The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sundrud, M. S.
Right arrow Articles by Unutmaz, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sundrud, M. S.
Right arrow Articles by Unutmaz, D.
The Journal of Immunology, 2003, 171: 3542-3549.
Copyright © 2003 by The American Association of Immunologists

Genetic Reprogramming of Primary Human T Cells Reveals Functional Plasticity in Th Cell Differentiation

Mark S. Sundrud*, Stacy M. Grill*, Donghui Ni{dagger}, Kinya Nagata{ddagger}, Sefik S. Alkan{dagger}, Arun Subramaniam{dagger} and Derya Unutmaz1,*

* Department of Microbiology and Immunology, Vanderbilt University Medical School, Nashville, TN 37232; {dagger} Aventis Pharmaceuticals, Immunology Platform, Bridgewater, NJ 08807; and {ddagger} R & D Center, BML, Inc., Saitama, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activation of naive T cells through the TCR and cytokine signals directs their differentiation into effector or memory subsets with different cytokine profiles. Here, we tested the flexibility of human Th1 or Th2 differentiation by forced expression of transcription factors T-bet and GATA-3. Ectopic expression of T-bet and GATA-3 in freshly isolated human TN cells resulted in their differentiation to a Th1 and Th2 phenotype, respectively, in the absence of polarizing cytokines. Introduction of GATA-3 into lineage-committed Th1 cells induced the expression of Th2-specific cytokines (IL-4 and IL-5) and chemotactic receptors (CCR4, chemoattractant receptor-homologous molecule expressed on Th2 cells (CRTH2). However, these cells partially maintained their Th1-specific profile (IFN-{gamma} and IL-12R{beta}2 expression). Conversely, expression of T-bet in lineage-committed Th2 cells caused a more profound switch to the Th1 phenotype, including the up-regulation of CXCR3 and down-regulation of CCR4 and CRTH2. Interestingly, similar to the naive T cell subset, central memory T cells were also largely programmed toward Th1 or Th2 effector cells upon expression of T-bet and GATA-3, respectively. However, expression of these transcription factors in effector memory T cells was much less influential on cytokine and chemokine receptor expression profiles. Our results reveal remarkable plasticity in the differentiation programs of human memory T cells. This flexibility is progressively diminished as cells mature from naive to effector T cells. These findings have important implications in understanding the molecular mechanisms of human T cell differentiation and for devising novel therapeutic strategies aimed at immunomodulation of skewed effector T cell responses.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Protective immune responses against pathogens are mediated by functionally distinct subsets of Ag-specific effector T cells, termed Th1 or Th2 cells, which display distinct cytokine profiles. The Th1 subset secretes IFN-{gamma} and is instrumental in mobilizing cell-mediated immunity to eliminate intracellular pathogens. In contrast, Th2 cells secrete IL-4, IL-5, and IL-13, which orchestrate humoral responses against helminthic parasites and extracellular microbes (1, 2, 3). Cross-regulation between the Th1 and Th2 subsets is critical for mounting effective immune responses and for preventing immunopathologies, such as those associated with allergy and autoimmune diseases. Cytokine signals are paramount in driving the effector fate of naive T lymphocytes (3, 4). Of key importance, IL-12 or IFN-{gamma} signals drive Th1 differentiation, whereas IL-4 promotes Th2 cell development (2, 3, 4). Signals emanating from the T cell and cytokine receptors culminate in the activation of transcription factors, which in turn specify the fate of naive T cell differentiation.

Induction of the transcription factors GATA-3 and T-bet are critical for differentiation of naive T cells into Th2 and Th1 cells, respectively (5, 6, 7). GATA-3 is a zinc finger protein that is preferentially expressed during the course of Th2 differentiation in response to IL-4 signals. In turn, GATA-3 activates and stabilizes the expression of IL-4, IL5, and IL-13 (5, 8, 9, 10, 11, 12). Several studies have demonstrated that GATA-3 expression is sufficient to direct differentiation into Th2 cells (13, 14, 15, 16, 17, 18, 19). GATA-3 overexpression in murine Th1 cells has been shown to result in the production of Th2 cytokines, as well as a decrease in IFN-{gamma} secretion and chromatin remodeling of the IL-4 locus (13, 14, 19, 20). GATA-3 expression in Th2-lineage committed cells is followed by induction of the transcription factor c-maf which synergistically controls the expression of IL-4 (21, 22, 23). In addition, GATA-3 potently trans activates IL-5 and IL-13 expression (10, 24, 25). In contrast, T-bet, a member of the T-box family of transcription factors, is a master regulator of Th1 lineage commitment (6, 26). T-bet is induced by STAT-1-mediated signals and strongly promotes IFN-{gamma} and IL-12R{beta}2 expression during Th1 cell differentiation while repressing Th2 differentiation (6, 27, 28, 29). Indeed, T-bet-deficient mice exhibit a profound defect in mounting Th1 immune responses (26), and ectopic expression of T-bet in murine Th2 cells directs trans activation of IFN-{gamma}, as well as the up-regulation of IL-12R{beta}2 (6, 27, 28).

Polarized Th1 and Th2 subtypes also express distinct chemokine receptor profiles. Specifically, CCR3, CCR4, and CCR8 are preferentially expressed on Th2 cells (30). In contrast, CXCR3 and to a lesser extent CCR5 are expressed at higher levels on Th1 cells (30). The recently identified PGD2 receptor (chemoattractant receptor-homologous molecule expressed on Th2 cells; CRTH2) (31), although not a member of the chemokine receptor family, is also highly Th2 cell specific and has been shown to have chemotactic activity for this subset (32). Differential expression of chemokines and their receptors within inflamed tissues and lymphoid organs could direct tissue-specific trafficking of Th1 and Th2 cells to areas where their effector functions would be most effective.

Little is known as to how human T cell differentiation into Th1 or Th2 subsets is regulated. The stability of cytokine profiles in differentiated effector and memory T cell subsets are also not well understood. Although a recent study demonstrated that lineage-committed memory T cell subsets are responsive to cytokine signals of the opposing lineage (33), the direct roles of T-bet and GATA-3 in these reprogramming processes remain unclear. The molecular mechanisms that coordinately regulate chemokine receptor expression during T cell differentiation also are poorly understood. To address these key questions, we used a lentiviral transduction system (34) to express the Th1- or Th2-specific transcription factors T-bet or GATA-3 in primary human T cells at different stages of differentiation. We show that naive (TN) and central memory (TCM) human T cells display a high level of flexibility in their cytokine and chemotactic receptor expression profiles as directed by GATA-3 or T-bet. In contrast, effector T cells are more limited in their ability to reprogram their cytokine and chemokine receptor expression. This multifaceted plasticity of human T cells suggests potential strategies for manipulating immune responses during immunological diseases or vaccine development.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lentiviral vectors

Construction of HIV-derived vectors (HDV) was previously described (34). To create a bicistronic vector that expressed a gene-of-interest and a marker gene, we subcloned the murine CD24 (HSA) gene that also contained an upstream internal ribosome entry site (obtained from Clontech Laboratories, Palo Alto, CA) into the HDV vector. Briefly, both internal ribosome entry site and HSA sequences were PCR amplified and triple-ligated into NotI and XhoI sites of HDV in place of the nef gene. Full length GATA-3 cDNA was obtained from the Incyte Genomics (Palo Alto, CA) clone repository. The T-bet gene was PCR amplified from a human Th1-specific cDNA library using T-bet-specific primers and subcloned into the HDV vector. All constructs were confirmed by sequencing of the insert regions.

Purification of resting human T cells

PBMC were separated from neonatal placental cord blood or from adult blood by Ficoll (Pharmacia, Peapack, NJ) centrifugation. Resting CD4+ T cells were purified as previously described (34). Briefly, CD4+ T cells were positively sorted using anti-CD4 Dynabeads followed by Detachabead removal of the beads (Dynal Biotech, Great Neck, NY). Purified CD4+ cells were then incubated with anti-CD8, anti-HLA-DR, anti-CD14, and anti-CD45RO (BD Biosciences, San Jose, CA), followed by Dynabeads conjugated with goat anti-mouse IgG (Dynal Biotech) to deplete bead-bound preactivated or memory T cells as well as residual CD8+ T cells, monocytes, or dendritic cells. After final purification, the cells were 99.5% CD4+CD45RA+RO- as determined by FACS. To purify cells that were infected with HDV constructs expressing the reporter protein mouse CD24 (HSA), T cells were incubated with biotin-conjugated anti-mouse HSA (1 µg/ml) for 30 min on ice. Cells were washed twice with PBS and subsequently incubated with streptavidin-conjugated MACS beads (Miltenyi Biotech, Auburn, CA) for 20 min on ice. After a washing, HSA+ cells were sorted using a magnetic sorter (MACS system from Miltenyi Biotech). To purify central and effector memory T cells, purified CD4+ cells were first stained with {alpha}-CD45RA Abs followed by goat-anti-mouse IgG conjugated to magnetic beads (Dynal) and CD45RA+-naive T cells were removed. The negative portion, which typically is 98% CD45RO+RA-, was stained with a anti-CCR7 Ab (R&D Systems, Minneapolis, MN) and sorted into CD45RO+CCR7+ (central memory) and CD45RO+CCR7- (effector memory) T cells using a flow cytometer sorter (Vanderbilt University Flow Cytometry Facility, Nashville, TN).

T cell activation and differentiation

Differentiation of naive T cells was accomplished via TCR stimulation using anti-CD3 (OKT3; American Type Culture Collection (ATCC)) and anti-CD28 (BD Biosciences) Abs in the presence or absence of polarizing cytokines. Flat-bottom 96-well plates were coated with 10 µg/ml goat anti-mouse IgG (Caltag Laboratories, Burlingame, CA) for 1 h at 37°C. Wells were washed twice with PBS and coated with 1 µg/ml anti-CD3 for an additional hour at 37°C. After a washing to remove unbound CD3 Abs, T cells were added to Ab-coated wells with soluble anti-CD28 (1 µg/ml) and the following cytokine and blocking Ab combinations: human rIL-4 (R&D Systems; 20 ng/ml) and neutralizing anti-IFN-{gamma} (R&D Systems; 2.5 µg/ml) Ab, or human rIL-12 (R&D Systems; 30 ng/ml) and neutralizing anti-IL-4 (R&D Systems; 0.5 µg/ml) Ab. Cells were removed from activation signals after 48–72 h and expanded in rIL-2 (Chiron, Emeryville, CA; 200 U/ml)-containing medium. The culture medium used in all experiments was RPMI supplemented with 10% FCS, as described before (34).

Virus production and infections

Vesicular stomatitis virus-G pseudotyped, replication-incompetent HIV-1 particles were generated as previously described (34). Briefly, HEK-293T cells were transfected with HDV and vesicular stomatitis virus-G plasmids. Supernatants were collected 48 h posttransfection, filtered through 0.45-µm pore size filters, and stored at -80°C. Cytokine or TCR-activated T cells were infected in flat-bottom 96-well plates at a 3–5 multiplicity of infection. In some experiments, cells inoculated with virus were centrifuged for 1 h at 2000 rpm to enhance infections as described (35).

FACS analysis

T cells were stained with the relevant Ab on ice for 45 min in PBS buffer containing 2% FCS and 0.1% sodium azide. Cells were then washed twice, fixed with 1% paraformaldehyde, and analyzed with a FACSCalibur four-color cytometer, using the CellQuest program (BD Biosciences). Live cells were gated based on forward and side scatter properties, and analysis was performed using FlowJo software (Tree Star, San Carlos, CA). The following anti-human Abs were used for staining: CD3, CD4, CD8, CD45RO, CD45RA, CD14, CCR4, CXCR3, IL-12R{beta}2 (all from BD Biosciences); CCR7 (R&D Systems) and a murine Ab against CD24 (HSA) cell surface Ag (BD PharMingen, San Diego, CA). The CRTH2 Ab used for these experiments has been previously described (36).

Real time PCR

Total RNA from resting and activated T helper cells was isolated using Qiagen RNeasy Midi Kit (Qiagen, Chatsworth, CA) following the manufacturer’s instructions. RNA samples were treated with Qiagen DNase (Qiagen) to remove any contaminating DNA and subjected to reverse transcription using Life Technologies SuperScript First-Strand Synthesis System (Invitrogen, San Diego, CA) following the manufacturer’s instructions. The cDNA was then used to perform real time PCR with the TaqMan universal PCR Master Mix (Roche Diagnostic Systems, Somerville, NJ) in a Model 7900 ABI Sequence Detection System. RNA samples were normalized using GAPDH primers and probe (Applied Biosystems, Foster City, CA). The sequences of the primers and probes are as follows. GATA-3 forward, GGACGAGAAAGAGTGCCTC; reverse, TGGGACGACTCCAGCTTCA. GATA-3 probe: FAM-AGGTGCCCCTGCCCGACAGC-BHQ. T-bet forward, GCTGAGTTTCGAGCAGTCAGC; reverse, AGTAGGACATGGTGGGCCC. T-bet probe: FAM-TGAAGCCTGCATTCTTGCCCTCTGC-BHQ. c-maf forward, AAGAGGCGGACCCTGAAAA; reverse, CGTGTCTCTGCTGCACCCT. c-maf probe: FAM-CGGCTATGCCCAGTCCTGCCG.

Cytokine detection

For intracellular cytokine analysis, T cells were stimulated with PMA (Sigma-Aldrich, St. Louis, MO; 50 ng/ml) and ionomycin (Sigma-Aldrich; 0.5 µg/ml) in the presence of 0.67 µl/ml GolgiStop (BD PharMingen). The cells were incubated for 4–6 h at 37°C followed by fixation and permeabilization using a commercial kit (BD PharMingen) according to the manufacturer’s instructions. Subsequently, cells were stained with the following Abs against human cytokines: APC-conjugated anti-IFN-{gamma}; PE-conjugated anti-IL-4; and, in some experiments, PE-conjugated anti-IL-13 and APC-conjugated anti-IL5 (all from BD PharMingen). For detection of secreted cytokines, T cells were stimulated with anti-CD3 (OKT-3; ATCC)-coated plates in the presence of soluble anti-CD28 (BD PharMingen; 1 µg/ml) for 18 h. Supernatants were assayed using a cytometric bead array (CBA) according to the manufacturer’s instructions (BD Biosciences) (37) and analyzed using CBA six-bead analysis software (BD Biosciences).

Western blot analysis of T-bet and GATA-3 expression

CD4+ T cells transduced with the control HDV, HDV.GATA-3, or HDV.T-bet were lysed at 5 x 107 cells/ml in SDS lysis buffer containing 0.25 M Tris base (Sigma-Aldrich), 8% SDS, 4% 2-ME (EM Science, Gibbstown, NJ) and protease inhibitor mixture (Boehringer Mannheim, Mannheim, Germany). Approximately 30 µg of protein lysates were fractionated on 10% SDS-PAGE gels (Invitrogen) and transferred onto PVDF membranes (Bio-Rad Laboratories, Hercules, CA). Blots were probed with anti-T-bet (Santa Cruz Biotechnology, Santa Cruz, CA; N-15) and anti-GATA-3 (Santa Cruz Biotechnology; HG3-31) Abs followed by HRP-conjugated anti-goat IgG (for T-bet Ab) or anti-mouse IgG (for GATA-3 Ab) (Jackson ImmunoResearch Laboratories, West Grove, PA). Blots developed using west pico luminol-peroxide solutions (Pierce) and autoradiographed (Amersham, Arlington Heights, IL). To normalize for protein content, the membranes were stripped using a commercially available stripping solution (Bio-Rad) for 5 min at 37°C and 7 min at 25°C. Stripped membranes were then probed with anti-{beta}-actin (Santa Cruz Biotechnology; I-19) Ab followed by anti-mouse IgG-HRP (The Jackson Laboratory).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Differentiation of TN cells in the presence of ectopic expression of GATA-3 and T-bet

Human TN cells can be polarized to differentiate into Th1 or Th2 cells upon stimulation through the TCR and by either IL-12 or IL-4, respectively. To establish Th1 and Th2 lineage-committed cells from neonatal cord blood, we isolated CD4+ TN cells and activated with anti-CD3 and anti-CD28 Abs in the presence of IL-12 or IL-4. Activated TN cells were expanded in IL-2-supplemented medium for 8–10 days, and effector populations were either probed for expression of the Th2-specific cell surface molecule, CRTH2, or restimulated through the TCR for determination of cytokine profiles. TN cells differentiated into Th1 (IFN-{gamma}highIL-4lowCRTH2-) or Th2 (IFN-{gamma}-IL-4highCRTH2high) effector cells in the presence of the appropriate cytokine milieu (Fig. 1A).



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 1. Differentiation of TN cells expressing T-bet or GATA-3. A, Human TN cells purified from neonatal cord blood or adult PBMC were activated through the TCR under the following conditions: 1) Th0, medium alone; 2) Th1, IL-12 (30 ng/ml), and neutralizing anti-IL-4 (0.5 µg/ml); or 3) Th2, IL-4 (100 ng/ml) and neutralizing anti-IFN-{gamma} (2.5 µg/ml). Cells were activated with anti-CD3 and anti-CD28 Abs and expanded in IL-2-containing medium for 8–10 days. These cells were then restimulated with PMA and ionomycin in the presence of monensin (4 h) for intracellular cytokine staining. CRTH2 cell surface expression was determined via FACS. B, Human TN cells isolated as described in A were again activated through the TCR in medium without polarizing cytokines, but containing the following viral supernatants HDV, HDV.GATA-3, or HDV.T-bet. Cells were expanded for 8–10 days, and cytokine and CRTH2 expression profiles were assessed as detailed in A. The transduced cells were identified by costaining for HSA expression. Data represent one of four experiments with naive T cells purified from different adult and neonatal blood samples.

 
We next asked whether stable expression of T-bet or GATA-3 in highly purified human TN cells could override the requirement for Th1- and Th2-polarizing cytokine signals during Th1 and Th2 cell differentiation, respectively. To ectopically introduce these transcription factors into TN cells, we used an HDV system that allows for highly efficient and stable gene transduction in primary human T cells (34). To monitor the functional effects of T-bet or GATA-3 expression in primary human T cells, we used HDV constructs that bicistronically express a marker gene (HSA). TN cells were infected with HDV, HDV.GATA-3, or HDV.T-bet viruses at the time of CD3 and CD28 stimulation. Activated and transduced cells were expanded for 8 days, and HSA+ cells were purified. Upon reactivation, cells expressing T-bet or GATA-3 displayed typical Th1 or Th2 cytokine profiles, respectively, similar to TN cells polarized with cytokines (Fig. 1B). Furthermore, GATA-3-transduced cells expressed high levels of CRTH2, similar to Th2 cells polarized by IL-4 signals (Fig. 1). These experiments establish a genetic system that can be effectively used to program human T cell lineage commitment.

To directly assess the level of expression of GATA-3 and T-bet in HDV-transduced primary T cells, we conducted Western blot experiments. We detected high levels of GATA-3 or T-bet in T cells transduced with lentiviral vectors expressing these genes as compared with cells transduced with HDV alone (Fig. 2). In addition, we performed real time PCR analysis which demonstrated at least 10-fold increase in transcript levels for both T-bet and GATA-3 in cells transduced with these genes (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 2. Expression of T-bet and GATA-3 in transduced cells. A, Purified CD4+ T cells were activated and transduced, as detailed in the legend to Fig. 1B, with HDV, HDV.GATA-3 or HDV.T-bet viruses. Cells were expanded for 8 days in IL-2-suplemented medium and sorted for HSA expression. These cells were then lysed and western blot analysis was performed for: GATA-3 (A) and T-bet (B) expression using specific Abs. The membranes were stripped and subsequently probed for {beta}-actin. Data are representative of two separate Western blot experiments using transduced cells obtained from different adult blood donors.

 
Reprogramming of lineage-committed Th1 and Th2 human T cells by ectopic expression of GATA-3 or T-bet

We next designed experiments to ask whether the phenotype of activated human TN cells that have already committed to Th1 or Th2 effector states can be reversed upon ectopic expression of GATA-3 or T-bet, respectively. The Th1 and Th2 cells generated from TN cells (Fig. 1) were transduced with HDV.GATA-3, HDV.T-bet, or the control HDV (Fig. 3). After 3 days postinfection, transduced Th1 and Th2 cells were either analyzed for cell surface expression or stimulated through TCR to determine their cytokine profile. Although expression of GATA-3 in committed Th1 cells induced IL-4 and IL-5 to varying degrees and induced CRTH2 expression, it had little effect on IFN-{gamma} production and IL-12R{beta}2 cell surface expression (Fig. 3). In contrast, expression of the Th1-specific transcription factor T-bet in committed Th2 effector cells greatly increased IFN-{gamma} production and IL-12R{beta}2 (Fig. 3). T-bet expression also almost completely extinguished IL-5 expression and resulted in a 10-fold reduction of IL-4 production by Th2 cells (Fig. 3). In addition, expression of T-bet in Th2 cells abrogated CRTH2 cell surface expression (Fig. 3). These data suggest early lineage-committed human T cells retain flexibility in reprogramming their effector functions.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 3. Ectopic expression of GATA-3 or T-bet in committed Th1 or Th2 cells directs the reprogramming of effector functions. Freshly purified human naive CD4+ T cells were activated through the TCR in either Th1- or Th2-polarizing cytokine conditions as described in the legend to Fig. 1. Cells were expanded for 13 days in IL-2-supplemented medium and subsequently transduced with the control HDV, HDV.GATA-3, or HDV.T-bet. Cells were sorted 3 days posttransduction based on HSA expression (for intracellular cytokine analyses and CBA experiments). Cell surface CRTH2 expression was determined as described in the legend to Fig. 1 using unsorted cells. Data are representative of three experiments.

 
We then asked whether this flexibility in the programs of cytokine production during T helper cell differentiation extends to the regulation of chemokine receptor expression. Committed Th1 and Th2 cells transduced with either the control HDV or an HDV expressing the opposing transcription factor were harvested, and cell surface chemokine receptor expression was ascertained through flow cytometric analyses. Genetically unaltered Th1 cells, as well as those transduced with the control HDV expressed a chemokine receptor profile characteristic of Th1 cells (CCR4-CXCR3+). Indeed, Th1 cells in which GATA-3 was ectopically expressed significantly down-regulated CXCR3 expression while inducing high level CCR4 expression (Fig. 4). On the contrary, lineage-committed Th2 cells not transduced or those transduced with HDV displayed the expected Th2-specific chemokine receptor expression profile (CCR4+CXCR3-; Fig. 4), whereas Th2 cells transduced with HDV.T-bet up-regulated CXCR3 expression and down-regulated CCR4 expression (Fig. 4). These data imply that lineage-committed effector T cells can be directly reprogrammed by T-bet or GATA-3 to change their chemokine receptor pattern and thus their migratory preferences.



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 4. Lineage-committed Th1 and Th2 cells modify their chemokine receptor expression profiles upon GATA-3 and T-bet ectopic expression. Similar primary human Th1 and Th2 cell lines were generated via TCR activation as described in the legend to Fig. 3. Transduced cells for these experiments were left unsorted, and chemokine receptor expression profiles were determined via flow cytometric analyses 3 days posttransduction, with transduced cells being separated by costaining for HSA. Results are representative of three experiments using cells from different donors.

 
Flexibility in effector functions of human memory T cell subsets

Naive T cells activated through TCR signaling acquire the ability to produce cytokines and gain other effector functions (38). A portion of these effector T cells become long-lived Ag-specific memory T cells. Recently, human memory T cells have been shown to consist of two subsets, termed central memory (TCM) and effector memory (TEM) T cells (39). TCM cells, defined by the expression of CCR7, express lymphoid homing receptors and lack robust effector functions. However, TCM cells can rapidly respond to pathogens or cytokines and mature into TEM cells, which lose the expression of CCR7, acquire tissue-homing receptors, and secrete large quantities of cytokines (39). The ability of GATA-3 and T-bet to change the cytokine profile of lineage-committed T cells led us to investigate whether the effector functions of TCM and TEM cells could be modified by expression of these transcription factors. The TCM and TEM cells were purified based on expression of CCR7 and CD45RO as previously described (39). To confirm that the CD45RO+CCR7+ and CD45RO+CCR7- subsets represent TCM and TEM cells, respectively, we stimulated these cells through the TCR and determined their cytokine production. As previously reported (39), we found that TEM cells secreted higher quantity of cytokines (TNF-{alpha}, IFN-{gamma}, IL-4, and IL-5) than did TCM cells (data not shown). Highly purified TCM and TEM cells were then transduced with GATA-3- and T-bet-expressing HDV and activated with anti-CD3 and anti-CD28. Cells were expanded for 8 days in IL-2 and restimulated through the TCR to evaluate their effector functions. Expression of GATA-3 in TCM cells resulted in a 5-fold increase in cells that were IL-4+IFN-{gamma}-, typical of a Th2 phenotype, whereas T-bet expression greatly increased the number of IFN-{gamma}+IL-4- TCM cells as compared with nontransduced or control HDV-transduced TCM cells (Fig. 5A). Transduction of GATA-3 into TEM cells also resulted in an increase of IL-4-producing cells (2-fold), albeit this was at a lower magnitude than in TCM cells (Fig. 5A). Ectopic expression of T-bet in TEM cells caused most to express IFN-{gamma}, similar to results observed for TCM subset. However, transduction of T-bet into TEM cells was less effective in suppressing IL-4 expression (Fig. 5A). We also examined the intracellular expression patterns of two other Th2-specific cytokines, IL-5 and IL-13, in GATA-3- or T-bet-expressing TCM and TEM cells (Fig. 5B). GATA-3 overexpression resulted in a 2-fold increase in IL-5+ and IL-13+ TCM and TEM cells (Fig. 5B). In contrast, expression of T-bet greatly reduced the number of IL-5-producing cells and resulted in a 2-fold decline in IL-13+ TCM and TEM T cells (Fig. 5B).



View larger version (66K):
[in this window]
[in a new window]
 
FIGURE 5. Human TCM and TEM cells transduced with T-bet and GATA-3 display flexible cytokine profiles. CD45RO+RA- memory T cells were isolated from adult blood PBMC and sorted via FACS for expression of CCR7 into TCM (CCR7+) and TEM (CCR7-) cells. The two memory T cell populations were then activated for 24 h through the TCR via Ab stimulation (see Materials and Methods) and infected with viruses containing the control HDV, HDV.GATA-3, or HDV.T-bet. After 8 days of expansion, intracellular expression of the cytokines IL-4 and IFN-{gamma} (A), IL-5 (B) or IL-13 (B), were determined by flow cytometry as described in Materials and Methods. For these experiments, transduced cells were left unsorted but were costained with an anti-HSA Ab, and the HSA-positive populations were gated on for analysis of intracellular cytokine production. Data are representative of three separate experiments using memory T cell subsets purified from different adult donors.

 
Concomitant analysis of CRTH2 revealed that GATA-3 expression in TCM cells mimicked the effects observed in TN cells by resulting in an approximate 10-fold induction of CRTH2+ cells. Whereas GATA-3 transduction into TEM cells resulted in only a 2-fold increase in CRTH2 expression (Fig. 6A). In contrast, T-bet expression in both human memory T cell subsets resulted in near abrogation of CRTH2 cell surface expression (Fig. 6A).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 6. Chemokine receptor expression profiles in human TCM and TEM subsets are modified by ectopic expression of T-bet and GATA-3. Human TCM and TEM cells were purified, activated, and transduced with HDV alone, HDV.GATA-3, or HDV.T-bet as in the legend to Fig. 5. After expansion, unsorted cells were stained with Abs against CRTH2 (A), CCR4 (B), or CXCR3 (C) in conjunction with an anti-HSA Ab to gate on transduced populations. The percent of positive cells for the appropriate chemokine receptor is shown. Results are representative of one of four experiments using T cell subsets from distinct adult donors.

 
We next determined whether the chemokine receptor profiles of TCM and TEM cells could also be modified by the ectopic expression of GATA-3 and T-bet, similar to lineage-committed effector Th1 and Th2 cells (Fig. 4). Similar to TN cells, in the presence of GATA-3, CCR4 levels were highly induced in TCM cells, whereas CXCR3 expression was lower (Fig. 6B). T-bet expression in TCM cells resulted in the up-regulation of CXCR3, while conversely down-regulating CCR4 expression (Fig. 6B). Introduction of GATA-3 and T-bet into TEM cells also had an effect on chemokine receptor expression; however, these effects were much more modest than those seen in TN and TCM subsets (Fig. 6B).

Taken together, these results show that the effector functions and chemokine receptor expression profiles of human memory T cells can be genetically reprogrammed through the expression of master transcription factors. However, the functional plasticity observed in effector/memory T cells progressively diminishes as cells move through their differentiation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We demonstrate that lineage-committed and primary human memory T cells, can be genetically reprogrammed toward Th2 or Th1 type cells by the transcription factors GATA-3 and T-bet, respectively. Transduction of GATA-3 in TN and TCM cells induce cytokine and chemokine receptor expression patterns ascribed to Th2 cells. However, GATA-3 fails to significantly down-regulate IFN-{gamma} production and IL-12R{beta}2 expression in cells already committed to the Th1 lineage and in the TEM subset. Conversely, T-bet directs TN and TCM human T cells to a Th1 phenotype, although it was less effective upon expression in the TEM subset. These data suggest a progressive loss of flexibility as T helper cells proceed from naive to effector memory stages of their differentiation.

The acquisition of effector functions and more rapid recall responses to Ags during T cell differentiation form the basis of immunological memory. The TCM and TEM subsets of human memory T cells have distinct effector functions and migratory properties (39, 40). TCM cells express receptors necessary for lymphoid organ trafficking, and display only moderate effector function upon antigenic stimulation. Conversely, TEM cells lose the ability to traffic to lymphoid organs and up-regulate pro-inflammatory chemokine receptors, while secreting robust levels of effector cytokines. TCM cells can further develop into TEM cells upon restimulation through TCR or cytokine receptors, thus maintaining a diverse repertoire of Ag-specific memory cells (39, 40). We have shown that the cytokine profiles of TCM and, to a lesser extent, TEM cells can be reprogrammed by constitutive expression of T-bet or GATA-3. These findings support our hypothesis that TCM cells represent an Ag-primed subset, which is capable of modifying its lineage commitment upon antigenic stimulation to generate new waves of TEM cells. In contrast, one would expect differentiated TEM cells, which have already been programmed to mount specific responses to an invading pathogen, to lack the adaptability to environmental cues that TCM cells exhibit. However, our findings demonstrate that even the cytokine secretion in TEM cells can be partially modified, particularly in response to forced T-bet expression. Indeed, an adaptable memory T cell response, exhibiting plasticity in the context of Ag re-exposure, could be a highly beneficial strategy against constantly evolving pathogens. This hypothesis is also supported by a previous report which demonstrated distinct patterns of cytokine production were elicited in a TCR-transgenic mouse model (41). Our results also suggest that long term human T cell memory could be modulated by either novel vaccine approaches or genetic manipulation of T cell differentiation programs.

Signaling from IL-12R{beta}2 or the IL-4R is thought to be a primary mode of induction of T-bet or GATA-3, respectively, during TCR stimulation of naive T cells (42). In our studies, we bypassed these receptor signals by overexpressing transcription factors. Our observations extend recent findings that the effector functions of human memory T cell subsets exhibit malleability in response to IL-4 signals (33). Although, IL-12R{beta}2 expression is not detectable on Th2 cells and was nonfunctional in murine studies (Fig. 3 and Refs. 43, 44, 45, 46), recent results suggest that Th2-committed human T cells can respond to IL-12 signals (Ref. 47 and our unpublished data). In addition, it is possible that, independent of IL-4 or IL-12 signals, either the strength of AgR activation or other costimulatory signals could act to induce GATA-3 or T-bet in Th1- or Th2-polarized memory T cells, respectively (48, 49, 50, 51).

Consistent with our conclusions, a recent report by Messi et al. (33) demonstrated that cytokine signals are capable of redirecting cytokine profiles in human effector and memory T cell subsets, suggesting that functional cytokine receptors are maintained on lineage-committed T cells to some extent. In this study, a subset of memory T cells did not change their effector status in the presence of opposing cytokines. It was not clear whether this resistance to recommit was maintained through the regulation of cytokine receptor levels, downstream signaling modules, or the induction or activity of opposing transcription factors. Indeed, our results show that ectopic expression of T-bet and GATA-3 can modify effector function and lymphoid homing receptor expression in lineage-committed effector and memory T cells. However, similar to findings by Messi et al., we observed that a population of memory T cells were resistant to T-bet- or GATA-3-mediated reprogramming. This resistant subset grew in size as cells transitioned from TCM to TEM cells. Because we bypassed receptor signals by ectopically expressing programming transcription factors, the likely mechanism for the progressive loss of flexibility within the memory population are heritable epigenetic changes at effector gene (cytokine, chemokine receptor) loci. The study of Messi et al. supports this hypothesis by demonstrating that lineage-committed memory cells failed to modify their histone acetylation patterns of cytokine genes, as compared with TN and TCM cells (33).

Our results also show that ectopic expression of T-bet not only induces IFN-{gamma} and IL-12R{beta}2 expression but can also function to repress expression of Th2 cytokines in lineage-committed Th2 cells, whereas GATA-3 was not effective in suppressing IFN-{gamma} secretion. One possible explanation for this observation could be epigenetic changes such as demethylation of cytosine nucleotides in CpG pairs (52) and/or histone tail modifications (53) which allow for structural rearrangements at appropriate cytokine gene loci. T-bet is critical for robust histone acetylation of the IFN-{gamma} promoter (54). It is possible that T-bet may also help in recruitment of histone deacetylases to Th2 cytokine gene loci, thereby suppressing transcription. In support of this, it was found that the IL-4 promoter and enhancer were hyperacetylated in T-bet-deficient Th1 cells (55). Another possibility could be the down-regulation of other Th2-specific transcription factors such as c-maf (21, 56, 57, 58). Indeed, transduction of T-bet into resting or activated Th2 cells also resulted in a 3- to 6-fold reduction in c-maf gene expression as assessed by real time PCR analysis (data not shown). In contrast to the potency of T-bet, the failure to fully reprogram lineage-committed Th1 cells into Th2 cells by GATA-3 may be due to a requirement for c-maf and perhaps other as yet to be discovered transcription factors (7).

In addition to cytokine production by effector and memory human T cells, chemokines and their cognate receptors play a pivotal role in adaptive immunity. We have shown that primary human TN, TCM, and Th1 lineage-committed T cell subsets transduced to express GATA-3 greatly up-regulated CCR4, while partially down-regulating CXCR3 expression. T-bet overexpression, in contrast, resulted in an opposite expression pattern. However, TEM cells were largely resistant to modulation of CCR4 and CXCR3, consistent with the notion of less flexibility within this subset. Our data show that functional plasticity of early lineage-committed effector and TCM cells extends to the control of lymphoid homing receptors. These findings are significant in understanding how the selective expression of chemokine receptors by Th1 and Th2 cells allows for their preferential recruitment to peripheral tissues and sites of inflammation (59, 60, 61). Indeed, CXCR3 ligands, such as IFN-{gamma}-inducible protein-10, monokine induced by IFN-{gamma}, and IFN-{gamma}-inducible T cell {alpha} chemoattractant, as well as the CCR4 ligands monocyte-derived chemokine and thymus and activation-regulated chemokine, are expressed by a number of cell types and are produced in peripheral tissues during inflammatory reactions (62, 63, 64). Hence, we propose that functional modifications in the TCM subset upon induction of T-bet and GATA-3 could lead to a restructuring of the lymphoid trafficking framework during recall responses to Ags.

Another Th2-specific receptor, CRTH2, upon binding to its ligand, PGD2, serves in the selective recruitment of Th2 cells (31, 32). Our results show that GATA-3 greatly up-regulates cell surface CRTH2 expression, whereas T-bet expression promotes its down-regulation in cells at all stages of differentiation. Interestingly, some cells, such as mast cells, that are potent producers of PGs, including PGD2, also express high levels of IL-4 when stimulated (65). Thus, CRTH2 may play an as yet unidentified role in the amplification of Th2 differentiation by bringing Th2 cells into proximity with high levels of IL-4 in the periphery. It is also possible that PGs themselves may signal through GATA-3-induced CRTH2 to serve as an amplifier, facilitating differentiation into the Th2 lineage. Additionally, CRTH2 expression may play a role in quenching Th1 responses by helping to recruit IL-4-producing Th2 cells to the site of inflammation.

In conclusion, our findings reveal a remarkable degree of plasticity in the differentiation programs of human T cells. In particular, we show that lineage-committed effector T cells, as well as Ag-specific central memory T cell subsets, retain the ability to modify their cytokine and chemokine receptor profiles in response to expression of opposing transcription factors. These findings suggest that during the course of an immune response Ag-specific memory T cells can modulate their effector functions and lymphoid trafficking properties according to the cytokine milieu or other signals provided by APCs. Our results may also have implications in designing therapeutic interventions aimed at ameliorating immunopathologies stemming from misbalanced memory T cell responses, such as allergic asthma or autoimmune diseases. In addition, the feasibility of genetically modifying naive human T cells can be used for the rapid functional validation of genes involved in T helper cell differentiation.


    Acknowledgments
 
We thank Dr. Robert Lewis, Dr. Chris Arendt, Dr. Wasif Khan, Dr. Gene Oltz, Dr. Vineet KewalRamani, and Karla Eger for critical reading and comments; and P. August and A. Brown (Aventis Cambridge Genomics Center) for the human T-bet cDNA.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. Derya Unutmaz, Department of Microbiology and Immunology, Vanderbilt University Medical School, 21st Avenue South, Medical Center North, Room AA-5206, Nashville, TN 37232-2363. E-mail address: Derya.unutmaz{at}vanderbilt.edu Back

2 Abbreviations used in this paper: CRTH2, chemoattractant receptor-homologous molecule expressed on Th2 cells; TN, naive T cell; TCM, central memory T cell; TEM, effector memory T cell; HDV, HIV-derived vector; HSA, heat-stable antigen; CBA, cytometric bead array. Back

Received for publication April 10, 2003. Accepted for publication July 29, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mosmann, T. R., S. Sad. 1996. The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol. Today 17:138.[Medline]
  2. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  3. O’Garra, A.. 1998. Cytokines induce the development of functionally heterogeneous T helper cell subsets. Immunity 8:275.[Medline]
  4. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Medline]
  5. Zheng, W., R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89:587.[Medline]
  6. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655.[Medline]
  7. Ho, I. C., L. H. Glimcher. 2002. Transcription: tantalizing times for T cells. Cell 109:(Suppl.):S109.-S120.
  8. Ho, I. C., P. Vorhees, N. Marin, B. K. Oakley, S. F. Tsai, S. H. Orkin, J. M. Leiden. 1991. Human GATA-3: a lineage-restricted transcription factor that regulates the expression of the T cell receptor {alpha} gene. EMBO J. 10:1187.[Medline]
  9. Zhang, D. H., L. Cohn, P. Ray, K. Bottomly, A. Ray. 1997. Transcription factor GATA-3 is differentially expressed in murine Th1 and Th2 cells and controls Th2-specific expression of the interleukin-5 gene. J. Biol. Chem. 272:21597.[Abstract/Free Full Text]
  10. Zhang, D. H., L. Yang, A. Ray. 1998. Differential responsiveness of the IL-5 and IL-4 genes to transcription factor GATA-3. J. Immunol. 161:3817.[Abstract/Free Full Text]
  11. Ouyang, W., M. Lohning, Z. Gao, M. Assenmacher, S. Ranganath, A. Radbruch, K. M. Murphy. 2000. Stat6-independent GATA-3 autoactivation directs IL-4-independent Th2 development and commitment. Immunity 12:27.[Medline]
  12. Grogan, J. L., M. Mohrs, B. Harmon, D. A. Lacy, J. W. Sedat, R. M. Locksley. 2001. Early transcription and silencing of cytokine genes underlie polarization of T helper cell subsets. Immunity 14:205.
  13. Ouyang, W., S. H. Ranganath, K. Weindel, D. Bhattacharya, T. L. Murphy, W. C. Sha, K. M. Murphy. 1998. Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism. Immunity 9:745.[Medline]
  14. Lee, H. J., N. Takemoto, H. Kurata, Y. Kamogawa, S. Miyatake, A. O’Garra, N. Arai. 2000. GATA-3 induces T helper cell type 2 (Th2) cytokine expression and chromatin remodeling in committed Th1 cells. J. Exp. Med. 192:105.[Abstract/Free Full Text]
  15. Zhang, D. H., L. Yang, L. Cohn, L. Parkyn, R. Homer, P. Ray, A. Ray. 1999. Inhibition of allergic inflammation in a murine model of asthma by expression of a dominant-negative mutant of GATA-3. Immunity 11:473.[Medline]
  16. Finotto, S., M. F. Neurath, J. N. Glickman, S. Qin, H. A. Lehr, F. H. Green, K. Ackerman, K. Haley, P. R. Galle, S. J. Szabo, J. M. Drazen, G. T. De Sanctis, L. H. Glimcher. 2002. Development of spontaneous airway changes consistent with human asthma in mice lacking T-bet. Science 295:336.[Abstract/Free Full Text]
  17. Neurath, M. F., B. Weigmann, S. Finotto, J. Glickman, E. Nieuwenhuis, H. Iijima, A. Mizoguchi, E. Mizoguchi, J. Mudter, P. R. Galle, et al 2002. The transcription factor T-bet regulates mucosal T cell activation in experimental colitis and Crohn’s disease. J. Exp. Med. 195:1129.[Abstract/Free Full Text]
  18. Kurata, H., H. J. Lee, A. O’Garra, N. Arai. 1999. Ectopic expression of activated Stat6 induces the expression of Th2- specific cytokines and transcription factors in developing Th1 cells. Immunity 11:677.[Medline]
  19. Ferber, I. A., H. J. Lee, F. Zonin, V. Heath, A. Mui, N. Arai, A. O’Garra. 1999. GATA-3 significantly downregulates IFN-{gamma} production from developing Th1 cells in addition to inducing IL-4 and IL-5 levels. Clin. Immunol. 91:134.[Medline]
  20. Lee, G. R., P. E. Fields, R. A. Flavell. 2001. Regulation of IL-4 gene expression by distal regulatory elements and GATA-3 at the chromatin level. Immunity 14:447.[Medline]
  21. Ho, I. C., M. R. Hodge, J. W. Rooney, L. H. Glimcher. 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85:973.[Medline]
  22. Ho, I. C., D. Lo, L. H. Glimcher. 1998. c-maf promotes T helper cell type 2 (Th2) and attenuates Th1 differentiation by both interleukin 4-dependent and -independent mechanisms. J. Exp. Med. 188:1859.[Abstract/Free Full Text]
  23. Kim, J. I., I. C. Ho, M. J. Grusby, L. H. Glimcher. 1999. The transcription factor c-Maf controls the production of interleukin-4 but not other Th2 cytokines. Immunity 10:745.[Medline]
  24. Kishikawa, H., J. Sun, A. Choi, S. C. Miaw, I. C. Ho. 2001. The cell type-specific expression of the murine IL-13 gene is regulated by GATA-3. J. Immunol. 167:4414.[Abstract/Free Full Text]
  25. Ranganath, S., W. Ouyang, D. Bhattarcharya, W. C. Sha, A. Grupe, G. Peltz, K. M. Murphy. 1998. GATA-3-dependent enhancer activity in IL-4 gene regulation. J. Immunol. 161:3822.[Abstract/Free Full Text]
  26. Szabo, S. J., B. M. Sullivan, C. Stemmann, A. R. Satoskar, B. P. Sleckman, L. H. Glimcher. 2002. Distinct effects of T-bet in Th1 lineage commitment and IFN-{gamma} production in CD4 and CD8 T cells. Science 295:338.[Abstract/Free Full Text]
  27. Mullen, A. C., F. A. High, A. S. Hutchins, H. W. Lee, A. V. Villarino, D. M. Livingston, A. L. Kung, N. Cereb, T. P. Yao, S. Y. Yang, S. L. Reiner. 2001. Role of T-bet in commitment of Th1 cells before IL-12-dependent selection. Science 292:1907.[Abstract/Free Full Text]
  28. Afkarian, M., J. R. Sedy, J. Yang, N. G. Jacobson, N. Cereb, S. Y. Yang, T. L. Murphy, K. M. Murphy. 2002. T-bet is a STAT1-induced regulator of IL-12R expression in naive CD4+ T cells. Nat. Immunol. 3:549.[Medline]
  29. Lighvani, A. A., D. M. Frucht, D. Jankovic, H. Yamane, J. Aliberti, B. D. Hissong, B. V. Nguyen, M. Gadina, A. Sher, W. E. Paul, J. J. O’Shea. 2001. T-bet is rapidly induced by interferon-{gamma} in lymphoid and myeloid cells. Proc. Natl. Acad. Sci. USA 98:15137.[Abstract/Free Full Text]
  30. Sallusto, F., C. R. Mackay, A. Lanzavecchia. 2000. The role of chemokine receptors in primary, effector, and memory immune responses. Annu. Rev. Immunol. 18:593.[Medline]
  31. Nagata, K., K. Tanaka, K. Ogawa, K. Kemmotsu, T. Imai, O. Yoshie, H. Abe, K. Tada, M. Nakamura, K. Sugamura, S. Takano. 1999. Selective expression of a novel surface molecule by human Th2 cells in vivo. J. Immunol. 162:1278.[Abstract/Free Full Text]
  32. Hirai, H., K. Tanaka, O. Yoshie, K. Ogawa, K. Kenmotsu, Y. Takamori, M. Ichimasa, K. Sugamura, M. Nakamura, S. Takano, K. Nagata. 2001. Prostaglandin D2 selectively induces chemotaxis in T helper type 2 cells, eosinophils, and basophils via seven-transmembrane receptor CRTH2. J. Exp. Med. 193:255.[Abstract/Free Full Text]
  33. Messi, M., I. Giacchetto, K. Nagata, A. Lanzavecchia, G. Natoli, F. Sallusto. 2003. Memory and flexibility of cytokine gene expression as separable properties of human Th1 and Th2 lymphocytes. Nat. Immunol. 4:78.[Medline]
  34. Unutmaz, D., V. N. KewalRamani, S. Marmon, D. R. Littman. 1999. Cytokine signals are sufficient for HIV-1 infection of resting human T lymphocytes. J. Exp. Med. 189:1735.[Abstract/Free Full Text]
  35. O’Doherty, U., W. J. Swiggard, M. H. Malim. 2000. Human immunodeficiency virus type 1 spinoculation enhances infection through virus binding. J. Virol. 74:10074.[Abstract/Free Full Text]
  36. Nagata, K., H. Hirai, K. Tanaka, K. Ogawa, T. Aso, K. Sugamura, M. Nakamura, S. Takano. 1999. CRTH2, an orphan receptor of T-helper-2-cells, is expressed on basophils and eosinophils and responds to mast cell-derived factor(s). FEBS Lett. 459:195.[Medline]
  37. Cook, E. B., J. L. Stahl, L. Lowe, R. Chen, E. Morgan, J. Wilson, R. Varro, A. Chan, F. M. Graziano, N. P. Barney. 2001. Simultaneous measurement of six cytokines in a single sample of human tears using microparticle-based flow cytometry: allergics vs non-allergics. J. Immunol. Methods 254:109.[Medline]
  38. Lanzavecchia, A., G. Lezzi, A. Viola. 1999. From TCR engagement to T cell activation: a kinetic view of T cell behavior. Cell 96:1.[Medline]
  39. Sallusto, F., D. Lenig, R. Forster, M. Lipp, A. Lanzavecchia. 1999. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401:708.[Medline]
  40. Geginat, J., F. Sallusto, A. Lanzavecchia. 2001. Cytokine-driven proliferation and differentiation of human naive, central memory, and effector memory CD4+ T cells. J. Exp. Med. 194:1711.[Abstract/Free Full Text]
  41. Ahmadzadeh, M., D. L. Farber. 2002. Functional plasticity of an antigen-specific memory CD4 T cell population. Proc. Natl. Acad. Sci. USA 99:11802.[Abstract/Free Full Text]
  42. Rengarajan, J., S. J. Szabo, L. H. Glimcher. 2000. Transcriptional regulation of Th1/Th2 polarization. Immunol. Today 21:479.[Medline]
  43. Szabo, S. J., A. S. Dighe, U. Gubler, K. M. Murphy. 1997. Regulation of the interleukin (IL)-12R{beta}2 subunit expression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185:817.[Abstract/Free Full Text]
  44. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
  45. Hilkens, C. M., G. Messer, K. Tesselaar, A. G. van Rietschoten, M. L. Kapsenberg, E. A. Wierenga. 1996. Lack of IL-12 signaling in human allergen-specific Th2 cells. J. Immunol. 157:4316.[Abstract]
  46. Heath, V. L., L. Showe, C. Crain, F. J. Barrat, G. Trinchieri, A. O’Garra. 2000. Cutting edge: ectopic expression of the IL-12 receptor-{beta}2 in developing and committed Th2 cells does not affect the production of IL-4 or induce the production of IFN-{beta}. J. Immunol. 164:2861.[Abstract/Free Full Text]
  47. Smits, H. H., J. G. van Rietschoten, C. M. Hilkens, R. Sayilir, F. Stiekema, M. L. Kapsenberg, E. A. Wierenga. 2001. IL-12-induced reversal of human Th2 cells is accompanied by full restoration of IL-12 responsiveness and loss of GATA-3 expression. Eur. J. Immunol. 31:1055.[Medline]
  48. Kuchroo, V. K., M. P. Das, J. A. Brown, A. M. Ranger, S. S. Zamvil, R. A. Sobel, H. L. Weiner, N. Nabavi, L. H. Glimcher. 1995. B7-1 and B7-2 costimulatory molecules activate differentially the Th1/Th2 developmental pathways: application to autoimmune disease therapy. Cell 80:707.[Medline]
  49. Constant, S., C. Pfeiffer, A. Woodard, T. Pasqualini, K. Bottomly. 1995. Extent of T cell receptor ligation can determine the functional differentiation of naive CD4+ T cells. J. Exp. Med. 182:1591.[Abstract/Free Full Text]
  50. Tao, X., S. Constant, P. Jorritsma, K. Bottomly. 1997. Strength of TCR signal determines the costimulatory requirements for Th1 and Th2 CD4+ T cell differentiation. J. Immunol. 159:5956.[Abstract]
  51. Iezzi, G., E. Scotet, D. Scheidegger, A. Lanzavecchia. 1999. The interplay between the duration of TCR and cytokine signaling determines T cell polarization. Eur. J. Immunol. 29:4092.[Medline]
  52. Bird, J. J., D. R. Brown, A. C. Mullen, N. H. Moskowitz, M. A. Mahowald, J. R. Sider, T. F. Gajewski, C. R. Wang, S. L. Reiner. 1998. Helper T cell differentiation is controlled by the cell cycle. Immunity 9:229.[Medline]
  53. Agarwal, S., A. Rao. 1998. Modulation of chromatin structure regulates cytokine gene expression during T cell differentiation. Immunity 9:765.[Medline]
  54. Mullen, A. C., A. S. Hutchins, F. A. High, H. W. Lee, K. J. Sykes, L. A. Chodosh, S. L. Reiner. 2002. Hlx is induced by and genetically interacts with T-bet to promote heritable Th1 gene induction. Nat. Immunol. 3:652.[Medline]
  55. Avni, O., D. Lee, F. Macian, S. J. Szabo, L. H. Glimcher, A. Rao. 2002. Th cell differentiation is accompanied by dynamic changes in histone acetylation of cytokine genes. Nat. Immunol. 3:643.[Medline]
  56. Miaw, S. C., A. Choi, E. Yu, H. Kishikawa, I. C. Ho. 2000. ROG, repressor of GATA, regulates the expression of cytokine genes. Immunity 12:323.[Medline]
  57. Kurata, H., H. J. Lee, T. McClanahan, R. L. Coffman, A. O’Garra, N. Arai. 2002. Friend of GATA is expressed in naive Th cells and functions as a repressor of GATA-3-mediated Th2 cell development. J. Immunol. 168:4538.[Abstract/Free Full Text]
  58. Zhou, M., W. Ouyang, Q. Gong, S. G. Katz, J. M. White, S. H. Orkin, K. M. Murphy. 2001. Friend of GATA-1 represses GATA-3-dependent activity in CD4+ T cells. J. Exp. Med. 194:1461.[Abstract/Free Full Text]
  59. Hancock, W. W., B. Lu, W. Gao, V. Csizmadia, K. Faia, J. A. King, S. T. Smiley, M. Ling, N. P. Gerard, C. Gerard. 2000. Requirement of the chemokine receptor CXCR3 for acute allograft rejection. J. Exp. Med. 192:1515.[Abstract/Free Full Text]
  60. Frigerio, S., T. Junt, B. Lu, C. Gerard, U. Zumsteg, G. A. Hollander, L. Piali. 2002. {beta} Cells are responsible for CXCR3-mediated T-cell infiltration in insulitis. Nat. Med. 8:1414.[Medline]
  61. Kawasaki, S., H. Takizawa, H. Yoneyama, T. Nakayama, R. Fujisawa, M. Izumizaki, T. Imai, O. Yoshie, I. Homma, K. Yamamoto, K. Matsushima. 2001. Intervention of thymus and activation-regulated chemokine attenuates the development of allergic airway inflammation and hyperresponsiveness in mice. J. Immunol. 166:2055.[Abstract/Free Full Text]
  62. Farber, J. M.. 1997. Mig and IP-10: CXC chemokines that target lymphocytes. J. Leukocyte Biol. 61:246.[Abstract]
  63. Sauty, A., M. Dziejman, R. A. Taha, A. S. Iarossi, K. Neote, E. A. Garcia-Zepeda, Q. Hamid, A. D. Luster. 1999. The T cell-specific CXC chemokines IP-10, Mig, and I-TAC are expressed by activated human bronchial epithelial cells. J. Immunol. 162:3549.[Abstract/Free Full Text]
  64. Andrew, D. P., M. S. Chang, J. McNinch, S. T. Wathen, M. Rihanek, J. Tseng, J. P. Spellberg, C. G. Elias, 3rd. 1998. STCP-1 (MDC) CC chemokine acts specifically on chronically activated Th2 lymphocytes and is produced by monocytes on stimulation with Th2 cytokines IL-4 and IL-13. J. Immunol. 161:5027.[Abstract/Free Full Text]
  65. Benoist, C., D. Mathis. 2002. Mast cells in autoimmune disease. Nature 420:875.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. Tsuji-Takayama, M. Suzuki, M. Yamamoto, A. Harashima, A. Okochi, T. Otani, T. Inoue, A. Sugimoto, T. Toraya, M. Takeuchi, et al.
The Production of IL-10 by Human Regulatory T Cells Is Enhanced by IL-2 through a STAT5-Responsive Intronic Enhancer in the IL-10 Locus
J. Immunol., September 15, 2008; 181(6): 3897 - 3905.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. P. Singh, H. H. Zhang, J. F. Foley, M. N. Hedrick, and J. M. Farber
Human T Cells That Are Able to Produce IL-17 Express the Chemokine Receptor CCR6
J. Immunol., January 1, 2008; 180(1): 214 - 221.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. J. Torres, S. E. VanCompernolle, M. S. Sundrud, D. Unutmaz, and T. L. Cover
Helicobacter pylori Vacuolating Cytotoxin Inhibits Activation-Induced Proliferation of Human T and B Lymphocyte Subsets
J. Immunol., October 15, 2007; 179(8): 5433 - 5440.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
U. De Fanis, F. Mori, R. J. Kurnat, W. K. Lee, M. Bova, N. F. Adkinson, and V. Casolaro
GATA3 up-regulation associated with surface expression of CD294/CRTH2: a unique feature of human Th cells
Blood, May 15, 2007; 109(10): 4343 - 4350.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
C. Aspord, A. Pedroza-Gonzalez, M. Gallegos, S. Tindle, E. C. Burton, D. Su, F. Marches, J. Banchereau, and A. K. Palucka
Breast cancer instructs dendritic cells to prime interleukin 13-secreting CD4+ T cells that facilitate tumor development
J. Exp. Med., May 14, 2007; 204(5): 1037 - 1047.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. M. S. Algood, V. J. Torres, D. Unutmaz, and T. L. Cover
Resistance of Primary Murine CD4+ T Cells to Helicobacter pylori Vacuolating Cytotoxin
Infect. Immun., January 1, 2007; 75(1): 334 - 341.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
W. Sun, J. Hong, Y. C. Q. Zang, X. Liu, and J. Z. Zhang
Altered expression of vasoactive intestinal peptide receptors in T lymphocytes and aberrant Th1 immunity in multiple sclerosis
Int. Immunol., December 1, 2006; 18(12): 1691 - 1700.
[Abstract] [Full Text] [PDF]