|
|
||||||||


* Department of Immunology, National Institute of Neuroscience, NCNP, Ogawahigashi, Kodaira, Tokyo, Japan;
Department of Biochemistry, University of Leipzig, Leipzig, Germany; and
Department of Functional and Applied Anatomy, Hannover Medical School, Hannover, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
and TNF-
in response to the peptide of the CNS components. In support of this consensus, a number of studies have proven that polarizing autoimmune Th1 cells toward Th2 directions (3, 4, 5, 6, 7) leads to suppression of the clinical and pathological manifestations of EAE. These findings indicate that human Th1-mediated diseases such as MS could also be treated or prevented with the Th2-inducing protocols effective in suppression of EAE. Thus, molecular mechanisms controlling the Th1/Th2 balance needs to be further elucidated in terms of the regulation of autoimmunity.
It is now well established that the immune system and the nervous system are connected bidirectionally (8, 9, 10). Although much remains to be investigated, several lines of evidence suggest that the sympathetic nervous system (SNS) provides a major pathway for neuroimmune interactions. Indeed, a role for catecholamines such as norepinephrine and epinephrine in SNS-mediated immunoregulation has been implicated in various conditions (11, 12, 13, 14, 15). Regarding the modulation of autoimmunity, it was previously demonstrated that depletion of SNS transmitters by chemical sympathectomy enhances the severity of EAE (11, 12). Because
-adrenoceptor agonists protect against EAE (13) and catecholamines modulate several immunological functions critical to the pathogenesis of EAE (14), the enhancement of EAE by chemical sympathectomy has largely been attributed to the depletion of catecholamines. However, although neuropeptide Y (NPY) is also released from SNS terminals innervating lymphatic tissues (16, 17), no previous studies have explored the possibility that depletion of other SNS transmitters such as NPY may contribute to these findings.
NPY is a 36-aa peptide. This amidated peptide is abundant in neurons and can be detected in all parts of the body. NPY regulates a variety of physiological activities, including energy balance and feeding, anxiety, neuroendocrine secretion, neuronal excitability, and vasoconstriction (18, 19). NPY exerts its pleiotropic functions through the activation of several G-protein coupled NPY receptor subtypes (18). Accumulating evidence indicates that NPY receptor subtypes mediate the differential actions of NPY (18) and that they are differentially expressed in the mammalian tissues. Whereas expression of Y2 and Y5 receptor is highly restricted to the CNS, Y4 receptors are selectively expressed in the periphery. In contrast, Y1 receptors are rather ubiquitously expressed; their presence has been reported in brain, heart, kidney, gastrointestinal tract, endothelial cells, and leukocytes (18, 19).
Of note, NPY can be found in the storage vesicles of the sympathetic nerve terminals innervating lymph nodes, spleens, and the bone marrow of various species (19). Furthermore, Y1 receptors were demonstrated on rat PBMC (20, 21). These results suggested a role for NPY in neuroimmune interactions. In support of this hypothesis, two independent studies previously showed that NPY significantly modifies the cytokine profile of T helper clone cells in vitro (22, 23). Namely, Levite (23) reported NPY converts the cytokine profile of Th1 clones to a Th0 type in vitro, whereas Kawamura et al. (22) showed that NPY inhibits the IFN-
production by Th1 clones as well as that of freshly isolated spleen T cells. However, despite the potential of NPY to induce a Th2 shift in vitro, it remains unclear whether NPY may alter the cytokine profile of Th1 cells in vivo. This prompted us to investigate a possible role of NPY in the regulation of EAE mediated by Th1 cells.
To explore the role of NPY in vivo, we immunized female C57BL/6 (B6) mice with MOG3555 and treated them with NPY and/or NPY receptor subtype-selective compounds every other day. Here we report that exogenous NPY significantly suppresses the clinical course of EAE and that this effect is mediated through the activation of Y1 receptors expressed by T cells. Our experiments have revealed that suppression of IFN-
production by MOG3555-specific Th1 cells and the concomitant Th2 bias account for the suppression of EAE.
| Materials and Methods |
|---|
|
|
|---|
Female B6 mice were purchased from CLEA Laboratory Animals (Tokyo, Japan), and female SJL/J mice were purchased from Charles River Japan (Tokyo, Japan). The animals were kept under specific pathogen-free conditions and were subjected to experiments at 610 wk of age. Rat MOG3555 (amino acid sequence, MEVGWYRSPFSRVVHLYRNGK) was synthesized at Chiron Technologies (Clayton, Victoria, Australia), and proteolipid protein (PLP) 139151 (amino acid sequence, HCLGKWLGHPDKF) at Toray Research Center (Tokyo, Japan). IFA and heat-killed Mycobacterium tuberculosis H37Ra were obtained from Difco (Detroit, MI), and pertussis toxin was obtained from List Biological Laboratories (Campbell, CA). NPY was purchased from Sigma-Aldrich (St. Louis, MO). A Y1 receptor agonist, [F7,P34]NPY, and a Y5 receptor agonist, [Ala31,Aib32]NPY, were generated as previously described (24, 25). Another Y1 receptor agonist, [D-His26]NPY (26), was a gift from Schering (Kenilworth, NJ). Receptor specificity of these compounds was achieved by replacing certain amino acids at specific positions that are critical for the structural interaction of native NPY with different NPY receptor subtypes (for details see Table I). The Y1 receptor antagonist BIBO3304, a small nonpeptide compound (27), was kindly provided by Boehringer Ingelheim (Biberach, Germany).
|
Active EAE was induced in B6 mice as described previously (6, 7). Briefly, the mice were challenged in the tail base with an emulsion containing 100 µg of MOG3555 and 500 µg of M. tuberculosis in IFA. Directly after the immunization and 48 h later, the mice were injected i.p. with 500 ng of pertussis toxin. SJL/J mice were immunized s.c. with an emulsion containing 100 µg of PLP139151 and 1000 µg of M. tuberculosis in IFA. They were injected with 200 ng of pertussis toxin shortly after immunization.
Clinical assessment
Mice were observed daily for clinical signs of EAE. Disease severity was scored and evaluated as follows: 0 = normal; 1 = weakness of the tail and/or paralysis of the distal half of the tail; 2 = loss of tail tonicity; 3 = partial hind limb paralysis; 4 = complete hind limb paralysis; 5 = forelimb paralysis or moribund; 6 = death. Cumulative scores were calculated for an individual mouse by summing up the daily scores.
Application of NPY and NPY receptor subtype-specific compounds
NPY and the receptor subtype-specific compounds were diluted in PBS. The animals were injected every second day with NPY and/or these compounds throughout the experiment, unless otherwise stated. Control mice were injected with 200 µl of PBS on alternate days. To treat mice with a combination of NPY and the Y1 receptor antagonist BIBO3304 on alternate days, we injected NPY and the antagonist on the same day (NPY injection followed by BIBO3304) and gave two injections of PBS to control mice.
Measurement of MOG3555-specific IgG1 and IgG2a titers
ELISA plates were coated with 10 µg/ml MOG3555 in PBS overnight at 4°C. After blocking with 3% BSA in PBS, serial dilutions of the serum from animals at day 40 after immunization, or normal mice or PBS were added to the plates. MOG3555-specific Abs were detected, using biotin-labeled anti-IgG1 and anti-IgG2a Abs. After adding streptavidin-peroxidase and a substrate, Ab concentrations were estimated on the basis of dilutions/OD curves.
MOG3555-specific T cell proliferation assay
After immunization with MOG3555, the animals were treated every second day with the indicated compounds from day 0 to day 10 after immunization. The mice were sacrificed at day 10 and inguinal and popliteal lymph nodes (LN) were removed. Total LN cells were suspended in RPMI 1640 supplemented with 5 x 10-5 M 2-ME, 2 mM L-glutamine, 100 U/100 mg/ml penicillin/streptomycin, and 1% syngeneic mouse serum (standard medium). We incubated the cells in 96-well round-bottom plates at 1 x 106/well for 72 h (37°C, 5% CO2 atmosphere) in the presence of MOG3555 (1, 10, or 100 µg/ml). Incorporation of [3H]thymidine (1 µCi/well) for the final 16 h of the culture was determined with a
-1205 counter (Pharmacia, Uppsala, Sweden).
To determine whether the suppressive effects of a Y1 receptor agonist, [D-His26]NPY, are due to its interaction with T cells or with APC, T cells were isolated from the LN using a standard nylon wool column procedure. The LN cells were obtained from MOG3555-primed mice treated with [D-His26]NPY or PBS. They were applied to the nylon wool column and incubated for 1 h at 37°C (5% CO2 atmosphere), and the T cells were harvested from the column by gently rinsing with RPMI 1640 containing 5% FCS. The LN cells that had been x-irradiated with 4000 rad were used as APC. T cells (5 x 105/well) and APC (5 x 105/well) were than cocultured in 96-well round-bottom plates in the presence or absence of MOG3555. Cytokine assay was conducted as described below for the supernatants harvested at 48 h. Cell proliferation was determined by measuring the incorporation of [3H]thymidine (1 µCi/well) in the final 16 h of 72-h cultures.
Cytokine assay
To evaluate the effect of Y1 receptor stimulation on the cytokine secretion, LN cells from the MOG3555-immunized, NPY-treated mice were suspended in the standard medium and cultured in 96-well round-bottom plates at 1 x 106/well for 48 h in the presence of MOG3555. The concentrations of IFN-
and IL-4 in the supernatants were determined by using a sandwich ELISA. The assays were performed according to the protocol provided by BD PharMingen (San Diego, CA). All the reagents, including recombinant mouse cytokines and Abs, were purchased from BD PharMingen.
Anti-CD3 stimulation of splenocytes derived from naive mice
For the stimulation of the Ag receptor complex of T cells, 96-well round-bottom plates were coated with 1 µg/ml anti-CD3 mAb (clone 2C11) (BD PharMingen) overnight. After three washings with PBS, splenocytes (1 x 106/well) from untreated, naive animals were added and incubated in the standard medium for 48 h in the presence of various concentrations of [D-His26]NPY. IFN-
levels in the supernatants were detected with the sandwich ELISA.
Induction of passive EAE in SJL/J mice
At day 10 after immunization with PLP139151, the total spleen and draining LN cells were prepared from the mice and stimulated with the PLP peptide (30 µg/ml) in the standard medium. The cells were harvested 96 h after culture, and 1.6 x 107 of the cells were injected i.p. into each recipient that had been x-irradiated (300 rad) shortly before cell transfer. The recipient mice were further treated with pertussis toxin on the day of cell transfer and 2 days later (200 ng for each i.p. injection).
In vitro T helper cell differentiation
Spleen T helper cells were polarized for either Th1 or Th2 direction according to the protocol described by others (28). In brief, CD4+CD44low naive T cells were purified from the spleen of young B6 mice by using the magnetic beads (Dynal, Oslo, Norway), and the cells were stimulated with anti-CD3 (2 µg/ml) and anti-CD28 (1 µg/ml) under Th1- or Th2-inducing conditions. Namely, Th1 cells were induced in the presence of mouse IL-12 (5 ng/ml) and anti-IL-4 mAb (HB188; 10 µg/ml), whereas Th2 cells were induced in the presence of mouse IL-4 (1000 U/ml), anti-IFN-
(HB170; 5 µg/ml), and anti-IL-12 (3 µg/ml). Three days later, the cells were fed with the fresh medium supplemented with 100 U/ml IL-2 in addition to the cytokines and Abs used in the primary stimulation. Eight days later, the cells were harvested and subjected to RNA preparation.
RT-PCR and real time PCR
RT-PCR was used to determine the transcription level of NPY Y1 receptor in the LN cells from MOG3555-sensitized animals or in the nylon wool-purified spleen T cells from naive mice. Homogenized brain tissues from naive mice served as controls. Total RNA was extracted from these samples using RNABee (Tel-Test, Friendswood, TX). RNA (5 µg) was subjected to reverse transcription with the SuperScript First-Strand Synthesis System (Invitrogen, Carlsbad, CA), and 35 cycles of PCR were conducted using TaqDNA polymerase and GeneAmp PCR system 9700 (Perkin-Elmer, Applied Biosystems, MA). Each cycle of PCR amplification comprised denaturation (95°C for 5 min), annealing (54°C for 30 s), and amplification (72°C for 60 s). The products of these reactions were analyzed by 2% gel electrophoresis. Primers used were as follows: Y1 receptor sense, CTTCGGGGAGACCATGTGCAAACTGAATC; Y1 receptor antisense, AGGAGAGTCGTGTAAGACAG; GAPDH sense, AACGACCCCTTCATTGAC; GAPDH antisense, TTCACGACATACTCAGCAC. Real time PCR was conducted by using the Light Cycler quantitative PCR system (Roche Molecular Biochemicals, Mannheim, Germany). We used a commercial kit (Light Cycler-FastStart DNA Master SYBR Green I; Roche Molecular Biochemicals) according to the manufacturers instructions.
Statistical analysis
We used the Mann-Whitney test to analyze the differences in the clinical score of treatment vs control group. Data for cytokines and proliferative responses were subjected to overall two-way ANOVA. When there was a significant difference, a Fisher post hoc test was implemented. The statistical analysis was performed using SPSS for Windows.
| Results |
|---|
|
|
|---|
To investigate a possible effect of NPY on actively induced EAE, we immunized female B6 mice with MOG3555 to actively induce EAE. The mice were injected with 0.0150 µg/kg NPY i.p. on alternate days from the day of immunization (day 0) until the termination of the experiments. The selection of NPY dosages is based on previous studies (29). We found that the continuous, alternate day treatment with NPY inhibits the clinical severity of EAE in a dose-dependent manner (Fig. 1). The maximum disease score was significantly inhibited when the mice were treated with 50 µg/kg (but not 0.01 or 1.0 µg/kg) of NPY (Fig. 1A and Table II). However, the cumulative disease score was effectively suppressed at both 1 and 50 µg/kg (Fig. 1B).
|
|
Given that differential actions of NPY are mediated through distinct receptor subtypes (18, 19), we sought to elucidate which NPY receptor subtypes are involved in the EAE-inhibitory action of NPY. To this aim, we used various NPY receptor subtype-specific compounds. Lymphoid cell expression of Y1 receptor has been recently reported (20, 21). In a first step, we treated MOG3555-immunized mice with a combination of the amount of NPY found to consistently inhibit EAE (50 µg/kg) and 100 µg/kg of the Y1 receptor antagonist BIBO3304. Interestingly, blocking Y1 receptors with BIBO3304 abrogated the suppressive effect of NPY on EAE (Fig. 2A). This indicates that NPY probably inhibits clinical signs of EAE via Y1 receptors. To further clarify this point, we treated the mice with a novel Y1 receptor agonist, [D-His26]NPY (Table I). Preliminary experiments showed that this compound is very potent and that a smaller dose (0.1 µg/kg to 0.01 µg/kg) than that for NPY effectively suppresses EAE. Due to a limited amount of the compound available, we treated the mice with 0.01 µg/kg of [D-His26]NPY on alternate days until the end of the experiment. As shown in Fig. 2B and Table II, this Y1 receptor agonist significantly down-regulated the clinical course of EAE, further supporting the role of Y1 receptor in the NPY-mediated suppression of EAE. We also examined the effect of another Y1 receptor agonist, [F7,P34]NPY, on EAE at 0.01, 0.1, and 1 µg/kg. Unlike [D-His26]NPY, [F7, P34]NPY was not effective at 0.01 or 0.1 µg/kg. However, treatment with 1 µg/kg [F7,P34]NPY every other day significantly ameliorated clinical signs of EAE (Table II). In contrast, treatment with a selective Y5 receptor agonist, [Ala31,Aib32]NPY, did not show any effect on the clinical course of EAE (Table II). Taken together, these experiments strongly indicate that exogenous NPY suppresses the clinical signs of EAE through the activation of Y1 receptors.
|
Y1 receptor agonist inhibits induction phase of EAE
We attempted to treat the mice with the Y1 receptor agonist [D-His26]NPY after appearance of the first clinical signs of EAE. However, the treatment protocols starting after onset of clinical manifestations did not significantly alter the clinical course of EAE (data not shown), indicating that Y1 receptor stimulation could not modify the effector phase of EAE. In contrast, alternate day administration of the D-His26 compound during the induction phase of EAE (from day 0 to 10) after sensitization significantly inhibited the development of EAE (Fig. 3). In fact, the induction phase treatment (days 010) was as efficient as the long term treatment (days 034) covering both induction and effector phases. This result implies that Y1 receptor stimulation leads to the inhibition of induction, but not effector phase of EAE.
|
NPY has been demonstrated to alter the cytokine profile of in vitro established Th1 clones toward Th2 directions (22, 23). We therefore speculated that the inhibitory action of NPY on EAE might be due to a modulation of the Th1/Th2 balance resulting from a Th2 bias of MOG3555-reactive T cells. To explore this possibility, we first measured serum levels of IgG1 and IgG2a isotypes of anti-MOG3555 Abs at day 40 after immunization. It is generally accepted that elevation of Ag-specific IgG2a Ab results from the augmentation of a Th1 immune response to the Ag, whereas a higher level of IgG1 Ab reflects a stronger Th2 response to the Ag. Fig. 4A demonstrates that the treatment with NPY and the Y1 receptor agonists remarkably inhibits anti-MOG3555 IgG2a titers, but they do not significantly alter IgG1 titers. Consequently, the IgG1-IgG2a ratio was significantly elevated in mice treated with either NPY or the Y1 receptor agonists, indicating that the suppression of EAE after NPY treatment is associated with a Th2 bias of MOG3555-reactive autoimmune T cells (Fig. 4B).
|
by MOG3555-specific T cells
To further characterize the immunomodulatory properties of NPY in vivo, we isolated the draining LN cells at day 10 from mice treated with [D-His26]NPY and from control mice treated with PBS and stimulated the lymphoid cells with MOG3555 in vitro. We compared these two groups with respect to the levels of IFN-
and IL-4 in the culture supernatant and cell-proliferative responses. We found that in vivo treatment with the Y1 receptor agonist significantly inhibited the production of IFN-
on in vitro stimulation with MOG3555 (Fig. 5A). [D-His26]NPY seemed to slightly inhibit the proliferation of MOG3555-specific T cells as well (Fig. 5B), but it was not statistically significant. IL-4 concentrations were below the detection level. These results indicate that the inhibition of IFN-
production by MOG3555-specific T cells may underlie the Th2 deviation (a higher IgG1-IgG2a ratio) provoked by the Y1 receptor agonist.
|
To obtain insights into the altered Th1/Th2 balance through the activation of Y1 receptors, we explored whether T cells or APCs are the major target of NPY. To address this question, we separated T cells from animals treated in vivo with either [D-His26]NPY (treated) or PBS (untreated). The T cells were mixed with irradiated LN cells from treated or untreated mice, serving as APC, and then stimulated with 100 µg/ml MOG3555 in vitro. Despite whether T cells from untreated mice (untreated T cells) were reconstituted with treated or untreated APC, they responded equally well to MOG3555 with regard to the production of IFN-
(Fig. 6A, Columns 3 and 4). However, when T cells from treated mice (treated T cells) were used for reconstitution (Fig. 6A, Columns 1 and 2), IFN-
production was remarkably reduced regardless of the source of the APC (two ANOVA, p = 0.001). However, cell proliferation responses were not significantly different among the reconstituted populations (Fig. 6B). These results demonstrate that the in vivo effect of [D-His26]NPY is mediated by the selective alteration of the T cell function to secrete IFN-
but not of APC.
|
The in vivo results presented above strongly suggest that NPY acts on EAE via direct activation of Y1 receptors expressed on the MOG3555-specific autoimmune T cells. To verify this further, we examined whether mouse T cells express the Y1 receptor. As shown in Fig. 7, RT-PCR enabled us to detect the expression of Y1 receptor mRNA in MOG3555-sensitized LN cells (Fig. 7A) and in spleen T cells isolated from naive mice (Fig. 7B). We also examined expression levels of the Y1 receptor in T cells polarized in vitro toward Th1 or Th2, according to the described method (28). We saw no significant difference between Th1 and Th2 cells regarding the Y1 receptor expression.
|
in the supernatant. The results indicate that the Y1 receptor agonist significantly inhibits the secretion of IFN-
on stimulation with anti-CD3 Ab in a dose-dependent manner (Fig. 8). These data further support that the Th2 bias found in vivo is mediated through the activation of functional Y1 receptors expressed on autoimmune T cells.
|
Furthermore, we asked whether the Y1 receptor agonist might also modulate acute EAE actively induced with PLP139151 in SJL/J mice. We found that the continuous treatment from day 0 to day 30 significantly suppressed clinical EAE, regarding the maximum clinical score: D-His26-treated mice, 1.8 ± 0.52 vs PBS-treated mice, 3.2 ± 0.37 (p < 0.02). Administration of D-His26 during the induction phase (from day 0 to day 10) also reduced the clinical severity of EAE as compared with treatment with PBS. It was interesting to know whether the treatment during the induction phase may inhibit the generation of encephalitogenic T cells reactive to PLP139151. To answer this question, we isolated PLP139151-sensitized lymphoid cells from D-His26- or PBS-treated mice at day 10 after immunization and stimulated the cells in vitro with PLP139151. The activated T cells were adoptively transferred to naive SJL/J mice to induce passive EAE as described in Materials and Methods. Our protocol induced very serious EAE in the recipients (n = 5 for each group), and all the recipient mice died before day 18 after cell transfer. However, there was a clear tendency that mice transferred with T cell blasts from D-His26-treated mice would survive for a longer period of time (the date of death in an individual mouse: day 14, day 17, day 17, day 17, day 17) compared with those given the T cell blasts from PBS-treated mice (the date of death: day 8, day 11, day 14, day 15, day 15). In addition, the mice transferred with the T cells from [D-His26-treated mice showed a reduced clinical score at day 8 compared with the control mice (1.5 ± 0.5 vs 4.5 ± 0.6). These results indicate that NPY Y1 agonist is effective also for EAE induced in SJL/J mice and that the mechanism of action is to interfere with the process of effector lymphocyte generation.
| Discussion |
|---|
|
|
|---|
The action of NPY is mediated via distinct receptor subtypes such as the Y1, Y2, Y4, and Y5 receptor. Here we conclude that Y1 receptors are the main receptor subtypes engaged in the NPY-mediated suppression of EAE. This conclusion was obtained from a series of experiments applying Y1 receptor agonists and a Y1 receptor antagonist. Firstly, we showed that the suppressive effect of NPY on EAE was abolished when we coinjected the Y1 receptor antagonist BIBO3304. Secondly, we replaced native NPY with two types of compounds known to selectively stimulate Y1 receptors ([D-His26]NPY, [F7,P34]NPY) and found that these NPY analogs also effectively suppress the development of EAE. However, a Y5 receptor agonist was not effective. Thirdly, treatment with BIBO3304 resulted in a significantly earlier onset of disease. All of these results indicate that Y1 receptor engagement leads to the suppression of EAE.
The Y1 receptor agonists appear to be much more potent EAE inhibitors than native NPY. In terms of the dosage requirement to gain clinical effects, the hierarchy for the native and altered NPY compounds was apparent ([D-His26]NPY > [F7,P34]NPY > native NPY). It seems that the efficacy of these ligands as EAE therapeutics correlates with the specificity for the Y1 receptors. Namely, [D-His26]NPY is more selective for Y1 receptors, compared with [F7,P34]NPY (24). Taking this into consideration, it is possible that stimulation of non-Y1 receptors may compete with Y1 receptor ligation. Alternatively, the Y1 receptor agonists may be more efficacious as ligands than native NPY in inducing intracellular events leading to the immunoregulation. Alternatively, these differences in the potency of Y1 receptor compounds and the native peptide NPY may be explained by parallel activation of stimulatory and inhibitory Y receptors by NPY itself rather than by the specific ligands. Furthermore, it is possible that the different Y1 receptor specific compounds exhibit a differential tissue penetration or may be differentially degraded by specific enzymes such as CD26 (31, 32). Further studies are needed to verify these postulates and provide us with a new insight into NPY-Y1 receptor interactions.
The experiment using the Y1 receptor antagonist BIBO3304 showed an earlier onset of EAE, although the disease course was not altered after onset. This indicates that endogenous NPY plays a regulatory role in the induction phase, but not in the effector phase of EAE. Consistent with this, we showed that the treatment during the induction phase is as effective as the continuous treatment covering both induction and effector phases, whereas the treatment starting after onset of EAE does not change the clinical course of EAE. A possible explanation for the failure of the Y1 receptor antagonist to alter the effector phase is that endogenous NPY levels may substantially decrease in the effector phase, owing to enzymatic degradation. Whereas it is currently impossible to measure the NPY levels in mice with EAE, it is well known that NPY is cleaved by enzymes such as dipeptidyl peptidase IV (CD26), a membrane-bound enzyme, constitutively expressed on numerous cells including leukocytes (31, 32). In addition, activated T cells are reported to express a higher level of CD26 on their surface (33). Thus, it is possible that the contribution of endogenous NPY to the immunoregulation might be reduced in the effector phase because of the rapid degradation by enzymes such as CD26. It is necessary to pursue this issue with different methodologies.
Regarding the mechanism for NPY-mediated suppression of EAE, we showed a significant inhibition of anti-MOG3555 IgG2a titers and of IFN-
production by MOG3555-specific T cells after treatment with [D-His26]NPY. In contrast, IgG1 titers were unaffected, which resulted in a higher IgG1-IgG2a ratio in treated mice. Also, T cell-proliferative responses were not affected significantly. On the basis of these results, we conclude that NPY plays a selective role in inhibiting IFN-
production by MOG3555-specific T cells, leading to a Th2 bias. Ex vivo reconstitution experiments also showed that MOG3555-specific T cells are the major target for NPY. Although the presence of functional Y1 receptors on rat leukocytes has been documented (20, 21), we proved here the presence of mRNA encoding the Y1 receptor in T cell populations. Accompanying in vitro experiments further confirmed that NPY suppresses T cell production of IFN-
provoked by CD3 cross-linking.
In conclusion, this study demonstrates for the first time to our knowledge that NPY has an immunomodulatory activity that suppresses signs of EAE. Given that the levels of NPY in the CSF are reduced in patients with MS (34, 35), it is tempting to speculate that NPY may also play a critical role in preventing the development of MS. With the availability of novel and highly selective agonists and their ability to mimic the effects of NPY in a highly specific manner, we propose that targeting NPY receptors may be a promising new therapeutic approach to autoimmune disorders.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Takashi Yamamura, Department of Immunology, National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigashi, Kodaira, 187-8502 Tokyo, Japan. E-mail address: yamamura{at}ncnp.go.jp ![]()
3 Abbreviations used in this paper: EAE: experimental autoimmune encephalomyelitis; LN, lymph node; MOG, myelin oligodendrocyte glycoprotein; MS, multiple sclerosis; NPY, neuropeptide Y; PLP, proteolipid protein; SNS, sympathetic nervous system. ![]()
Received for publication January 22, 2003. Accepted for publication July 21, 2003.
| References |
|---|
|
|
|---|
14 NK T cells. J. Immunol. 166:662.
-adrenergic agonist isoproterenol suppresses experimental allergic encephalomyelitis in Lewis rats. J. Neuroimmunol. 25:203.[Medline]
2-Agonists prevent Th1 development by selective inhibition of interleukin 12. J. Clin. Invest. 100:1513.[Medline]
2-adrenergic receptor stimulation regulate CD4+ T and B lymphocyte function in vitro and in vivo. Pharmacol. Rev. 53:487.This article has been cited by other articles:
![]() |
M. J. Mattapallil, A. Augello, C. Cheadle, D. Teichberg, K. G. Becker, C.-C. Chan, J. J. Mattapallil, G. Pennesi, and R. R. Caspi Differentially Expressed Genes in MHC-Compatible Rat Strains That Are Susceptible or Resistant to Experimental Autoimmune Uveitis Invest. Ophthalmol. Vis. Sci., May 1, 2008; 49(5): 1957 - 1970. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Reddy, S. R. Kleeberger, M. Yamamoto, T. W. Kensler, C. Scollick, S. Biswal, and S. P. Reddy Genetic dissection of the Nrf2-dependent redox signaling-regulated transcriptional programs of cell proliferation and cytoprotection Physiol Genomics, December 19, 2007; 32(1): 74 - 81. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Hansen, K. Loser, A. M. Westendorf, D. Bruder, S. Pfoertner, C. Siewert, J. Huehn, S. Beissert, and J. Buer G Protein-Coupled Receptor 83 Overexpression in Naive CD4+CD25- T Cells Leads to the Induction of Foxp3+ Regulatory T Cells In Vivo J. Immunol., July 1, 2006; 177(1): 209 - 215. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wheway, C. R. Mackay, R. A. Newton, A. Sainsbury, D. Boey, H. Herzog, and F. Mackay A fundamental bimodal role for neuropeptide Y1 receptor in the immune system J. Exp. Med., December 5, 2005; 202(11): 1527 - 1538. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Matarese, P. B. Carrieri, A. La Cava, F. Perna, V. Sanna, V. De Rosa, D. Aufiero, S. Fontana, and S. Zappacosta Leptin increase in multiple sclerosis associates with reduced number of CD4+CD25+ regulatory T cells PNAS, April 5, 2005; 102(14): 5150 - 5155. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |