|
|
||||||||
CUTTING EDGE |
Neurocrine Biosciences, Inc., San Diego, CA 92121
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
A major obstacle in identifying the IDDM-promoting genes within these non-MHC-linked Idd loci has been the lack of adequate disease-associated phenotypes with sufficient penetrance for tracking in recombinant congenic gene mapping studies (2). Most attempts have been made using complex traits such as disease incidence or cellular processes such as insulitis that likely require epistatic interactions among several Idd loci. However, we have identified and characterized a genetically-programmed, cell type-specific phenotype unique to the NOD strain that exists in the absence of the disease process (i.e., it is expressed in young male and female NOD mice well before disease symptoms (4, 5)), and thus is expected to show sufficient penetrance in recombinant congenic gene mapping studies. This defect is a 4- to 25-fold elevation in production of the IL-12p40 cytokine subunit (but not of other cytokines) by activated macrophages (M
) from the NOD strain compared with at least eight other non-diabetic control strains (4, 5, 6). This finding has recently been confirmed in dendritic cells by Tisch and coworkers (7), indicating that the defect is expressed by two key APCs of the innate immune system. The IL-12p40 subunit complexes with either the p35 or the p19 subunits to form the functionally active IL-12p70 (8) or IL-23 (9) cytokines, respectively, that are required for development of Th1 responses and play a central role in the autoimmune process. Furthermore, elevated IL-12p40 production has also been associated with individuals at high-risk for type 1 diabetes (10) in which unique sequence polymorphisms near the IL-12p40 coding sequence have been identified in a large cohort of type 1 diabetic families (11).
Here, we determined whether a single Idd locus could be responsible for the IL-12p40 expression defect in NOD M
by screening several different recombinant congenic mouse strains carrying Idd loci on either C57BL/6 or CBA backgrounds. Our results show that the Idd4 locus is responsible for the elevated expression of the IL-12p40 gene in NOD mice.
| Materials and Methods |
|---|
|
|
|---|
Four- to 6-wk-old male mice of the following strains were purchased from The Jackson Laboratory (Bar Harbor, ME) and were maintained for 14 wk after arrival under germfree conditions: A/J, BALB/c, C57BL/6, C57BL/10, C3H/OUJ, CBA, and NOD. The following CBA-NOD recombinant congenic strains that have unique sets of Idd loci (12) were a gift from Dr. E. Leiter (The Jackson Laboratory): NOcCB-1 (Idd1, 2, 4, 5, 6, 7, 8, 13, 14, 15, 16), CBcNO6 (Idd1, 2, 6, 8, 9, 11, 13, 15, 16), CBcNO7-C (Idd1, 6, 7, 9, 15, 16), and CBcNO7-D (Idd1, 6, 7, 9, 10, 13, 15, 16, 17). Breeding pairs of the following C57BL/6 mice congenic for Idd loci were also a gift from Dr. E. Leiter and bred in-house: B6.NODc17 (B6.NODIdd1), D17MIT21-D17MIT10, 19 cM interval; B6.NODc11 (B6.NODIdd4), D11Mit20-D11Mit42, 52 cM interval; B6.NODc17/c11 (B6.NODIdd1/Idd4), D17Mit21-D17Mit10, 19 cM interval, D11Mit20-D11Mit42, 52 cM interval; B6.NODc17/c1c (B6.NODIdd1/Idd5), D17Mit21-D17Mit10, 19 cM interval, D1Mit3-BclII, 44 cM interval; B6.NODc17/c6 (B6.NODIdd1/Idd6), D17MIT21-D17MIT10, 19 cM interval, D6MIT54-D6MIT14, 24 cM interval; B6.NODc17/c3 (B6.NODIdd1/Idd3/Idd10), D17Mit21-D17Mit10, 19 cM interval, D3Mit132-Tshb, 43 cM interval; B6.NODc2 (B6.NODIdd13), D2Mit17-D2Mit48, 32 cM interval (13).
M
isolation, culturing, and cytokine production measurement
Thioglycollate-elicited peritoneal exudate M
were obtained by peritoneal lavage and isolated by adherence to plastic as previously described (4). Adherent M
(2 x 105) were stimulated with LPS (LPS; Escherichia coli: 0111:B4; Sigma-Aldrich, St. Louis, MO) in RPMI 1640 medium supplemented with 2 mM L-glutamine, 0.5% HEPES (Cellgro, Herndon, VA), 5 µg/ml penicillin and 100 U/ml streptomycin (Life Technologies, Grand Island, NY), and 10% FBS (BioWhittaker, Walkersville, MD). The culture-conditioned medium was collected at 24 h at which time M
were replenished with fresh stimuli and cultured for another 48 h before collection of conditioned medium (i.e., 2472 h). Culture-conditioned medium was stored at -20°C for assessment of cytokine levels using sandwich ELISA (BD PharMingen, San Diego, CA).
RNase protection assay
RNA was extracted from LPS-stimulated adherent M
(107) using a total RNA Isolation Kit (BD PharMingen) and quantified by UV spectrophotometry. Total RNA (5 µg) from each sample was used in an RNase protection assay (Riboquant mCK-2b; BD PharMingen) which was resolved using a 0.4 mm urea-polyacrylimide gel and visualized by autoradiography. Samples were quantified by densitometry using Image-Pro Plus software.
Sequencing IL-12p40 cDNA polymorphisms
Two T
C sequence polymorphisms exist in the cDNA sequence (accession number NM_008352) of the murine IL-12p40 allele at nucleotide positions 506 and 880 down-stream from the transcription start site and distinguish the C57BL/6 and CBA (i.e., T) from the NOD (i.e., C) sequences (14). These polymorphisms were determined in several congenic strains via RT-PCR amplification of total RNA from LPS-stimulated M
and sequencing of the PCR product using the following primers:_GACTTTCCTGAAGTGTGAAGCACC and GCTGACCTCCACCTGTGAGTTC which flank the polymorphism at 506 position, and GCAGCAGAATAAATATGAGAAC and CCTTTCCAACGTTGCATCCTAGG which flank the polymorphism at 880 position.
| Results and Discussion |
|---|
|
|
|---|
We previously reported the IL-12p40 overexpression defect in LPS-stimulated M
from young (pre-disease) NOD mice (4, 5). Here, we determined whether one of the known Idd loci harbored the defect by screening several congenic strains that contained Idd loci on a C57BL/6 background. We first confirmed and extended our previous studies (4, 5) by performing a comprehensive analysis of IL-12p40 levels produced by M
from the C57BL/6 background strain relative to other disease-resistant strains (i.e., BALB/c, A/J, C57BL/10, C3H/OuJ) and to the autoimmune-prone NOD strain. Peritoneal M
from young mice of all strains were activated with LPS, and conditioned medium was collected in two sequential intervals to quantitatively and qualitatively evaluate IL-12p40 production. Cytokine levels for each strain were normalized to those of C57BL/6 M
and the mean of these relative values from several experiments are reported (Fig. 1). LPS-stimulated M
from the NOD strain produced 4- to 12-fold greater levels of IL-12p40 than did M
from the five normal strains tested during the first 24 h of culture (Fig. 1A). This difference increased to 10- to 25-fold greater IL-12p40 levels in the NOD during the next 48 h of culture (i.e., 2472 h; Fig. 1B). Differences in M
cytokine production among all strains were not associated with a variation in viability or metabolic activity as measured by conversion of the redox reagent, Alamar Blue (data not shown). This dysregulation in cytokine expression appears specific to IL-12p40 because NOD M
levels of other cytokines are within the range of normal strains (4).
|
from B6.NODIdd congenic strains
LPS-stimulated M
from seven recombinant congenic strains on a C57BL/6 background containing single, double, or triple Idd loci were screened for the IL-12p40 overproduction defect. Of the seven congenic strains screened, only those carrying the Idd4 locus, i.e., B6.NODIdd4 and B6.NODIdd1/Idd4, showed significantly elevated levels of IL-12p40 production relative to the parental C57BL/6 strain (Fig. 2), demonstrating that the Idd4 locus is the factor responsible for the IL-12p40 overproduction defect. The 20% difference in IL-12p40 levels between the B6.NODIdd4 and NOD strains is most likely due to elevated IL-10 levels (an inhibitory cytokine) in the C57BL/6 background: C57BL/6 and the B6.NODIdd4 congenic M
produce 4-fold more IL-10 than NOD M
(Ref. 4 and data not shown). Moreover, Ab-mediated neutralization of IL-10 restored IL-12p40 levels of the Idd4 congenic strains (but not C57BL/6) to those of the NOD strain (data not shown). As a control for the Idd4-specific effects on the IL-12p40 gene, TNF-
levels were similar among all strains (i.e., less than 2-fold differences; data not shown), which is consistent with our previous observations of C57BL/6 and NOD M
TNF-
levels (4).
|
express similar levels of IL-12p40 mRNA
We confirmed that the IL-12p40 overproduction defect was associated with the Idd4 locus by comparing mRNA levels expressed among the C57BL/6, B6.NODIdd4, B6.NODIdd1/Idd4, and NOD strains (Fig. 3). Maximal expression of IL-12p40 mRNA occurred at 4 h in M
from all four strains; M
from the NOD, B6.NODIdd4, and B6.NODIdd1/Idd4 strains expressed similar levels, each of which were 6- to 12-fold greater than those of the C57BL/6 at 4 h. Maximum IL-12p35 mRNA expression among all strains occurred at 4 h at which time differences among strains were roughly 2- to 3-fold. Moreover, a distinguishing qualitative difference is that M
expression of IL-12p40 mRNA was substantially greater than that of IL-12p35 mRNA only in the NOD, B6.NODIdd4, and B6.NODIdd1/Idd4 strains, whereas mRNA levels of these two subunits were similar in the C57BL/6 (Fig. 3) and in other control strains as well (4, 5). Note that we have previously shown that the IL-12p40 expression defect by NOD M
leads to overproduction of the functional heterodimer, IL-12p70 (4, 5). These results further support the association of the IL-12p40 defect with the Idd4 locus.
|
Although the Idd4 locus (15) and the IL-12p40 gene, i.e., IL-12b (16), map to murine chromosome 11, it is unclear whether the IL-12b gene, which maps to the 19 cM position, is contained within the Idd4 interval of the B6.NODIdd4 congenic strain, which starts around the 1620 cM position (Ref. 13 and see Table I). To address this, we made use of two different single-nucleotide polymorphisms located within the IL-12p40 cDNA that distinguish the C57BL/6 (and the CBA) from the NOD sequence (i.e., T
C (B6
NOD) at both 506 and 880 nucleotide positions, see Materials and Methods and Ref. 14). Sequencing of the two single-nucleotide polymorphisms in cDNA from all strains studied in this report showed that strains containing the Idd4 interval (and therefore the IL-12p40 defect) also contained the NOD IL-12b allele, and that those strains that did not contain the Idd4 locus contained the B6 (and CBA, see below) IL-12b allele (Table I).
|
levels were similar among all strains tested (Fig. 4B), confirming that the underlying molecular aberrancy does not effect the general M
activation pathway, but rather is focused on IL-12p40 expression in the NOcCB-1 and NOD strains. The NOcCB-1 strain was the only one of the four congenic strains to contain the entire Idd4 locus (see Materials and Methods and Ref. 12 for a detailed comparison of strains) and the NOD IL-12b allele (Table I). These results confirm that the IL-12p40 expression defect is caused by the Idd4 locus, which encompasses the NOD IL-12b allele.
|
from Idd congenic and normal strains may reveal the genes responsible for the IL-12p40 expression defect. As the mouse genome sequence is near completion, this genomic information should be useful in uncovering the genetic aberrancies within disease-associated loci of autoimmune-prone strains.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: IDDM, precipitate insulin-dependent diabetes mellitus; NOD, nonobese diabetic; M
, macrophage. ![]()
Received for publication March 25, 2003. Accepted for publication August 4, 2003.
| References |
|---|
|
|
|---|
and IL-10 define a unique cytokine profile in macrophages from young nonobese diabetic mice. Diabetes 49:1106.[Abstract]
B regulation due to a hyperactive I
B kinase. J. Immunol. 167:1461.This article has been cited by other articles:
![]() |
L. M. Maier, S. K. Howlett, K. M. Rainbow, J. Clark, J. M. M. Howson, J. A. Todd, and L. S. Wicker NKG2D-RAE-1 Receptor-Ligand Variation Does Not Account for the NK Cell Defect in Nonobese Diabetic Mice J. Immunol., November 15, 2008; 181(10): 7073 - 7080. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Marleau, K. L. Summers, and B. Singh Differential Contributions of APC Subsets to T Cell Activation in Nonobese Diabetic Mice J. Immunol., April 15, 2008; 180(8): 5235 - 5249. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshida, F. Jiang, T. Honjo, and T. Okazaki PD-1 deficiency reveals various tissue-specific autoimmunity by H-2b and dose-dependent requirement of H-2g7 for diabetes in NOD mice PNAS, March 4, 2008; 105(9): 3533 - 3538. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Enzler, S. Gillessen, M. Dougan, J. P. Allison, D. Neuberg, D. A. Oble, M. Mihm, and G. Dranoff Functional deficiencies of granulocyte-macrophage colony stimulating factor and interleukin-3 contribute to insulitis and destruction of {beta} cells Blood, August 1, 2007; 110(3): 954 - 961. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Litherland, K. M. Grebe, N. S. Belkin, E. Paek, J. Elf, M. Atkinson, L. Morel, M. J. Clare-Salzler, and M. McDuffie Nonobese Diabetic Mouse Congenic Analysis Reveals Chromosome 11 Locus Contributing to Diabetes Susceptibility, Macrophage STAT5 Dysfunction, and Granulocyte-Macrophage Colony-Stimulating Factor Overproduction J. Immunol., October 1, 2005; 175(7): 4561 - 4565. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kimura, S.-C. Tzou, R. Rocchi, M. Kimura, K. Suzuki, A. F. Parlow, N. R. Rose, and P. Caturegli Interleukin (IL)-12-Driven Primary Hypothyroidism: the Contrasting Roles of Two Th1 Cytokines (IL-12 and Interferon-{gamma}) Endocrinology, August 1, 2005; 146(8): 3642 - 3651. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Pearson, P. Weiser, T. G. Markees, D. V. Serreze, L. S. Wicker, L. B. Peterson, A.-M. Cumisky, L. D. Shultz, J. P. Mordes, A. A. Rossini, et al. Islet Allograft Survival Induced by Costimulation Blockade in NOD Mice Is Controlled by Allelic Variants of Idd3 Diabetes, August 1, 2004; 53(8): 1972 - 1978. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |