinase p38-dependent tyrosine kinase activity during virus infection
J. Gen. Virol., February 1, 2005; 86(2): 375 - 384.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Kumar, J. Zhang, and F.-S. X. Yu
Innate Immune Response of Corneal Epithelial Cells to Staphylococcus aureus Infection: Role of Peptidoglycan in Stimulating Proinflammatory Cytokine Secretion
Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3513 - 3522.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
I S Patel
Viral regulation of inflammatory cytokines in epithelial cells: an alternative signalling pathway
Thorax, December 1, 2003; 58(12): 1019 - 1019.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meusel, T. R.
Right arrow Articles by Imani, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meusel, T. R.
Right arrow Articles by Imani, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS