The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bedoui, S.
Right arrow Articles by Yamamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bedoui, S.
Right arrow Articles by Yamamura, T.
The Journal of Immunology, 2003, 171: 3451-3458.
Copyright © 2003 by The American Association of Immunologists

Neuropeptide Y (NPY) Suppresses Experimental Autoimmune Encephalomyelitis: NPY1 Receptor-Specific Inhibition of Autoreactive Th1 Responses In Vivo 1

Sammy Bedoui*, Sachiko Miyake*, Youwei Lin*, Katsuichi Miyamoto*, Shinji Oki*, Noriyuki Kawamura*, Annette Beck-Sickinger{dagger}, Stephan von Hörsten{ddagger} and Takashi Yamamura2,*

* Department of Immunology, National Institute of Neuroscience, NCNP, Ogawahigashi, Kodaira, Tokyo, Japan; {dagger} Department of Biochemistry, University of Leipzig, Leipzig, Germany; and {ddagger} Department of Functional and Applied Anatomy, Hannover Medical School, Hannover, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prior studies have revealed that the sympathetic nervous system regulates the clinical and pathological manifestations of experimental autoimmune encephalomyelitis (EAE), an autoimmune disease model mediated by Th1 T cells. Although the regulatory role of catecholamines has been indicated in the previous works, it remained possible that other sympathetic neurotransmitters like neuropeptide Y (NPY) may also be involved in the regulation of EAE. Here we examined the effect of NPY and NPY receptor subtype-specific compounds on EAE, actively induced with myelin oligodendrocyte glycoprotein 35–55 in C57BL/6 mice. Our results revealed that exogenous NPY as well as NPY Y1 receptor agonists significantly inhibited the induction of EAE, whereas a Y5 receptor agonist or a combined treatment of NPY with a Y1 receptor antagonist did not inhibit signs of EAE. These results indicate that the suppression of EAE by NPY is mediated via Y1 receptors. Furthermore, treatment with the Y1 receptor antagonist induced a significantly earlier onset of EAE, indicating a protective role of endogenous NPY in the induction phase of EAE. We also revealed a significant inhibition of myelin oligodendrocyte glycoprotein 35–55-specific Th1 response as well as a Th2 bias of the autoimmune T cells in mice treated with the Y1 receptor agonist. Ex vivo analysis further demonstrated that autoimmune T cells are directly affected by NPY via Y1 receptors. Taken together, we conclude that NPY is a potent immunomodulator involved in the regulation of the Th1-mediated autoimmune disease EAE.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental autoimmune encephalomyelitis (EAE)3 is an animal autoimmune disease that can be induced with sensitization against CNS components such as myelin oligodendrocyte glycoprotein (MOG) (1, 2). Because the neurological signs of paralysis can be monitored continuously and because the pathological findings characterized by focal mononuclear cell infiltrates and demyelinating lesions resemble those found in multiple sclerosis (MS), this representative autoimmune disease model is widely used. It is established that EAE is mediated by CD4+ Th1 T cells producing IFN-{gamma} and TNF-{alpha} in response to the peptide of the CNS components. In support of this consensus, a number of studies have proven that polarizing autoimmune Th1 cells toward Th2 directions (3, 4, 5, 6, 7) leads to suppression of the clinical and pathological manifestations of EAE. These findings indicate that human Th1-mediated diseases such as MS could also be treated or prevented with the Th2-inducing protocols effective in suppression of EAE. Thus, molecular mechanisms controlling the Th1/Th2 balance needs to be further elucidated in terms of the regulation of autoimmunity.

It is now well established that the immune system and the nervous system are connected bidirectionally (8, 9, 10). Although much remains to be investigated, several lines of evidence suggest that the sympathetic nervous system (SNS) provides a major pathway for neuroimmune interactions. Indeed, a role for catecholamines such as norepinephrine and epinephrine in SNS-mediated immunoregulation has been implicated in various conditions (11, 12, 13, 14, 15). Regarding the modulation of autoimmunity, it was previously demonstrated that depletion of SNS transmitters by chemical sympathectomy enhances the severity of EAE (11, 12). Because {beta}-adrenoceptor agonists protect against EAE (13) and catecholamines modulate several immunological functions critical to the pathogenesis of EAE (14), the enhancement of EAE by chemical sympathectomy has largely been attributed to the depletion of catecholamines. However, although neuropeptide Y (NPY) is also released from SNS terminals innervating lymphatic tissues (16, 17), no previous studies have explored the possibility that depletion of other SNS transmitters such as NPY may contribute to these findings.

NPY is a 36-aa peptide. This amidated peptide is abundant in neurons and can be detected in all parts of the body. NPY regulates a variety of physiological activities, including energy balance and feeding, anxiety, neuroendocrine secretion, neuronal excitability, and vasoconstriction (18, 19). NPY exerts its pleiotropic functions through the activation of several G-protein coupled NPY receptor subtypes (18). Accumulating evidence indicates that NPY receptor subtypes mediate the differential actions of NPY (18) and that they are differentially expressed in the mammalian tissues. Whereas expression of Y2 and Y5 receptor is highly restricted to the CNS, Y4 receptors are selectively expressed in the periphery. In contrast, Y1 receptors are rather ubiquitously expressed; their presence has been reported in brain, heart, kidney, gastrointestinal tract, endothelial cells, and leukocytes (18, 19).

Of note, NPY can be found in the storage vesicles of the sympathetic nerve terminals innervating lymph nodes, spleens, and the bone marrow of various species (19). Furthermore, Y1 receptors were demonstrated on rat PBMC (20, 21). These results suggested a role for NPY in neuroimmune interactions. In support of this hypothesis, two independent studies previously showed that NPY significantly modifies the cytokine profile of T helper clone cells in vitro (22, 23). Namely, Levite (23) reported NPY converts the cytokine profile of Th1 clones to a Th0 type in vitro, whereas Kawamura et al. (22) showed that NPY inhibits the IFN-{gamma} production by Th1 clones as well as that of freshly isolated spleen T cells. However, despite the potential of NPY to induce a Th2 shift in vitro, it remains unclear whether NPY may alter the cytokine profile of Th1 cells in vivo. This prompted us to investigate a possible role of NPY in the regulation of EAE mediated by Th1 cells.

To explore the role of NPY in vivo, we immunized female C57BL/6 (B6) mice with MOG35–55 and treated them with NPY and/or NPY receptor subtype-selective compounds every other day. Here we report that exogenous NPY significantly suppresses the clinical course of EAE and that this effect is mediated through the activation of Y1 receptors expressed by T cells. Our experiments have revealed that suppression of IFN-{gamma} production by MOG35–55-specific Th1 cells and the concomitant Th2 bias account for the suppression of EAE.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice and reagents

Female B6 mice were purchased from CLEA Laboratory Animals (Tokyo, Japan), and female SJL/J mice were purchased from Charles River Japan (Tokyo, Japan). The animals were kept under specific pathogen-free conditions and were subjected to experiments at 6–10 wk of age. Rat MOG35–55 (amino acid sequence, MEVGWYRSPFSRVVHLYRNGK) was synthesized at Chiron Technologies (Clayton, Victoria, Australia), and proteolipid protein (PLP) 139–151 (amino acid sequence, HCLGKWLGHPDKF) at Toray Research Center (Tokyo, Japan). IFA and heat-killed Mycobacterium tuberculosis H37Ra were obtained from Difco (Detroit, MI), and pertussis toxin was obtained from List Biological Laboratories (Campbell, CA). NPY was purchased from Sigma-Aldrich (St. Louis, MO). A Y1 receptor agonist, [F7,P34]NPY, and a Y5 receptor agonist, [Ala31,Aib32]NPY, were generated as previously described (24, 25). Another Y1 receptor agonist, [D-His26]NPY (26), was a gift from Schering (Kenilworth, NJ). Receptor specificity of these compounds was achieved by replacing certain amino acids at specific positions that are critical for the structural interaction of native NPY with different NPY receptor subtypes (for details see Table I). The Y1 receptor antagonist BIBO3304, a small nonpeptide compound (27), was kindly provided by Boehringer Ingelheim (Biberach, Germany).


View this table:
[in this window]
[in a new window]
 
Table I. Amino acid sequence of NPY and receptor subtype-specific NPY analogs

 
Immunization

Active EAE was induced in B6 mice as described previously (6, 7). Briefly, the mice were challenged in the tail base with an emulsion containing 100 µg of MOG35–55 and 500 µg of M. tuberculosis in IFA. Directly after the immunization and 48 h later, the mice were injected i.p. with 500 ng of pertussis toxin. SJL/J mice were immunized s.c. with an emulsion containing 100 µg of PLP139–151 and 1000 µg of M. tuberculosis in IFA. They were injected with 200 ng of pertussis toxin shortly after immunization.

Clinical assessment

Mice were observed daily for clinical signs of EAE. Disease severity was scored and evaluated as follows: 0 = normal; 1 = weakness of the tail and/or paralysis of the distal half of the tail; 2 = loss of tail tonicity; 3 = partial hind limb paralysis; 4 = complete hind limb paralysis; 5 = forelimb paralysis or moribund; 6 = death. Cumulative scores were calculated for an individual mouse by summing up the daily scores.

Application of NPY and NPY receptor subtype-specific compounds

NPY and the receptor subtype-specific compounds were diluted in PBS. The animals were injected every second day with NPY and/or these compounds throughout the experiment, unless otherwise stated. Control mice were injected with 200 µl of PBS on alternate days. To treat mice with a combination of NPY and the Y1 receptor antagonist BIBO3304 on alternate days, we injected NPY and the antagonist on the same day (NPY injection followed by BIBO3304) and gave two injections of PBS to control mice.

Measurement of MOG35–55-specific IgG1 and IgG2a titers

ELISA plates were coated with 10 µg/ml MOG35–55 in PBS overnight at 4°C. After blocking with 3% BSA in PBS, serial dilutions of the serum from animals at day 40 after immunization, or normal mice or PBS were added to the plates. MOG35–55-specific Abs were detected, using biotin-labeled anti-IgG1 and anti-IgG2a Abs. After adding streptavidin-peroxidase and a substrate, Ab concentrations were estimated on the basis of dilutions/OD curves.

MOG35–55-specific T cell proliferation assay

After immunization with MOG35–55, the animals were treated every second day with the indicated compounds from day 0 to day 10 after immunization. The mice were sacrificed at day 10 and inguinal and popliteal lymph nodes (LN) were removed. Total LN cells were suspended in RPMI 1640 supplemented with 5 x 10-5 M 2-ME, 2 mM L-glutamine, 100 U/100 mg/ml penicillin/streptomycin, and 1% syngeneic mouse serum (standard medium). We incubated the cells in 96-well round-bottom plates at 1 x 106/well for 72 h (37°C, 5% CO2 atmosphere) in the presence of MOG35–55 (1, 10, or 100 µg/ml). Incorporation of [3H]thymidine (1 µCi/well) for the final 16 h of the culture was determined with a {beta}-1205 counter (Pharmacia, Uppsala, Sweden).

To determine whether the suppressive effects of a Y1 receptor agonist, [D-His26]NPY, are due to its interaction with T cells or with APC, T cells were isolated from the LN using a standard nylon wool column procedure. The LN cells were obtained from MOG35–55-primed mice treated with [D-His26]NPY or PBS. They were applied to the nylon wool column and incubated for 1 h at 37°C (5% CO2 atmosphere), and the T cells were harvested from the column by gently rinsing with RPMI 1640 containing 5% FCS. The LN cells that had been x-irradiated with 4000 rad were used as APC. T cells (5 x 105/well) and APC (5 x 105/well) were than cocultured in 96-well round-bottom plates in the presence or absence of MOG35–55. Cytokine assay was conducted as described below for the supernatants harvested at 48 h. Cell proliferation was determined by measuring the incorporation of [3H]thymidine (1 µCi/well) in the final 16 h of 72-h cultures.

Cytokine assay

To evaluate the effect of Y1 receptor stimulation on the cytokine secretion, LN cells from the MOG35–55-immunized, NPY-treated mice were suspended in the standard medium and cultured in 96-well round-bottom plates at 1 x 106/well for 48 h in the presence of MOG35–55. The concentrations of IFN-{gamma} and IL-4 in the supernatants were determined by using a sandwich ELISA. The assays were performed according to the protocol provided by BD PharMingen (San Diego, CA). All the reagents, including recombinant mouse cytokines and Abs, were purchased from BD PharMingen.

Anti-CD3 stimulation of splenocytes derived from naive mice

For the stimulation of the Ag receptor complex of T cells, 96-well round-bottom plates were coated with 1 µg/ml anti-CD3 mAb (clone 2C11) (BD PharMingen) overnight. After three washings with PBS, splenocytes (1 x 106/well) from untreated, naive animals were added and incubated in the standard medium for 48 h in the presence of various concentrations of [D-His26]NPY. IFN-{gamma} levels in the supernatants were detected with the sandwich ELISA.

Induction of passive EAE in SJL/J mice

At day 10 after immunization with PLP139–151, the total spleen and draining LN cells were prepared from the mice and stimulated with the PLP peptide (30 µg/ml) in the standard medium. The cells were harvested 96 h after culture, and 1.6 x 107 of the cells were injected i.p. into each recipient that had been x-irradiated (300 rad) shortly before cell transfer. The recipient mice were further treated with pertussis toxin on the day of cell transfer and 2 days later (200 ng for each i.p. injection).

In vitro T helper cell differentiation

Spleen T helper cells were polarized for either Th1 or Th2 direction according to the protocol described by others (28). In brief, CD4+CD44low naive T cells were purified from the spleen of young B6 mice by using the magnetic beads (Dynal, Oslo, Norway), and the cells were stimulated with anti-CD3 (2 µg/ml) and anti-CD28 (1 µg/ml) under Th1- or Th2-inducing conditions. Namely, Th1 cells were induced in the presence of mouse IL-12 (5 ng/ml) and anti-IL-4 mAb (HB188; 10 µg/ml), whereas Th2 cells were induced in the presence of mouse IL-4 (1000 U/ml), anti-IFN-{gamma} (HB170; 5 µg/ml), and anti-IL-12 (3 µg/ml). Three days later, the cells were fed with the fresh medium supplemented with 100 U/ml IL-2 in addition to the cytokines and Abs used in the primary stimulation. Eight days later, the cells were harvested and subjected to RNA preparation.

RT-PCR and real time PCR

RT-PCR was used to determine the transcription level of NPY Y1 receptor in the LN cells from MOG35–55-sensitized animals or in the nylon wool-purified spleen T cells from naive mice. Homogenized brain tissues from naive mice served as controls. Total RNA was extracted from these samples using RNABee (Tel-Test, Friendswood, TX). RNA (5 µg) was subjected to reverse transcription with the SuperScript First-Strand Synthesis System (Invitrogen, Carlsbad, CA), and 35 cycles of PCR were conducted using TaqDNA polymerase and GeneAmp PCR system 9700 (Perkin-Elmer, Applied Biosystems, MA). Each cycle of PCR amplification comprised denaturation (95°C for 5 min), annealing (54°C for 30 s), and amplification (72°C for 60 s). The products of these reactions were analyzed by 2% gel electrophoresis. Primers used were as follows: Y1 receptor sense, CTTCGGGGAGACCATGTGCAAACTGAATC; Y1 receptor antisense, AGGAGAGTCGTGTAAGACAG; GAPDH sense, AACGACCCCTTCATTGAC; GAPDH antisense, TTCACGACATACTCAGCAC. Real time PCR was conducted by using the Light Cycler quantitative PCR system (Roche Molecular Biochemicals, Mannheim, Germany). We used a commercial kit (Light Cycler-FastStart DNA Master SYBR Green I; Roche Molecular Biochemicals) according to the manufacturer’s instructions.

Statistical analysis

We used the Mann-Whitney test to analyze the differences in the clinical score of treatment vs control group. Data for cytokines and proliferative responses were subjected to overall two-way ANOVA. When there was a significant difference, a Fisher post hoc test was implemented. The statistical analysis was performed using SPSS for Windows.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NPY inhibits actively induced EAE in a dose-dependent manner

To investigate a possible effect of NPY on actively induced EAE, we immunized female B6 mice with MOG35–55 to actively induce EAE. The mice were injected with 0.01–50 µg/kg NPY i.p. on alternate days from the day of immunization (day 0) until the termination of the experiments. The selection of NPY dosages is based on previous studies (29). We found that the continuous, alternate day treatment with NPY inhibits the clinical severity of EAE in a dose-dependent manner (Fig. 1). The maximum disease score was significantly inhibited when the mice were treated with 50 µg/kg (but not 0.01 or 1.0 µg/kg) of NPY (Fig. 1A and Table II). However, the cumulative disease score was effectively suppressed at both 1 and 50 µg/kg (Fig. 1B).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 1. Effect of NPY on actively induced EAE. EAE was induced in female B6 mice by an immunization with MOG35–55 in CFA as described in Materials and Methods. A, Repetitive treatment with NPY (50 µg/kg) suppresses the clinical course of EAE as compared with sham-treated animals (PBS). B, Treatment with various NPY dosages induced a dose-dependent inhibition of EAE as assessed by cumulative disease scores. Statistical analysis reveals a significant inhibition of the cumulative disease score at 1 µg/kg (p = 0.0196) and 50 µg/kg (p = 0.0176) vs control mice injected with PBS. One representative experiment is shown (n = 5 for each group) and data are expressed as mean ± SEM. *, Significant differences between NPY and controls (PBS). Further statistical analysis is shown in Table II.

 

View this table:
[in this window]
[in a new window]
 
Table II. Effect of NPY/receptor-specific analogs on EAE actively induced in wild-type B6a

 
The inhibitory action of NPY is due to Y1 receptor activation in vivo

Given that differential actions of NPY are mediated through distinct receptor subtypes (18, 19), we sought to elucidate which NPY receptor subtypes are involved in the EAE-inhibitory action of NPY. To this aim, we used various NPY receptor subtype-specific compounds. Lymphoid cell expression of Y1 receptor has been recently reported (20, 21). In a first step, we treated MOG35–55-immunized mice with a combination of the amount of NPY found to consistently inhibit EAE (50 µg/kg) and 100 µg/kg of the Y1 receptor antagonist BIBO3304. Interestingly, blocking Y1 receptors with BIBO3304 abrogated the suppressive effect of NPY on EAE (Fig. 2A). This indicates that NPY probably inhibits clinical signs of EAE via Y1 receptors. To further clarify this point, we treated the mice with a novel Y1 receptor agonist, [D-His26]NPY (Table I). Preliminary experiments showed that this compound is very potent and that a smaller dose (0.1 µg/kg to 0.01 µg/kg) than that for NPY effectively suppresses EAE. Due to a limited amount of the compound available, we treated the mice with 0.01 µg/kg of [D-His26]NPY on alternate days until the end of the experiment. As shown in Fig. 2B and Table II, this Y1 receptor agonist significantly down-regulated the clinical course of EAE, further supporting the role of Y1 receptor in the NPY-mediated suppression of EAE. We also examined the effect of another Y1 receptor agonist, [F7,P34]NPY, on EAE at 0.01, 0.1, and 1 µg/kg. Unlike [D-His26]NPY, [F7, P34]NPY was not effective at 0.01 or 0.1 µg/kg. However, treatment with 1 µg/kg [F7,P34]NPY every other day significantly ameliorated clinical signs of EAE (Table II). In contrast, treatment with a selective Y5 receptor agonist, [Ala31,Aib32]NPY, did not show any effect on the clinical course of EAE (Table II). Taken together, these experiments strongly indicate that exogenous NPY suppresses the clinical signs of EAE through the activation of Y1 receptors.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 2. Receptor specificity of the suppressive effect of NPY. A, The suppressive effect of NPY is abrogated when NPY is administered in combination with the Y1 receptor antagonist BIBO3304 (100 µg/kg). B, The novel and highly selective Y1 receptor agonist [D-His26]NPY (0.01 µg/kg) induced a similar suppression of EAE as seen with NPY (Fig. 1A). Data represent mean ± SEM. Additional disease parameters are analyzed in Table I.

 
Next we asked whether endogenous NPY plays a role in the natural course of EAE. To answer this question, we evaluated the clinical course of EAE in mice treated with the Y1 receptor antagonist BIBO3304. Blocking Y1 receptors with BIBO3304 led to a significantly earlier onset of disease (Table II), although severity of EAE after onset was not significantly altered. This indicates that endogenous NPY prevents premature development of EAE by interfering with the induction of MOG35–55-specific autoimmune T cells, but it is inefficient to modulate the effector phase of EAE.

Y1 receptor agonist inhibits induction phase of EAE

We attempted to treat the mice with the Y1 receptor agonist [D-His26]NPY after appearance of the first clinical signs of EAE. However, the treatment protocols starting after onset of clinical manifestations did not significantly alter the clinical course of EAE (data not shown), indicating that Y1 receptor stimulation could not modify the effector phase of EAE. In contrast, alternate day administration of the D-His26 compound during the induction phase of EAE (from day 0 to 10) after sensitization significantly inhibited the development of EAE (Fig. 3). In fact, the induction phase treatment (days 0–10) was as efficient as the long term treatment (days 0–34) covering both induction and effector phases. This result implies that Y1 receptor stimulation leads to the inhibition of induction, but not effector phase of EAE.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 3. [D-His26]NPY treatment from day 0 to day 10 significantly suppresses development of EAE. The B6 mice sensitized with MOG35–55 were treated i.p. with [D-His26]NPY (0.01 µg/kg) every other day either throughout the experiment (Y1R day 0–34) or during the induction phase (Y1R day 0–10). Compared with control mice that were given PBS on alternate days, the mice treated with [D-His26]NPY showed milder clinical course. The effect of the treatment from day 0 to day 10 is comparable with the continuous treatment from day 0 to 34. Data represent mean ± SEM. Each treatment group consists of five mice.

 
EAE suppression is associated with an inhibition of MOG35–55-specific Th1 response

NPY has been demonstrated to alter the cytokine profile of in vitro established Th1 clones toward Th2 directions (22, 23). We therefore speculated that the inhibitory action of NPY on EAE might be due to a modulation of the Th1/Th2 balance resulting from a Th2 bias of MOG35–55-reactive T cells. To explore this possibility, we first measured serum levels of IgG1 and IgG2a isotypes of anti-MOG35–55 Abs at day 40 after immunization. It is generally accepted that elevation of Ag-specific IgG2a Ab results from the augmentation of a Th1 immune response to the Ag, whereas a higher level of IgG1 Ab reflects a stronger Th2 response to the Ag. Fig. 4A demonstrates that the treatment with NPY and the Y1 receptor agonists remarkably inhibits anti-MOG35–55 IgG2a titers, but they do not significantly alter IgG1 titers. Consequently, the IgG1-IgG2a ratio was significantly elevated in mice treated with either NPY or the Y1 receptor agonists, indicating that the suppression of EAE after NPY treatment is associated with a Th2 bias of MOG35–55-reactive autoimmune T cells (Fig. 4B).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 4. Analysis of anti-MOG35–55 Abs of IgG1 and IgG2a isotype after treatment with NPY and Y1 receptor agonists. A, NPY (p = 0.0430) and the Y1 receptor agonists [F7,P34]NPY (p = 0.0091) and [D-His26]NPY (p = 0.0147) induced a significant inhibition of IgG2a. B, Assessment of the IgG1-IgG2a ratio revealed that NPY (p = 0.0309) and the Y1 receptor agonists [F7,P34]NPY (p = 0.0054) and [D-His26]NPY (p = 0.0417) would induce a Th2 bias of T cell response to MOG35–55. Serum samples (n = 5 per condition) were obtained at day 40 after immunization and were analyzed as indicated in Material and Methods. Data represent mean ± SEM; *, significant differences between NPY/analogs and controls (PBS).

 
Treatment with the Y1 receptor agonist inhibits the ex vivo production of IFN-{gamma} by MOG35–55-specific T cells

To further characterize the immunomodulatory properties of NPY in vivo, we isolated the draining LN cells at day 10 from mice treated with [D-His26]NPY and from control mice treated with PBS and stimulated the lymphoid cells with MOG35–55 in vitro. We compared these two groups with respect to the levels of IFN-{gamma} and IL-4 in the culture supernatant and cell-proliferative responses. We found that in vivo treatment with the Y1 receptor agonist significantly inhibited the production of IFN-{gamma} on in vitro stimulation with MOG35–55 (Fig. 5A). [D-His26]NPY seemed to slightly inhibit the proliferation of MOG35–55-specific T cells as well (Fig. 5B), but it was not statistically significant. IL-4 concentrations were below the detection level. These results indicate that the inhibition of IFN-{gamma} production by MOG35–55-specific T cells may underlie the Th2 deviation (a higher IgG1-IgG2a ratio) provoked by the Y1 receptor agonist.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 5. Comparison of MOG35–55-specific T cell responses after in vivo treatment with [D-His26]NPY and PBS. A, In vivo treatment with the Y1 receptor agonist [D-His26]NPY significantly inhibits the ability of MOG35–55-specific T cells to secrete IFN-{gamma} on Ag challenge (treatment vs control; 100 µg MOG35–55, p < 0.0001). B, Tendency toward inhibition of the proliferative response of MOG35–55-specific T cells. Statistical analysis revealed no significant differences (ANOVA). Popliteal and inguinal LN cells from treated and control animals were incubated in the presence of MOG35–55 for 48 h. IFN-{gamma} was detected by ELISA, and proliferation was determined by estimating the uptake of [3H]thymidine. Pooled data from three independent experiments is shown (n = 9). Error bars, SEM; *, significant differences.

 
NPY treatment alters autoimmune T cells but not APC

To obtain insights into the altered Th1/Th2 balance through the activation of Y1 receptors, we explored whether T cells or APCs are the major target of NPY. To address this question, we separated T cells from animals treated in vivo with either [D-His26]NPY (treated) or PBS (untreated). The T cells were mixed with irradiated LN cells from treated or untreated mice, serving as APC, and then stimulated with 100 µg/ml MOG35–55 in vitro. Despite whether T cells from untreated mice (untreated T cells) were reconstituted with treated or untreated APC, they responded equally well to MOG35–55 with regard to the production of IFN-{gamma} (Fig. 6A, Columns 3 and 4). However, when T cells from treated mice (treated T cells) were used for reconstitution (Fig. 6A, Columns 1 and 2), IFN-{gamma} production was remarkably reduced regardless of the source of the APC (two ANOVA, p = 0.001). However, cell proliferation responses were not significantly different among the reconstituted populations (Fig. 6B). These results demonstrate that the in vivo effect of [D-His26]NPY is mediated by the selective alteration of the T cell function to secrete IFN-{gamma} but not of APC.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of [D-His26]NPY on primed T cells and APC. T cells and APC were isolated from animals treated with either [D-His26]NPY in vivo (treated) or PBS (untreated) and then coincubated in the presence of MOG35–55 in vitro. A, Significant inhibition of the IFN-{gamma} secretion is observed only in T cells from treated animals (two-way ANOVA: treated T cells vs untreated T cells, p = 0.001). Coincubation with either treated or untreated APC revealed no statistically significant differences. B. The proliferative response is not significantly different, although there is a tendency toward a decreased proliferation on treatment. Pooled data from two independent experiments is shown (n = 6). Error bars represent SEM.

 
Mouse T cells express Y1 receptor mRNA and respond to the Y1 receptor agonist in vitro

The in vivo results presented above strongly suggest that NPY acts on EAE via direct activation of Y1 receptors expressed on the MOG35–55-specific autoimmune T cells. To verify this further, we examined whether mouse T cells express the Y1 receptor. As shown in Fig. 7, RT-PCR enabled us to detect the expression of Y1 receptor mRNA in MOG35–55-sensitized LN cells (Fig. 7A) and in spleen T cells isolated from naive mice (Fig. 7B). We also examined expression levels of the Y1 receptor in T cells polarized in vitro toward Th1 or Th2, according to the described method (28). We saw no significant difference between Th1 and Th2 cells regarding the Y1 receptor expression.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 7. Constitutive expression of Y1 receptor mRNA in LN cells from immunized animals and T cells from naive mice. A, LN cells from animals immunized with MOG35–55 express Y1 receptor RNA (left panels). LN cells were prepared as described in Material and Methods. RNA from homogenized mouse brain was used as a positive control (right panels in both A and B). One representative experiment is shown. B, T cells isolated from spleens of naive animals also express Y1 receptor RNA (left panels). Five micrograms of total RNA were used for RT-PCR, and amplified products were analyzed by agarose gel electrophoresis. GAPDH was used as a control for equal loading. The sizes of the PCR products were 334 bp for the Y1 receptor and 190 bp for GAPDH.

 
To further determine the functional significance of these findings, we stimulated spleen T cells with plate-bound anti-CD3 mAb in the presence of different concentrations of [D-His26]NPY (10-12–10-8 M), and measured IFN-{gamma} in the supernatant. The results indicate that the Y1 receptor agonist significantly inhibits the secretion of IFN-{gamma} on stimulation with anti-CD3 Ab in a dose-dependent manner (Fig. 8). These data further support that the Th2 bias found in vivo is mediated through the activation of functional Y1 receptors expressed on autoimmune T cells.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 8. Splenocytes from naive mice were stimulated by a plate-bound anti-CD3 mAb in the presence of various concentrations of [D-His26]NPY. The Y1 receptor agonist induced a dose-dependent inhibition of the secretion of IFN-{gamma} in vitro (Y1 receptor agonist vs control: 10-12 M, p = 0.023; 10-10 M, p = 0.001; 10-8 M, p < 0.0001). Pooled data from three independent experiments are shown (n = 7). Error bars, SEM; *, significant differences between treated and untreated conditions.

 
Effect of the Y1 receptor agonist on EAE induced in SJL/J mice

Furthermore, we asked whether the Y1 receptor agonist might also modulate acute EAE actively induced with PLP139–151 in SJL/J mice. We found that the continuous treatment from day 0 to day 30 significantly suppressed clinical EAE, regarding the maximum clinical score: D-His26-treated mice, 1.8 ± 0.52 vs PBS-treated mice, 3.2 ± 0.37 (p < 0.02). Administration of D-His26 during the induction phase (from day 0 to day 10) also reduced the clinical severity of EAE as compared with treatment with PBS. It was interesting to know whether the treatment during the induction phase may inhibit the generation of encephalitogenic T cells reactive to PLP139–151. To answer this question, we isolated PLP139–151-sensitized lymphoid cells from D-His26- or PBS-treated mice at day 10 after immunization and stimulated the cells in vitro with PLP139–151. The activated T cells were adoptively transferred to naive SJL/J mice to induce passive EAE as described in Materials and Methods. Our protocol induced very serious EAE in the recipients (n = 5 for each group), and all the recipient mice died before day 18 after cell transfer. However, there was a clear tendency that mice transferred with T cell blasts from D-His26-treated mice would survive for a longer period of time (the date of death in an individual mouse: day 14, day 17, day 17, day 17, day 17) compared with those given the T cell blasts from PBS-treated mice (the date of death: day 8, day 11, day 14, day 15, day 15). In addition, the mice transferred with the T cells from [D-His26-treated mice showed a reduced clinical score at day 8 compared with the control mice (1.5 ± 0.5 vs 4.5 ± 0.6). These results indicate that NPY Y1 agonist is effective also for EAE induced in SJL/J mice and that the mechanism of action is to interfere with the process of effector lymphocyte generation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
With regard to the bidirectional interaction between the immune and the nervous system, prior studies have indicated that catecholamines released from sympathetic nerve endings regulate Th1 responses and Th1-mediated disease such as EAE. Our study demonstrates that NPY also plays an important role in the regulation of EAE. It has previously been indicated that NPY modulates various T cell functions in vitro, including T cell adhesion to integrins (30) and cytokine secretion of in vitro established T clones (22, 23). Our study could be regarded as the first work to provide evidence that NPY modulates T cell function in vivo and that NPY is involved in the natural regulation of Th1-mediated autoimmunity.

The action of NPY is mediated via distinct receptor subtypes such as the Y1, Y2, Y4, and Y5 receptor. Here we conclude that Y1 receptors are the main receptor subtypes engaged in the NPY-mediated suppression of EAE. This conclusion was obtained from a series of experiments applying Y1 receptor agonists and a Y1 receptor antagonist. Firstly, we showed that the suppressive effect of NPY on EAE was abolished when we coinjected the Y1 receptor antagonist BIBO3304. Secondly, we replaced native NPY with two types of compounds known to selectively stimulate Y1 receptors ([D-His26]NPY, [F7,P34]NPY) and found that these NPY analogs also effectively suppress the development of EAE. However, a Y5 receptor agonist was not effective. Thirdly, treatment with BIBO3304 resulted in a significantly earlier onset of disease. All of these results indicate that Y1 receptor engagement leads to the suppression of EAE.

The Y1 receptor agonists appear to be much more potent EAE inhibitors than native NPY. In terms of the dosage requirement to gain clinical effects, the hierarchy for the native and altered NPY compounds was apparent ([D-His26]NPY > [F7,P34]NPY > native NPY). It seems that the efficacy of these ligands as EAE therapeutics correlates with the specificity for the Y1 receptors. Namely, [D-His26]NPY is more selective for Y1 receptors, compared with [F7,P34]NPY (24). Taking this into consideration, it is possible that stimulation of non-Y1 receptors may compete with Y1 receptor ligation. Alternatively, the Y1 receptor agonists may be more efficacious as ligands than native NPY in inducing intracellular events leading to the immunoregulation. Alternatively, these differences in the potency of Y1 receptor compounds and the native peptide NPY may be explained by parallel activation of stimulatory and inhibitory Y receptors by NPY itself rather than by the specific ligands. Furthermore, it is possible that the different Y1 receptor specific compounds exhibit a differential tissue penetration or may be differentially degraded by specific enzymes such as CD26 (31, 32). Further studies are needed to verify these postulates and provide us with a new insight into NPY-Y1 receptor interactions.

The experiment using the Y1 receptor antagonist BIBO3304 showed an earlier onset of EAE, although the disease course was not altered after onset. This indicates that endogenous NPY plays a regulatory role in the induction phase, but not in the effector phase of EAE. Consistent with this, we showed that the treatment during the induction phase is as effective as the continuous treatment covering both induction and effector phases, whereas the treatment starting after onset of EAE does not change the clinical course of EAE. A possible explanation for the failure of the Y1 receptor antagonist to alter the effector phase is that endogenous NPY levels may substantially decrease in the effector phase, owing to enzymatic degradation. Whereas it is currently impossible to measure the NPY levels in mice with EAE, it is well known that NPY is cleaved by enzymes such as dipeptidyl peptidase IV (CD26), a membrane-bound enzyme, constitutively expressed on numerous cells including leukocytes (31, 32). In addition, activated T cells are reported to express a higher level of CD26 on their surface (33). Thus, it is possible that the contribution of endogenous NPY to the immunoregulation might be reduced in the effector phase because of the rapid degradation by enzymes such as CD26. It is necessary to pursue this issue with different methodologies.

Regarding the mechanism for NPY-mediated suppression of EAE, we showed a significant inhibition of anti-MOG35–55 IgG2a titers and of IFN-{gamma} production by MOG35–55-specific T cells after treatment with [D-His26]NPY. In contrast, IgG1 titers were unaffected, which resulted in a higher IgG1-IgG2a ratio in treated mice. Also, T cell-proliferative responses were not affected significantly. On the basis of these results, we conclude that NPY plays a selective role in inhibiting IFN-{gamma} production by MOG35–55-specific T cells, leading to a Th2 bias. Ex vivo reconstitution experiments also showed that MOG35–55-specific T cells are the major target for NPY. Although the presence of functional Y1 receptors on rat leukocytes has been documented (20, 21), we proved here the presence of mRNA encoding the Y1 receptor in T cell populations. Accompanying in vitro experiments further confirmed that NPY suppresses T cell production of IFN-{gamma} provoked by CD3 cross-linking.

In conclusion, this study demonstrates for the first time to our knowledge that NPY has an immunomodulatory activity that suppresses signs of EAE. Given that the levels of NPY in the CSF are reduced in patients with MS (34, 35), it is tempting to speculate that NPY may also play a critical role in preventing the development of MS. With the availability of novel and highly selective agonists and their ability to mimic the effects of NPY in a highly specific manner, we propose that targeting NPY receptors may be a promising new therapeutic approach to autoimmune disorders.


    Acknowledgments
 
We thank Kylie Bruce for correction of the English.


    Footnotes
 
1 This work was supported by the research funds from the Ministry of Health, Labor, and Welfare of Japan and from the Organization for Pharmaceutical Safety and Research (Kiko). Back

2 Address correspondence and reprint requests to Dr. Takashi Yamamura, Department of Immunology, National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigashi, Kodaira, 187-8502 Tokyo, Japan. E-mail address: yamamura{at}ncnp.go.jp Back

3 Abbreviations used in this paper: EAE: experimental autoimmune encephalomyelitis; LN, lymph node; MOG, myelin oligodendrocyte glycoprotein; MS, multiple sclerosis; NPY, neuropeptide Y; PLP, proteolipid protein; SNS, sympathetic nervous system. Back

Received for publication January 22, 2003. Accepted for publication July 21, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wekerle, H.. 1993. Experimental autoimmune encephalomyelitis as a model of immune-mediated CNS disease. Curr. Opin. Neurobiol. 3:779.[Medline]
  2. Hemmer, B., S. Cepok, S. Nessler, N. Sommer. 2002. Pathogenesis of multiple sclerosis: an update on immunology. Curr. Opin. Neurol. 15:227.[Medline]
  3. Nicholson, L. B., J. M. Greer, R. A. Sobel, M. B. Lees, V. K. Kuchroo. 1995. An altered peptide ligand mediates immune deviation and prevents autoimmune encephalomyelitis. Immunity 3:397.[Medline]
  4. Aharoni, R., D. Teitelbaum, M. Sela, R. Arnon. 1997. Copolymer 1 induces T cells of the T helper type 2 that crossreact with myelin basic protein and suppress experimental autoimmune encephalomyelitis. Proc. Natl. Acad. Sci. USA 94:10821.[Abstract/Free Full Text]
  5. Garren, H., P. J. Ruiz, T. A. Watkins, P. Fontoura, L. T. Nguyen, E. R. Estline, D. L. Hirschberg, L. Steinman. 2001. Combination of gene delivery and DNA vaccination to protection from and reverse Th1 autoimmune disease via deviation to the Th2 pathway. Immunity 15:15.[Medline]
  6. Pal, E., T. Tabira, T. Kawano, M. Taniguchi, S. Miyake, T. Yamamura. 2001. Costimulation-dependent modulation of experimental autoimmune encephalomyelitis by ligand stimulation of V{alpha}14 NK T cells. J. Immunol. 166:662.[Abstract/Free Full Text]
  7. Miyamoto, K., S. Miyake, T. Yamamura. 2001. A synthetic glycolipid prevents autoimmune encephalomyelitis by inducing TH2 bias of natural killer T cells. Nature 413:531.[Medline]
  8. Straub, R. H., J. Westermann, J. Schölmerich, W. Falk. 1998. Dialogue between the CNS and the immune system in lymphoid organs. Immunol. Today 19:40.
  9. Elenkov, I. J., R. L. Wilder, G. P. Chrousos, E. S. Vizi. 2000. The sympathetic nerve: an integrative interface between two supersystems—the brain and the immune system. Pharmacol. Rev. 52:595.[Abstract/Free Full Text]
  10. Downing, J. E., J. A. Miyan. 2000. Neural immunoregulation: emerging roles for nerves in immune homeostasis and disease. Immunol. Today 21:281.[Medline]
  11. Chelmicka-Schorr, E., M. Checincski, B. G. M. Arnason. 1988. Chemical sympathectomy augments the severity of experimental allergic encephalomyelitis. J. Neuroimmunol. 17:347.[Medline]
  12. Chelmicka-Schorr, E., M. N. Kwasniewski, R. L. Wollmann. 1992. Sympathectomy augments adoptively transferred experimental allergic encephalomyelitis. J. Neuroimmunol. 37:99.[Medline]
  13. Chelmicka-Schorr, E., M. N. Kwasniewski, B. E. Thomas, B. G. Arnason. 1989. The {beta}-adrenergic agonist isoproterenol suppresses experimental allergic encephalomyelitis in Lewis rats. J. Neuroimmunol. 25:203.[Medline]
  14. Panina-Bordignon, P., D. Mazzeo, P. D. Lucia, D. D’Ambrosio, R. Lang, L. Fabbri, C. Self, F. Sinigaglia. 1997. {beta}2-Agonists prevent Th1 development by selective inhibition of interleukin 12. J. Clin. Invest. 100:1513.[Medline]
  15. Kohm, A. P., V. M. Sanders. 2001. Norepinephrine and {beta}2-adrenergic receptor stimulation regulate CD4+ T and B lymphocyte function in vitro and in vivo. Pharmacol. Rev. 53:487.[Abstract/Free Full Text]
  16. Felten, D. L., S. Y. Felten, S. L. Carlson, J. A. Olshowka, S. Livnat. 1985. Noradrenergic and peptidergic innervation of lymphoid tissue. J. Immunol. 135:755s.
  17. Lundberg, J. M., A. Rudehill, A. Sollevi, G. Fried, G. Wallin. 1989. Co-release of neuropeptide Y and noradrenaline from pig spleen in vivo: importance of subcellular storage, nerve impluse frequency and pattern, feedback regulation and resupply by axonal transport. Neuroscience 28:475.[Medline]
  18. Michel, M. C., A. Beck-Sickinger, H. Cox, H. N. Doods, H. Herzog, D. Larhammar, R. Quirion, T. Schwartz, T. Westfall. 1998. XVI International Union of Pharmacology recommendations for the nomenclature of neuropeptide Y, peptide YY, and pancreatic polypeptide receptors. Pharmacol. Rev. 50:143.[Abstract/Free Full Text]
  19. Bedoui, S., N. Kawamura, R. H. Straub, R. Pabst, T. Yamamura, S. von Hörsten. 2003. Relevance of neuropeptide Y for the neuroimmune crosstalk. J. Neuroimmunol. 134:1.[Medline]
  20. Petitto, J. M., Z. Huang, D. B. McCarthy. 1994. Molecular cloning of NPY-Y1 receptor cDNA from rat splenic lymphocytes: evidence of low levels of mRNA expression and [125I]-NPY binding sites. J. Neuroimmunol. 54:81.[Medline]
  21. Bedoui, S., S. Lechner, T. Gebhardt, H. Nave, A. Beck-Sickinger, R. H. Straub, R. Pabst, S. von Hörsten. 2002. NPY modulates epinephrine-induced leukocytosis via Y-1 and Y-5 receptor activation in vivo: sympathetic co-transmission during leukocyte mobilization. J. Neuroimmunol. 132:25.[Medline]
  22. Kawamura, N., H. Tamura, S. Obana, M. Wenner, T. Ishikawa, A. Nakata, H. Yamamoto. 1998. Differential effects of neuropeptides on cytokine production by mouse helper T cell subsets. Neuroimmunomodulation 5:9.[Medline]
  23. Levite, M.. 1998. Neuropeptides, by direct interaction with T cells, induce cytokine secretion and break the commitment to a distinct T helper phenotype. Proc. Natl. Acad. Sci. USA 95:12544.[Abstract/Free Full Text]
  24. Söll, R. M., M. C. Dinger, I. Lundell, D. Larhammer, A. G. Beck-Sickinger. 2001. Novel analogues of neuropeptide Y with a preference for the Y1-receptor. Eur. J. Biochem. 268:2828.[Medline]
  25. Cabrele, C., M. Langer, R. Bader, H. A. Wieland, H. N. Doods, O. Zerbe, A. G. Beck-Sickinger. 2000. The first selective agonist for the neuropeptide YY5 receptor increases food intake in rats. J. Biol. Chem. 275:36043.[Abstract/Free Full Text]
  26. Mullins, D., D. Kirby, J. Hwa, M. Guzzi, J. Rivier, E. Parker. 2001. Identification of potent and selective neuropeptide Y Y1 receptor agonists with orexigenic activity in vivo. Mol. Pharmacol. 60:534.[Abstract/Free Full Text]
  27. Wieland, H. A., W. Engel, W. Eberlein, K. Rudolf, H. N. Doods. 1998. Subtype selectivity of the novel nonpeptide neuropeptide Y Y1 receptor antagonist BIBO 3304 and its effect on feeding in rodents. Br. J. Pharmacol. 125:549.[Medline]
  28. Avni, O., D. Lee, F. Macian, S. J. Szabo, L. H. Glimcher, A. Rao. 2002. Th cell differentiation is accompanied by dynamic changes in histone acetylation of cytokine genes. Nat. Immunol. 3:643.[Medline]
  29. Bedoui, S., S. Kuhlmann, H. Nave, J. Drube, R. Pabst, S. von Hörsten. 2001. Differential effects of neuropeptide Y (NPY) on leukocyte subsets in the blood: mobilization of B-1-like B-lymphocytes and activated monocytes. J. Neuroimmunol. 117:125.[Medline]
  30. Levite, M., L. Cahalon, R. Hershkoviz, L. Steinman, O. Lider. 1998. Neuropeptides, via specific receptors, regulate T cell adhesion to fibronectin. J. Immunol. 160:993.[Abstract/Free Full Text]
  31. Fleischer, B.. 1994. CD26: a surface protease involved in T-cell activation. Immunol. Today 15:180.[Medline]
  32. Mentlein, R.. 1999. Dipeptidyl-peptidase IV (CD26): role in the inactivation of regulatory peptides. Regul. Pept. 85:9.[Medline]
  33. Gorell, M. D., V. Gysbers, G. W. McCaughan. 2001. CD26: a multifunctional integral membrane and secreted protein of activated lymphocytes. Scand. J. Immunol. 54:249.[Medline]
  34. Maeda, K., M. Yasuda, H. Kaneda, S. Maeda, A. Yamadori. 1994. Cerebrospinal fluid (CSF) neuropeptide Y- and somatostatin-like immunoreactivities in man. Neuropeptides 27:323.[Medline]
  35. Gallai, V., P. Sarchielli, C. Firenze, A. Trequattrini, M. Paciaroni, F. Usai, M. Franceschini, R. Palumbo. 1994. Neuropeptide Y plasma levels and serum dopamine-beta-hydroxylase activity in MS patients with and without abnormal cardiovascular reflexes. Acta Neurol. Belg. 94:44.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. Holler, A. Zakrzewicz, A. Kaufmann, J. Wilhelm, G. Fuchs-Moll, H. Dietrich, W. Padberg, J. Kuncova, W. Kummer, and V. Grau
Neuropeptide Y Is Expressed by Rat Mononuclear Blood Leukocytes and Strongly Down-Regulated during Inflammation
J. Immunol., November 15, 2008; 181(10): 6906 - 6912.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. J. Mattapallil, A. Augello, C. Cheadle, D. Teichberg, K. G. Becker, C.-C. Chan, J. J. Mattapallil, G. Pennesi, and R. R. Caspi
Differentially Expressed Genes in MHC-Compatible Rat Strains That Are Susceptible or Resistant to Experimental Autoimmune Uveitis
Invest. Ophthalmol. Vis. Sci., May 1, 2008; 49(5): 1957 - 1970.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
N. M. Reddy, S. R. Kleeberger, M. Yamamoto, T. W. Kensler, C. Scollick, S. Biswal, and S. P. Reddy
Genetic dissection of the Nrf2-dependent redox signaling-regulated transcriptional programs of cell proliferation and cytoprotection
Physiol Genomics, December 19, 2007; 32(1): 74 - 81.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. Hansen, K. Loser, A. M. Westendorf, D. Bruder, S. Pfoertner, C. Siewert, J. Huehn, S. Beissert, and J. Buer
G Protein-Coupled Receptor 83 Overexpression in Naive CD4+CD25- T Cells Leads to the Induction of Foxp3+ Regulatory T Cells In Vivo
J. Immunol., July 1, 2006; 177(1): 209 - 215.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. Wheway, C. R. Mackay, R. A. Newton, A. Sainsbury, D. Boey, H. Herzog, and F. Mackay
A fundamental bimodal role for neuropeptide Y1 receptor in the immune system
J. Exp. Med., December 5, 2005; 202(11): 1527 - 1538.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Matarese, P. B. Carrieri, A. La Cava, F. Perna, V. Sanna, V. De Rosa, D. Aufiero, S. Fontana, and S. Zappacosta
Leptin increase in multiple sclerosis associates with reduced number of CD4+CD25+ regulatory T cells
PNAS, April 5, 2005; 102(14): 5150 - 5155.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bedoui, S.
Right arrow Articles by Yamamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bedoui, S.
Right arrow Articles by Yamamura, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS