| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,¶
,¶
* Department of Immunology, Osaka Medical Center for Cancer and Cardiovascular Diseases, Higashinari-ku, Osaka, Japan;
Department of Molecular Immunology, Nara Institute Science and Technology, Ikoma, Nara, Japan;
Department of Virology, Osaka City University Medical School, Osaka,
Department of Cell Biology, Nagahama Institute of Bio-Science and Technology, Nagahama, Shiga, Japan; and
¶ Core Research for Evolutional Science and Technology, Japan Science and Technology, Tokyo, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and IFN-
promoter. Type I IFNs (IFN-
/) function as key cytokines in anti-viral host defense. Human fibroblasts express TLR3 on the cell surface, and anti-TLR3 mAb inhibits dsRNA-induced IFN- secretion by fibroblasts, suggesting that TLR3 acts on the cell surface to sense viral infection. In this study, we examined the expression and localization of human TLR3 in various DC subsets using anti-TLR3 mAb. In monocyte-derived immature dendritic cells (iDCs), TLR3 predominantly resided inside the cells but not on the cell surface. iDCs produced IL-12p70 and IFN- and - in response to poly(I:C). Similar response was observed in iDCs treated with rotavirus-derived dsRNA. These responses could not be blocked by pretreatment of the cells with anti-TLR3 mAb. In CD11c+ blood DCs, cytoplasmic retention of TLR3 was also observed as in monocyte-derived iDCs, again endorsing a different TLR3 distribution profile from fibroblasts. In precursor DC2, however, TLR3 could not be detected inside or outside the cells. Of note, there was a putative centrosomal protein that shared an epitope with TLR3 in myeloid DCs and precursor DC2, but not peripheral blood monocytes. Immunoelectron microscopic analysis revealed that TLR3, when stably expressed in the murine B cell line Ba/F3, was specifically accumulated in multivesicular bodies, a subcellular compartment situated in endocytic trafficking pathways. Thus, regulation and localization of TLR3 are different in each cell type, which may reflect participation of cell type-specific multiple pathways in antiviral IFN induction via TLR3. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and IFN- promoter via myeloid differentiation factor 88 (MyD88)-independent and MyD88 adapter-like/Toll-IL-1R domain (TIR) adapter protein-independent manner (11, 13, 14). A novel adapter molecule named TIR-containing adapter molecule (TICAM)-1 was identified, which binds the TIR of TLR3 and transmits signal to activate IFN- promoter in response to poly(I:C) (14). Human lung fibroblast cell line, MRC-5, expresses TLR3 on the cell surface, and anti-TLR3 mAb we established inhibited poly(I:C)-induced IFN- production in MRC-5 cells, which suggest that TLR3 may act on the cell surface to sense viral infection (11).
Type I IFNs (IFN-/) play a critical role in antiviral immune responses, and also mediate a variety of immunoregulatory effects that may link between innate and adaptive immune responses (15, 16). IFN- is mainly produced by fibroblasts upon viral infection or treatment with poly(I:C), while human plasmacytoid precursor DC (pre-DC)2, known as natural IFN-producing cells, is a major source of IFN- upon exposure to viruses and bacteria (17, 18). Monocyte-derived immature DCs (iDCs), on the other hand, produce large amounts of IL-12p70 and up-regulate costimulatory molecules on their cell surface by treatment with dsRNA, which induces Th1 differentiation leading to antiviral immune responses (19, 20). Recent studies demonstrated that TLR3 was expressed in monocyte-derived iDCs and CD11c+ immature blood DCs, but not in pre-DC2 at the message level (7, 9, 21, 22). Although myeloid DCs have TLR3 and sense dsRNA, how DCs recognizes dsRNA by their TLR3 remains unknown.
In this study, using a mAb against human TLR3, we analyzed the expression and localization of TLR3 in human DC subsets. We show evidence suggesting that regulation and localization of TLR3 expression are different in each cell type and that intracellular TLR3 responds to dsRNA in iDCs.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CD14+ monocytes were isolated from human PBMCs using the MACS system (Miltenyi Biotec, Bergisch Gladbach, Germany). The monocytes were cultured for 6 days in RPMI 1640 supplemented with 10% heat-inactivated FCS (JRH Biosciences, Lenexa, KS) and antibiotics, in the presence of 500 U/ml GM-CSF (PeproTech EC, London, U.K.) and 100 U/ml of IL-4 (PeproTech) to obtain monocyte-derived iDCs (23). To induce the maturation of iDCs, the cells were cultured for 40 h with 10 ng/ml LPS from Escherichia coli serotype 0111:B4 (Sigma-Aldrich, St. Louis, MO), 100 nM of synthetic macrophage-activating lipopeptide 2 (MALP-2) (24, 25), or 12.5 µg/ml poly(I:C) (Amersham Pharmacia Biotech, Piscataway, NJ) in the presence of 500 U/ml GM-CSF. MALP-2 and poly(I:C) were treated with polymyxin B (Sigma-Aldrich) (final concentration, 10 µg/ml) for 1 h at 37°C before stimulation of the cells. Human CD11c+ blood DCs and plasmacytoid pre-DC2 were isolated from PBMCs using a blood DC Ag (BDCA)-1 cell isolation kit or BDCA-4 cell isolation kit, respectively, according to the manufacturer’s instructions (Miltenyi Biotec). The purity of BDCA-1+ myeloid blood DCs and BDCA-4+ plasmacytoid blood DCs was >95%. HeLa cells were cultured in MEM containing 5% heat-inactivated FCS and antibiotics. The IL-3-dependent murine Ba/F3 cells were cultured in RPMI containing 10% heat-inactivated FCS, 5 ng/ml murine IL-3, 100 µM 2-ME, and antibiotics. Recombinant human IFN- was kindly provided by Toray (Tokyo, Japan). The phosphorothioate CpG oligodeoxynucleotide (ODN) 2006 (TCGTCGTTTTGTCGTTTTGTCGT) was synthesized by Hokkaido System Science (Hokkaido, Japan).
Stable transfectant
Stable transfectants expressing human TLR3 were prepared as previously described (11). Briefly, Ba/F3 cells were transfected with the pEFBOS expression vector encoding human TLR3, together with pSV2neo plasmid by electroporation. The transfectants were selected with G418 for 10 days. The expression of TLR3 was confirmed by intracellular staining for the flag epitope, which had been attached to the COOH terminus of TLR3.
RT-PCR analysis
Total RNA was isolated from monocytes, monocyte-derived iDCs, BDCA-1+ myeloid blood DCs, and BDCA-4+ plasmacytoid DCs using RNeasy Mini kit (Qiagen, Valencia, CA). DNase I-treated total RNA (3 µg) was reverse-transcribed by using random primers with RNaseH-free reverse transcriptase (Invitrogen, San Diego, CA). TLR2, TLR3, TLR4, and GAPDH were amplified using specific primers described below. TLR2 (5'-GGCTCTGGTGCTGACATCC-3'/5'-CCAACTCCATTAAGGGTACAGTC-3'); TLR3 (5'-CTCAGAAGATTACCAGCCGCC-3'/5'-CCATTATGAGACAGATCTAATG-3'); TLR4 (5'-ACCCCATCCAGAGTTTAGCCC-3'/5'-GTCACACTCACCAGGGAAAATG-3'); GAPDH (5'-CACAGTCCATGCCATCACTG-3'/5'-TACTCCTTGGAGGCCATGTG-3').
Monoclonal Abs
Anti-human TLR2 mAb (TLR2.45) and anti-human TLR3 mAb (TLR3.7) were obtained in our laboratory (11). Anti-human TLR4 mAb (HTA125) was a gift from Dr. K. Miyake (University of Tokyo, Tokyo, Japan) (26). Anti-TLR3 mAb against synthetic peptide of human TLR3 was purchased from BioCarta (San Diego, CA). Anti-CD4, anti-CD45RA, and anti-CD86 mAbs were purchased from Ancell (Bayport, MN). Anti-CD1a, anti-CD2, anti-CD83, and anti-HLA-DR were from Immunotech (Marseille, France), anti-CD64 and anti-CD123 (IL-3R) were from BD PharMingen (San Diego, CA), anti-CD8 was from Nichirei (Tokyo, Japan), and anti-CD33 and anti-CD11c were from BD Biosciences (San Jose, CA).
Preparation of viral dsRNA
Primate rotavirus strains were propagated in the monkey kidney cell line MA-104 as previously described (27). dsRNA of rotavirus (SA-11 strain) was prepared from viral infected-MA104 cells by using TRIzol LS (Invitrogen), and 11 segments of dsRNA were checked by RNA-PAGE as described (28). The dsRNA preparation was treated with polymyxin B and its function was assessed using monocyte-derived iDCs and human fibroblast cell line, MRC-5.
Flow cytometry
Cells were incubated with the indicated mAbs (1 µg) together with human IgG (10 µg) for 30 min at 4°C in FACS buffer (Dulbecco’s PBS containing 0.5% BSA and 0.1% sodium azide). After the cells were washed twice with the above buffer, FITC-labeled secondary Ab (American Qualex, San Clemente, CA) was added and further incubated for 30 min at 4°C. For intracellular staining, cells were pretreated with permeabilizing solution (BD Biosciences) for 10 min at room temperature, washed once with Dulbecco’s PBS and then incubated with mAbs (1 µg) for 30 min at room temperature. After washing, cells were reacted with FITC-labeled secondary Ab at room temperature for 30 min. Goat serum (10%) was added to both reaction mixtures to prevent nonspecific binding. The cells were then analyzed on a FACSCalibur (BD Biosciences).
Immunoprecipitation
Ba/F3 cells stably expressing Flag-tagged human TLR3, HEK293 cells transiently expressing Flag-tagged human TLR3 (11), and HeLa cells endogenously expressing TLR3 were lysed in lysis buffer (50 mM Tris-HCl, pH 7.5, containing 150 mM NaCl, 1% Nonidet P-40, 10 mM EDTA, 25 mM iodoacetamide, and 2 mM PMSF). TLR3 was immunoprecipitated with anti-Flag mAb (M2) or anti-TLR3 mAb (TLR3.7) and subjected to SDS-PAGE (7.5%) under reducing conditions, followed by immunoblotting with M2 anti-Flag mAb (Sigma-Aldrich) or anti-TLR3 mAb (IMGENEX, San Diego, CA). Mouse IgG1 was used as a negative-control for immunoprecipitation.
To detect TLR3 protein expressed in monocyte-derived iDCs, 4.5 x 107 cells were washed three times in PBS and resuspended in hypotonic buffer (10 mM KCl, 5 mM MgCl2, 0.1 mM EDTA, 20 mM HEPES, pH 7.4) on ice for 20 min. Cells were lysed by Dounce homogenizer (50 strokes) and sequentially centrifuged at 600 x g to pellet nuclei, and 10,000 x g to pellet mitochondria and lysosome. The pellet (10,000 x g) was lysed in the lysis buffer. TLR3 protein in the lysate was immunoprecipitated as previously described.
Cytokine assays
Monocyte-derived iDCs in 24-well plates (6.6 x 105/ml), or BDCA-1+ myeloid blood DCs in 96-well round bottom plates (3 x 105/ml) were stimulated with LPS (100 ng/ml), MALP-2 (100 nM), or poly(I:C) (50 µg/ml) for 4 to 24 h. BDCA-4+ plasmacytoid DCs in round bottom 96-well plates (1.25 x 105/ml) were stimulated with LPS, MALP-2, poly(I:C), or CpG ODN 2006 (2 µM) in the presence of 500 U/ml of rhIL-3 (PeproTech). For the Ab inhibition assay, monocyte-derived iDCs were pretreated with 20 µg/ml of anti-TLR2 mAb (TLR2.45) or anti-TLR3 mAb (TLR3.7) for 30 min at 37°C, then stimulated with polymyxin B-treated poly(I:C) (0, 5, 10, 20 µg/ml) for 24 h. The levels of IFN-, IFN-, and IL-12p70 in the culture supernatants were measured by ELISA:IFN- (BioSource International, Camarillo, CA), IFN- (TFB, Tokyo, Japan), and IL-12p70 (Amersham Pharmacia Biotech).
MLR assay
Practical method was described in a previous report (29). Briefly, monocyte-derived iDCs were cultured with or without poly(I:C) (5 and 20 µg/ml) in the presence of GM-CSF (500 U/ml) for 24 h. The cells were irradiated (3000 rad) and cultured for 4 days with 1 x 105 allogeneic lymphocytes in 96-well plates in 100 µl RPMI 1640 containing 10% FCS. The lymphocyte proliferation was determined using a cell proliferation assay kit (CellTiter 96; Promega, Madison, WI).
Immunofluorescence microscopy
Monocytes, monocyte-derived iDCs, BDCA-1+ myeloid blood DCs, or BDCA-4+ plasmacytoid DCs were adhered to glass slides by Cytospin (Thermo Shandon, Cheshire, U.K.). The adhered cells were fixed for 30 min with 3% formaldehyde in PBS and were permeabilized with 0.5% saponin, 1% BSA/PBS for 30 min, washed four times with PBS. After soaking in 1% BSA/PBS, cells were treated for 1 h at room temperature with anti-TLR3 mAb (TLR3.7) or normal mouse IgG (20 µg/ml) (Sigma-Aldrich) in 1% BSA/PBS. Cells were then washed with 1% BSA/PBS and treated for 30 min at room temperature with rhodamine B-conjugated goat anti-mouse IgG (BioSource International) (1:100) in PBS containing 10% (w/v) Block Ace (Yukijirushi, Sapporo, Japan). The stained cells were visualized at x60 magnification under a FLUOVIEW FV300 (Olympus, Melville, NY). Images were captured using the attached computer software, FLUOVIEW.
Immunoelectron microscopy
For immunoelectron microscopy, the pre-embedding silver enhancement immunogold method was used with a slight modification (30). Briefly, a pellet of the cells was fixed in 4% paraformaldehyde in 0.1 M sodium phosphate buffer (pH 7.4) for 2 h. Cryosections (6 µm in thickness) were made and reacted with Abs, followed by incubation with colloidal gold-conjugated (diameter 1.4 nm) secondary Abs. The gold labeling was intensified using a silver enhancement kit, HQ silver (Nanoprobes).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
First, we examined whether the mAb TLR3.7 can immunoprecipitate human TLR3 expressed in a variety of cells. This mAb recognizes the extracellular portion of native TLR3, but fails to react with a denatured-form of TLR3 on blots (11). Flag-tagged TLR3 in lysates of Ba/F3 and HEK293 transfectants and endogenous TLR3 in HeLa cells were pulled down with TLR3.7 and resolved on SDS-PAGE followed by immunoblotting. The blots were probed with anti-Flag mAb or anti-human TLR3 peptide Ab (Fig. 1). TLR3 proteins were detected in the lanes using the specific mAb TLR3.7, suggesting that TLR3.7 can catch up TLR3 in cell lysates.
|
The protein expression levels of human TLR2, TLR3, and TLR4 in monocyte-derived iDCs were analyzed by flow cytometry using the characterized mAbs against human TLR2, TLR3, and TLR4. The surface marker profile of the iDCs prepared is shown in Fig. 2A. Several reports demonstrated that TLR2, TLR3, and TLR4 are expressed in monocyte-derived iDCs at the message levels (7, 9). At the protein level, TLR2 and TLR4 were marginally detected by cell surface staining, while TLR3 was detected only by intracellular staining (Fig. 2B). Expressions of the mRNAs of TLR2, TLR3, and TLR4 in these cells were confirmed by RT-PCR (Fig. 2C).
|
|
We next examined the TLR3 expression in human blood DCs, CD11c+ blood DCs and the second type of pre-DC2 (previously known as plasmacytoid DC precursors), which were recently identified as natural type I IFN-producing cells in human blood (17). CD11c+ blood DCs were isolated from PBMCs using BDCA-1 (CD1c) cell isolation kit. The CD1c Ag is expressed on a major subpopulation of myeloid blood DCs in human blood (31, 32). The freshly isolated CD1c (BDCA-1+) myeloid blood DCs were CD1a-, CD4+, CD11c+, CD123dim, CD33+, CD64+, CD80-, CD83-, CD86low, and HLA-DRhigh, the phenotype matching those in previous reports (31, 32) (Fig. 4A). The cells expressed TLR2, TLR3, and TLR4 similar to monocyte-derived iDCs, but cell surface expression level of TLR2 was higher than that of monocyte-derived iDCs (Fig. 4A).
|
)+CD11c-; their surface phenotype was identical with that of pre-DC2 (Fig. 4B). They also lacked CD1a, CD2, CD8, and CD64. Although the mRNA of TLR3 was not detectable in BDCA-4+ plasmacytoid DCs (Fig. 4B), TLR3 signal was detected by intracellular staining (Fig. 4Bb). One possibility of this protein-mRNA discrepancy is that anti-TLR3 mAb cross-reacted with an intracellular molecule other than TLR3 in BDCA-4+ cells. To confirm this possibility and where TLR3 is localized in myeloid DCs, immunofluorescent staining with anti-TLR3 mAb was performed and analyzed by confocal microscopy. As shown in Fig. 5A, TLR3 resided in the subcellular compartment but not on the plasma membrane in monocyte-derived iDCs and CD11c+ blood DCs. In addition, a spot-like fluorescent signal was detected near the nucleus in myeloid DCs and BDCA-4+ plasmacytoid DCs (Fig. 5A), which nearly merged with centrosome defined by 
-tublin (data not shown). Spot-like staining was not observed in monocytes (Figs. 3A and 5A), suggesting that the anti-TLR3 mAb (TLR3.7) recognizes centrosomal protein that shared an epitope with TLR3. This unidentified protein was expressed in myeloid DCs and plasmacytoid DCs but not in peripheral blood monocytes. Endogenous TLR3 protein was also detected in monocyte-derived iDCs by immunoprecipitation/immunoblotting analysis (Fig. 5B).
|
We next tested whether these DC subsets produced IFN-/ and IL-12p70 in response to MALP-2 (a TLR2 ligand), LPS, poly(I:C), or CpG ODN 2006 (a TLR9 ligand). Monocyte-derived iDCs produced IL-12p70 and IFN-/ in response to poly(I:C) or LPS, while BDCA-4+ plasmacytoid DCs produced IFN- in response to CpG ODN (Fig. 6A). Similar to monocyte-derived iDCs, BDCA-1+ myeloid DCs produced IFN- in response to poly(I:C), but its level was relatively low (data not shown). TLR2 signaling did not induce any IL-12p70, IFN-, or IFN- in either myeloid or BDCA-4+ DCs. Although a previous report showed that CpG ODN 2006 did not induce pre-DC2 to produce IFN- (33), freshly isolated BDCA-4+ plasmacytoid DCs induced large amounts of IFN- in response to ODN 2006, suggesting that there may be some differences between pre-DC2 and BDCA-4+ plasmacytoid DCs.
|
TLR3 does not act on the cell surface in DCs
We next tested whether TLR3 expressed in the myeloid lineage of DCs is competent to dsRNA recognition. Interestingly, function-blocking anti-TLR3 mAb could not inhibit poly(I:C)-induced IFN- production by monocyte-derived iDCs (Fig. 7A). Furthermore, long-term poly(I:C) stimulation was required to induce IFN- and IL-12p70 production in iDCs (Fig. 7B). In short-term stimulation (4 h), IFN- protein was below the detection limit in the culture supernatants of iDCs, which is completely different from fibroblasts expressing cell surface TLR3 (11). As TLR3 localizes intracellular compartment in myeloid DCs, we next examined whether endosomal maturation is required in poly(I:C)-mediated cytokine production similar to CpG DNA-mediated TLR9 signaling (34). In the presence of 5 µg/ml of endosomal acidification inhibitor, chloroquine, which dose is sufficient to inhibit CpG DNA-mediated cytokine production in B cells and monocytes, poly(I:C)-mediated IL-12p70 production by iDCs was markedly inhibited (Fig. 7C). Under the same conditions, action of LPS was not inhibited when judged by the level of IL-12p70 (Fig. 7C). Thus, dsRNA should be internalized into the acidified intracellular compartment in iDCs, in which TLR3 may reside for encounter with its ligands.
|
The subcellular compartment that TLR3 localizes to was further analyzed by immunoelectron microscopy using stable Ba/F3 transfectants expressing human TLR3. FACS analysis showed that TLR3 was predominantly present inside the cells and slightly expressed on the cell surface (Fig. 8A). Anti-Flag mAb detected TLR3 after the cells were permeabilized, because Flag tag was attached to the C terminus of TLR3. By observation with electron microscopy, the Ba/F3 cells were found to possess relatively large vacuoles containing multiple vesicles in the lumen, called MVBs. MVBs are late endosomal compartments situated in the endocytic route between early endosomes and lysosomes (35, 36, 37). In APCs such as B cells and DCs, MHC class II is stored intracellularly at the internal vesicles of MVBs (38, 39, 40). In the Ba/F3 cells stably expressing human TLR3, TLR3 molecules were found predominantly on the internal membrane of MVBs by immunoelectron microscopy with anti-TLR3 or anti-Flag mAb and then gold-labeled secondary Ab (Fig. 8B). A small number of TLR3 molecules were detected on the limiting membrane of MVBs and on the plasma membrane (Fig. 8B). Although no drastic change of TLR3 expression both on the plasma membrane and intracellular were seen after 24-h stimulation with poly(I:C), cell surface expression of TLR3 was slightly increased through TLR3 signaling (Fig. 8C). These results suggest that in Ba/F3 cells, endocytic trafficking activity is somewhat increased by poly(I:C) stimulation, but most TLR3 molecules are largely stored intracellularly like monocyte-derived iDCs.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/ and IL-12p70 in response to poly(I:C), a synthetic ligand for TLR3. The Ab-blocking research (Fig. 7A) suggests that TLR3 does not act on the cell surface in iDCs. Similar to monocyte-derived iDCs, CD11c+ blood DCs also expressed TLR3 inside the cells and produced IFN- in response to poly(I:C). These results suggest that myeloid-lineage DCs express TLR3 in their cytoplasmic compartment, the distribution profiles of which differ from that of fibroblasts expressing TLR3 on the cell surface. BDCA-4+ plasmacytoid DCs, on the other hand, do not express TLR3 either inside or outside the cells consistent with previous reports (21, 22). BDCA-4 Ag is a novel human DC marker, which is expressed on CD11c-CD123bright plasmacytoid blood DCs and also appeared on monocyte-derived and CD34+ cell-derived CD1a+ DCs (31, 32). Interestingly, the anti-TLR3 mAb (TLR3.7) cross-reacts with an intracellular molecule expressed in BDCA-4+cells and myeloid DCs. This cross-reactive Ag shares an epitope with TLR3 and nearly merged with the centrosome marker, suggesting that this is a centrosomal protein.
In myeloid-lineage DCs, TLR3 appears to localize to endosomal compartments (Fig. 5), but any organelle marker we tested and MHC class II molecule did not colocalize with TLR3 (K. Funami, M. Matsumoto, A. Yamamoto, and T. Seya, unpublished observations). Notably, TLR3 was shown to specifically localize to MVBs in a stable transfectant Ba/F3 cell, which is an IL-3-dependent murine B cell line (Fig. 8). MVBs are late endosomal compartments situated in the endocytic trafficking pathways, and are responsible for both the biosynthetic delivery of lysosomal proteins and the down-regulation of activated cell surface receptors (35, 36, 37). They are 300–500 nm vacuoles with numerous membrane vesicles in their lumens. Internal vesicles of MVBs are generated by inward budding of the limiting membrane (36). In APCs such as B cells and DCs, MHC class II is stored intracellularly in MVBs, referred to as MHC class II-enriched compartments or a class II-containing vesicle, which is a specialized site for peptide loading (38, 39, 40). Stimulation of DCs with living bacteria or bacterial components such as LPS results in the reorganization of MVBs and increased surface expression of MHC class II at the plasma membrane (40). In Ba/F3 cells, TLR3 molecules resided in the internal membrane of MVBs, and small numbers of TLR3 were detected on the limiting membrane of MVBs and on the plasma membrane (Fig. 8B). However, no drastic change of TLR3 expression was seen either on the plasma membrane or inside the cell after 24-h stimulation with poly(I:C) (Fig. 8C). Thus, TLR3 molecules are stored in intracellular compartments in Ba/F3 cells like monocyte-derived iDCs.
The regulation of human TLR3 expression is different from that of murine TLR3 (41). LPS did not up-regulate the TLR3 expression in human monocyte-derived iDCs, while poly(I:C) induced both murine and human TLR3 expressions in DCs (Fig. 3). A previous report showed that human TLR3 mRNA is up-regulated by viral infection or treatment of macrophages with type I IFN (42). Poly(I:C) induces IFN-/ secretion by murine DCs and the released IFN-/ acts in an autocline manner through the IFN-/ receptor to induce TLR3 expression in DCs (43). In either case, TLR3 expression is up-regulated intracellularly. In this study, human TLR3 was undetectable on the cell surface after the treatment of monocyte-derived iDCs with poly(I:C) or IFN- (Fig. 3C, data not shown). Although the mechanisms by which TLR3 is enriched into the vacuoles are under investigation, the mode of dsRNA-TLR3 interaction in myeloid DCs should differ from that in fibroblasts.
In this study, we first demonstrated that dsRNA of viral origin activates DCs in a similar manner to poly(I:C). Although TLR3 does not present on the cell surface in DCs, exogenously added dsRNA activates the cells to produce IFN-/ and IL-12p70, suggesting that after internalization, dsRNA encounters intracellular TLR3 present in the subcellular compartments and activated TLR3 transduces signals inside the cells. Supporting this issue is that 1) an endosomal acidification inhibitor, chloroquine, inhibited IL-12p70 liberation from iDCs by poly(I:C), 2) long-term incubation with poly(I:C) was required for IFN- and IL-12p70 induction (Fig. 7). Because we just extrinsically added poly(I:C) or dsRNA to cells without using transfection reagents, no direct association between poly(I:C) and cytoplasmic proteins could be verified.
A possibility might have remained, however, that poly(I:C) internalized could activate protein kinase R (PKR) as suggested in mouse embryonic fibroblasts. PKR is a cytoplasmic protein and has been characterized as a major intracellular RNA-recognition molecule inducing antiviral cellular response (44). Nevertheless, PKR knockout mice and cells showed no severe phenotype, which suggested the presence of an additional protection strategy against viral infection (45). Based on these results, together with our present finding indicating that dsRNA is taken up into the endosomal compartments, we hold that the viral dsRNA recognition system barely involves cytoplasmic PKR in DCs, at least under our relevant conditions. Our findings might provide new insight into the physiological antiviral DC functions in conjunction with reported knowledge on the recognition system of dsRNA (46). Further study including where TLR3 encounters dsRNA and how signals are transduced in DCs will be needed to consolidate the importance of the TLR3-mediated antiviral DC functions.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Misako Matsumoto, Department of Immunology, Osaka Medical Center for Cancer and Cardiovascular Diseases, 1-3-2 Nakamichi, Higashinari-ku, Osaka, 537-8511 Japan. E-mail address: matumoto-mi{at}mc.pref.osaka.jp
3 Abbreviations used in this paper: TLR, Toll-like receptor; DC, dendritic cell; iDC, immature DC; pre-DC; precursor DC; MALP-2, macrophage-activating lipopeptide-2; MVBs, multivesicular bodies; BDCA, blood DC Ag; ODN, oligodeoxynucleotide; PKR, protein kinase R.
Received for publication April 23, 2002. Accepted for publication July 25, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B by Toll-like receptor 3. Nature 413:732.[Medline]
induction. Nat. Immun. 4:161.[Medline]
and as immune regulators: a new look. Immunity 14:661.[Medline]
-producing predendritic cell (pre-DC) 2 from human CD34+ hematopoietic stem cells. J. Exp. Med. 192:1785./ gene induction. Immunity 13:539.[Medline]This article has been cited by other articles:
|
|
 |
|
  N. Wang, Y. Liang, S. Devaraj, J. Wang, S. M. Lemon, and K. Li Toll-Like Receptor 3 Mediates Establishment of an Antiviral State against Hepatitis C Virus in Hepatoma Cells J. Virol., October 1, 2009; 83(19): 9824 - 9834. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Chamorro, J. J. Garcia-Vallejo, W. W. J. Unger, R. J. Fernandes, S. C. M. Bruijns, S. Laban, B. O. Roep, B. A. 't Hart, and Y. van Kooyk TLR Triggering on Tolerogenic Dendritic Cells Results in TLR2 Up-Regulation and a Reduced Proinflammatory Immune Program J. Immunol., September 1, 2009; 183(5): 2984 - 2994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Goodchild, N. Nopper, A. Craddock, T. Law, A. King, G. Fanning, L. Rivory, and T. Passioura Primary Leukocyte Screens for Innate Immune Agonists J Biomol Screen, July 1, 2009; 14(6): 723 - 730. [Abstract] [PDF]
|
|
|
|
|
|
R. Romieu-Mourez, M. Francois, M.-N. Boivin, M. Bouchentouf, D. E. Spaner, and J. Galipeau Cytokine Modulation of TLR Expression and Activation in Mesenchymal Stromal Cells Leads to a Proinflammatory Phenotype J. Immunol., June 15, 2009; 182(12): 7963 - 7973. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ablasser, H. Poeck, D. Anz, M. Berger, M. Schlee, S. Kim, C. Bourquin, N. Goutagny, Z. Jiang, K. A. Fitzgerald, et al. Selection of Molecular Structure and Delivery of RNA Oligonucleotides to Activate TLR7 versus TLR8 and to Induce High Amounts of IL-12p70 in Primary Human Monocytes J. Immunol., June 1, 2009; 182(11): 6824 - 6833. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wornle, M. Roeder, M. Sauter, and A. Ribeiro Role of matrix metalloproteinases in viral-associated glomerulonephritis Nephrol. Dial. Transplant., April 1, 2009; 24(4): 1113 - 1121. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Frleta, C. I. Yu, E. Klechevsky, A.-L. Flamar, G. Zurawski, J. Banchereau, and A. K. Palucka Influenza Virus and Poly(I:C) Inhibit MHC Class I-Restricted Presentation of Cell-Associated Antigens Derived from Infected Dead Cells Captured by Human Dendritic Cells J. Immunol., March 1, 2009; 182(5): 2766 - 2776. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Negishi, T. Osawa, K. Ogami, X. Ouyang, S. Sakaguchi, R. Koshiba, H. Yanai, Y. Seko, H. Shitara, K. Bishop, et al. A critical link between Toll-like receptor 3 and type II interferon signaling pathways in antiviral innate immunity PNAS, December 23, 2008; 105(51): 20446 - 20451. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Itoh, A. Watanabe, K. Funami, T. Seya, and M. Matsumoto The Clathrin-Mediated Endocytic Pathway Participates in dsRNA-Induced IFN-{beta} Production J. Immunol., October 15, 2008; 181(8): 5522 - 5529. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Ilvesaro, M. A. Merrell, L. Li, S. Wakchoure, D. Graves, S. Brooks, E. Rahko, A. Jukkola-Vuorinen, K. S. Vuopala, K. W. Harris, et al. Toll-Like Receptor 9 Mediates CpG Oligonucleotide-Induced Cellular Invasion Mol. Cancer Res., October 1, 2008; 6(10): 1534 - 1543. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Starace, R. Galli, A. Paone, P. D. Cesaris, A. Filippini, E. Ziparo, and A. Riccioli Toll-Like Receptor 3 Activation Induces Antiviral Immune Responses in Mouse Sertoli Cells Biol Reprod, October 1, 2008; 79(4): 766 - 775. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Wilson, P. F. de Sessions, M. A. Leon, and F. Scholle West Nile Virus Nonstructural Protein 1 Inhibits TLR3 Signal Transduction J. Virol., September 1, 2008; 82(17): 8262 - 8271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Matsuo, H. Oshiumi, T. Tsujita, H. Mitani, H. Kasai, M. Yoshimizu, M. Matsumoto, and T. Seya Teleost TLR22 Recognizes RNA Duplex to Induce IFN and Protect Cells from Birnaviruses J. Immunol., September 1, 2008; 181(5): 3474 - 3485. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Fukuda, T. Watanabe, T. Tokisue, T. Tsujita, S. Nishikawa, T. Hasegawa, T. Seya, and M. Matsumoto Modulation of Double-stranded RNA Recognition by the N-terminal Histidine-rich Region of the Human Toll-like Receptor 3 J. Biol. Chem., August 15, 2008; 283(33): 22787 - 22794. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. C. Nance, A.-K. Yi, F. C. Re, and E. A. Fitzpatrick MyD88 is necessary for neutrophil recruitment in hypersensitivity pneumonitis J. Leukoc. Biol., May 1, 2008; 83(5): 1207 - 1217. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Errington, L. Steele, R. Prestwich, K. J. Harrington, H. S. Pandha, L. Vidal, J. de Bono, P. Selby, M. Coffey, R. Vile, et al. Reovirus Activates Human Dendritic Cells to Promote Innate Antitumor Immunity J. Immunol., May 1, 2008; 180(9): 6018 - 6026. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Yasuda, A. Leelahavanichkul, S. Tsunoda, J. W. Dear, Y. Takahashi, S. Ito, X. Hu, H. Zhou, K. Doi, R. Childs, et al. Chloroquine and inhibition of Toll-like receptor 9 protect from sepsis-induced acute kidney injury Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1050 - F1058. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Liu, I. Botos, Y. Wang, J. N. Leonard, J. Shiloach, D. M. Segal, and D. R. Davies Structural Basis of Toll-Like Receptor 3 Signaling with Double-Stranded RNA Science, April 18, 2008; 320(5874): 379 - 381. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kramer, B. M. Schulte, L. W. J. Toonen, P. M. Barral, P. B. Fisher, K. H. W. Lanke, J. M. D. Galama, F. J. M. van Kuppeveld, and G. J. Adema Phagocytosis of Picornavirus-Infected Cells Induces an RNA-Dependent Antiviral State in Human Dendritic Cells J. Virol., March 15, 2008; 82(6): 2930 - 2937. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. N. Leonard, R. Ghirlando, J. Askins, J. K. Bell, D. H. Margulies, D. R. Davies, and D. M. Segal The TLR3 signaling complex forms by cooperative receptor dimerization PNAS, January 8, 2008; 105(1): 258 - 263. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Vercammen, J. Staal, and R. Beyaert Sensing of Viral Infection and Activation of Innate Immunity by Toll-Like Receptor 3 Clin. Microbiol. Rev., January 1, 2008; 21(1): 13 - 25. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sivori, M. Falco, S. Carlomagno, E. Romeo, L. Moretta, and A. Moretta Heterogeneity of TLR3 mRNA transcripts and responsiveness to poly (I:C) in human NK cells derived from different donors Int. Immunol., December 1, 2007; 19(12): 1341 - 1348. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Shibolet, C. Giallourakis, I. Rosenberg, T. Mueller, R. J. Xavier, and D. K. Podolsky AKAP13, a RhoA GTPase-specific Guanine Exchange Factor, Is a Novel Regulator of TLR2 Signaling J. Biol. Chem., November 30, 2007; 282(48): 35308 - 35317. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Woods, F. Monneaux, P. Soulas-Sprauel, S. Muller, T. Martin, A.-S. Korganow, and J.-L. Pasquali Influenza Virus-Induced Type I Interferon Leads to Polyclonal B-Cell Activation but Does Not Break Down B-Cell Tolerance J. Virol., November 15, 2007; 81(22): 12525 - 12534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Funami, M. Sasai, Y. Ohba, H. Oshiumi, T. Seya, and M. Matsumoto Spatiotemporal Mobilization of Toll/IL-1 Receptor Domain-Containing Adaptor Molecule-1 in Response to dsRNA J. Immunol., November 15, 2007; 179(10): 6867 - 6872. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Shingai, T. Ebihara, N. A. Begum, A. Kato, T. Honma, K. Matsumoto, H. Saito, H. Ogura, M. Matsumoto, and T. Seya Differential Type I IFN-Inducing Abilities of Wild-Type versus Vaccine Strains of Measles Virus J. Immunol., November 1, 2007; 179(9): 6123 - 6133. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Lundberg, S. K. Drexler, C. Monaco, L. M. Williams, S. M. Sacre, M. Feldmann, and B. M. Foxwell Key differences in TLR3/poly I:C signaling and cytokine induction by human primary cells: a phenomenon absent from murine cell systems Blood, November 1, 2007; 110(9): 3245 - 3252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. D. Gilfoy and P. W. Mason West Nile Virus-Induced Interferon Production Is Mediated by the Double-Stranded RNA-Dependent Protein Kinase PKR J. Virol., October 15, 2007; 81(20): 11148 - 11158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Hirata, A. H. Broquet, L. Menchen, and M. F. Kagnoff Activation of Innate Immune Defense Mechanisms by Signaling through RIG-I/IPS-1 in Intestinal Epithelial Cells J. Immunol., October 15, 2007; 179(8): 5425 - 5432. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Shuang Chen, M. H. Wong, D. J. Schulte, M. Arditi, and K. S. Michelsen Differential expression of Toll-like receptor 2 (TLR2) and responses to TLR2 ligands between human and murine vascular endothelial cells Innate Immunity, October 1, 2007; 13(5): 281 - 296. [Abstract] [PDF]
|
|
|
|
 |
|
 T. Morikawa, A. Sugiyama, H. Kume, S. Ota, T. Kashima, K. Tomita, T. Kitamura, T. Kodama, M. Fukayama, and H. Aburatani Identification of Toll-Like Receptor 3 as a Potential Therapeutic Target in Clear Cell Renal Cell Carcinoma Clin. Cancer Res., October 1, 2007; 13(19): 5703 - 5709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. H. Holm, J. Zurney, V. Tumilasci, S. Leveille, P. Danthi, J. Hiscott, B. Sherry, and T. S. Dermody Retinoic Acid-inducible Gene-I and Interferon-beta Promoter Stimulator-1 Augment Proapoptotic Responses Following Mammalian Reovirus Infection via Interferon Regulatory Factor-3 J. Biol. Chem., July 27, 2007; 282(30): 21953 - 21961. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yamazaki, K. Suzuki, E. Yamada, T. Yamada, F. Takeshita, M. Matsumoto, T. Mitsuhashi, T. Obara, K. Takano, and K. Sato Suppression of Iodide Uptake and Thyroid Hormone Synthesis with Stimulation of the Type I Interferon System by Double-Stranded Ribonucleic Acid in Cultured Human Thyroid Follicles Endocrinology, July 1, 2007; 148(7): 3226 - 3235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. T. Ranjith-Kumar, W. Miller, J. Sun, J. Xiong, J. Santos, I. Yarbrough, R. J. Lamb, J. Mills, K. E. Duffy, S. Hoose, et al. Effects of Single Nucleotide Polymorphisms on Toll-like Receptor 3 Activity and Expression in Cultured Cells J. Biol. Chem., June 15, 2007; 282(24): 17696 - 17705. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Uematsu and S. Akira Toll-like Receptors and Type I Interferons J. Biol. Chem., May 25, 2007; 282(21): 15319 - 15323. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Brinkmann, E. Spooner, K. Hoebe, B. Beutler, H. L. Ploegh, and Y.-M. Kim The interaction between the ER membrane protein UNC93B and TLR3, 7, and 9 is crucial for TLR signaling J. Cell Biol., April 23, 2007; 177(2): 265 - 275. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. B. Gowen, M.-H. Wong, K.-H. Jung, A. B. Sanders, W. M. Mitchell, L. Alexopoulou, R. A. Flavell, and R. W. Sidwell TLR3 Is Essential for the Induction of Protective Immunity against Punta Toro Virus Infection by the Double-Stranded RNA (dsRNA), Poly(I:C12U), but not Poly(I:C): Differential Recognition of Synthetic dsRNA Molecules J. Immunol., April 15, 2007; 178(8): 5200 - 5208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Sullivan, J. H. Postlethwait, C. R. Lage, P. J. Millard, and C. H. Kim Evidence for Evolving Toll-IL-1 Receptor-Containing Adaptor Molecule Function in Vertebrates J. Immunol., April 1, 2007; 178(7): 4517 - 4527. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Zhou, H. Wei, R. Sun, and Z. Tian Recognition of Double-Stranded RNA by TLR3 Induces Severe Small Intestinal Injury in Mice J. Immunol., April 1, 2007; 178(7): 4548 - 4556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Uchida, P. O. Scumpia, D. M. Murasko, S. Seki, S. Woulfe, M. J. Clare-Salzler, and L. L. Moldawer Variable Requirement of Dendritic Cells for Recruitment of NK and T Cells to Different TLR Agonists J. Immunol., March 15, 2007; 178(6): 3886 - 3892. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. T. Ranjith-Kumar, W. Miller, J. Xiong, W. K. Russell, R. Lamb, J. Santos, K. E. Duffy, L. Cleveland, M. Park, K. Bhardwaj, et al. Biochemical and Functional Analyses of the Human Toll-like Receptor 3 Ectodomain J. Biol. Chem., March 9, 2007; 282(10): 7668 - 7678. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. A. Derbigny, S.-C. Hong, M. S. Kerr, M. Temkit, and R. M. Johnson Chlamydia muridarum Infection Elicits a Beta Interferon Response in Murine Oviduct Epithelial Cells Dependent on Interferon Regulatory Factor 3 and TRIF Infect. Immun., March 1, 2007; 75(3): 1280 - 1290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-F. Tsan and Baochong Gao Review: Pathogen-associated molecular pattern contamination as putative endogenous ligands of Toll-like receptors Innate Immunity, February 1, 2007; 13(1): 6 - 14. [Abstract] [PDF]
|
|
|
|
|
|
P. Liu, M. Jamaluddin, K. Li, R. P. Garofalo, A. Casola, and A. R. Brasier Retinoic Acid-Inducible Gene I Mediates Early Antiviral Response and Toll-Like Receptor 3 Expression in Respiratory Syncytial Virus-Infected Airway Epithelial Cells J. Virol., February 1, 2007; 81(3): 1401 - 1411. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. H. Lim, S. Kireta, G. R. Russ, and P. T. H. Coates Human plasmacytoid dendritic cells regulate immune responses to Epstein-Barr virus (EBV) infection and delay EBV-related mortality in humanized NOD-SCID mice Blood, February 1, 2007; 109(3): 1043 - 1050. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Zhou and S. Perlman Mouse Hepatitis Virus Does Not Induce Beta Interferon Synthesis and Does Not Inhibit Its Induction by Double-Stranded RNA J. Virol., January 15, 2007; 81(2): 568 - 574. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Niimi, K. Asano, Y. Shiraishi, T. Nakajima, M. Wakaki, J. Kagyo, T. Takihara, Y. Suzuki, K. Fukunaga, T. Shiomi, et al. TLR3-Mediated Synthesis and Release of Eotaxin-1/CCL11 from Human Bronchial Smooth Muscle Cells Stimulated with Double-Stranded RNA J. Immunol., January 1, 2007; 178(1): 489 - 495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sasai, M. Shingai, K. Funami, M. Yoneyama, T. Fujita, M. Matsumoto, and T. Seya NAK-Associated Protein 1 Participates in Both the TLR3 and the Cytoplasmic Pathways in Type I IFN Induction J. Immunol., December 15, 2006; 177(12): 8676 - 8683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Tabiasco, E. Devevre, N. Rufer, B. Salaun, J.-C. Cerottini, D. Speiser, and P. Romero Human Effector CD8+ T Lymphocytes Express TLR3 as a Functional Coreceptor J. Immunol., December 15, 2006; 177(12): 8708 - 8713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Bell, I. Botos, P. R. Hall, J. Askins, J. Shiloach, D. R. Davies, and D. M. Segal The molecular structure of the TLR3 extracellular domain Innate Immunity, December 1, 2006; 12(6): 375 - 378. [Abstract] [PDF]
|
|
|
|
|
|
C. A. Leifer, J. C. Brooks, K. Hoelzer, J. Lopez, M. N. Kennedy, A. Mazzoni, and D. M. Segal Cytoplasmic Targeting Motifs Control Localization of Toll-like Receptor 9 J. Biol. Chem., November 17, 2006; 281(46): 35585 - 35592. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. McBride, K. Hoebe, P. Georgel, and E. Janssen Cell-Associated Double-Stranded RNA Enhances Antitumor Activity through the Production of Type I IFN J. Immunol., November 1, 2006; 177(9): 6122 - 6128. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Sun, C. M. Celluzzi, M. Marovich, H. Subramanian, M. Eller, S. Widjaja, D. Palmer, K. Porter, W. Sun, and T. Burgess CD40 Ligand Enhances Dengue Viral Infection of Dendritic Cells: A Possible Mechanism for T Cell-Mediated Immunopathology J. Immunol., November 1, 2006; 177(9): 6497 - 6503. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Yang, V. Murthy, K. Schultz, J. B. Tatro, K. A. Fitzgerald, and D. Beasley Toll-like receptor 3 signaling evokes a proinflammatory and proliferative phenotype in human vascular smooth muscle cells Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2334 - H2343. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Nakahira, H. P. Kim, X. H. Geng, A. Nakao, X. Wang, N. Murase, P. F. Drain, X. Wang, M. Sasidhar, E. G. Nabel, et al. Carbon monoxide differentially inhibits TLR signaling pathways by regulating ROS-induced trafficking of TLRs to lipid rafts J. Exp. Med., October 2, 2006; 203(10): 2377 - 2389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Samuel and M. S. Diamond Pathogenesis of West Nile Virus Infection: a Balance between Virulence, Innate and Adaptive Immunity, and Viral Evasion J. Virol., October 1, 2006; 80(19): 9349 - 9360. [Full Text] [PDF]
|
|
|
|
|
|
M. A. Rivieccio, H.-S. Suh, Y. Zhao, M.-L. Zhao, K. C. Chin, S. C. Lee, and C. F. Brosnan TLR3 Ligation Activates an Antiviral Response in Human Fetal Astrocytes: A Role for Viperin/cig5 J. Immunol., October 1, 2006; 177(7): 4735 - 4741. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. E. Morris, L. C. Parker, J. R. Ward, E. C. Jones, M. K. B. Whyte, C. E. Brightling, P. Bradding, S. K. Dower, and I. Sabroe Cooperative molecular and cellular networks regulate Toll-like receptor-dependent inflammatory responses FASEB J, October 1, 2006; 20(12): 2153 - 2155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Teige, Y. Liu, and S. Issazadeh-Navikas IFN-beta Inhibits T Cell Activation Capacity of Central Nervous System APCs J. Immunol., September 15, 2006; 177(6): 3542 - 3553. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Buonaguro, M. L. Tornesello, M. Tagliamonte, R. C. Gallo, L. X. Wang, R. Kamin-Lewis, S. Abdelwahab, G. K. Lewis, and F. M. Buonaguro Baculovirus-derived human immunodeficiency virus type 1 virus-like particles activate dendritic cells and induce ex vivo T-cell responses. J. Virol., September 1, 2006; 80(18): 9134 - 9143. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Miggin and L. A. J. O'Neill New insights into the regulation of TLR signaling J. Leukoc. Biol., August 1, 2006; 80(2): 220 - 226. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Tsukuba, S. Yamamoto, M. Yanagawa, K. Okamoto, Y. Okamoto, K. I. Nakayama, T. Kadowaki, and K. Yamamoto Cathepsin e-deficient mice show increased susceptibility to bacterial infection associated with the decreased expression of multiple cell surface toll-like receptors. J. Biochem., July 1, 2006; 140(1): 57 - 66. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Merrell, J. M. Ilvesaro, N. Lehtonen, T. Sorsa, B. Gehrs, E. Rosenthal, D. Chen, B. Shackley, K. W. Harris, and K. S. Selander Toll-Like Receptor 9 Agonists Promote Cellular Invasion by Increasing Matrix Metalloproteinase Activity Mol. Cancer Res., July 1, 2006; 4(7): 437 - 447. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Bell, J. Askins, P. R. Hall, D. R. Davies, and D. M. Segal The dsRNA binding site of human Toll-like receptor 3 PNAS, June 6, 2006; 103(23): 8792 - 8797. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ciencewicki, L. Brighton, W.-D. Wu, M. Madden, and I. Jaspers Diesel exhaust enhances virus- and poly(I:C)-induced Toll-like receptor 3 expression and signaling in respiratory epithelial cells Am J Physiol Lung Cell Mol Physiol, June 1, 2006; 290(6): L1154 - L1163. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Gitlin, W. Barchet, S. Gilfillan, M. Cella, B. Beutler, R. A. Flavell, M. S. Diamond, and M. Colonna Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus PNAS, May 30, 2006; 103(22): 8459 - 8464. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Sun, K. E. Duffy, C. T. Ranjith-Kumar, J. Xiong, R. J. Lamb, J. Santos, H. Masarapu, M. Cunningham, A. Holzenburg, R. T. Sarisky, et al. Structural and Functional Analyses of the Human Toll-like Receptor 3: ROLE OF GLYCOSYLATION J. Biol. Chem., April 21, 2006; 281(16): 11144 - 11151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. L. Fredericksen and M. Gale Jr. West Nile Virus Evades Activation of Interferon Regulatory Factor 3 through RIG-I-Dependent and -Independent Pathways without Antagonizing Host Defense Signaling J. Virol., March 15, 2006; 80(6): 2913 - 2923. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Seya, T. Akazawa, T. Tsujita, and M. Matsumoto Role of Toll-like Receptors in Adjuvant-Augmented Immune Therapies. Evid. Based Complement. Altern. Med., March 1, 2006; 3(1): 31 - 38. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Galdeano and G. Perdigon The Probiotic Bacterium Lactobacillus casei Induces Activation of the Gut Mucosal Immune System through Innate Immunity Clin. Vaccine Immunol., February 1, 2006; 13(2): 219 - 226. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sasai, M. Matsumoto, and T. Seya The Kinase Complex Responsible for IRF-3-Mediated IFN-{beta} Production in Myeloid Dendritic Cells (mDC) J. Biochem., February 1, 2006; 139(2): 171 - 175. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wornle, H. Schmid, B. Banas, M. Merkle, A. Henger, M. Roeder, S. Blattner, E. Bock, M. Kretzler, H.-J. Grone, et al. Novel Role of Toll-Like Receptor 3 in Hepatitis C-Associated Glomerulonephritis Am. J. Pathol., February 1, 2006; 168(2): 370 - 385. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Wesch, S. Beetz, H.-H. Oberg, M. Marget, K. Krengel, and D. Kabelitz Direct Costimulatory Effect of TLR3 Ligand Poly(I:C) on Human {gamma}{delta} T Lymphocytes J. Immunol., February 1, 2006; 176(3): 1348 - 1354. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Groskreutz, M. M. Monick, L. S. Powers, T. O. Yarovinsky, D. C. Look, and G. W. Hunninghake Respiratory Syncytial Virus Induces TLR3 Protein and Protein Kinase R, Leading to Increased Double-Stranded RNA Responsiveness in Airway Epithelial Cells J. Immunol., February 1, 2006; 176(3): 1733 - 1740. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Rudd, J. J. Smit, R. A. Flavell, L. Alexopoulou, M. A. Schaller, A. Gruber, A. A. Berlin, and N. W. Lukacs Deletion of TLR3 Alters the Pulmonary Immune Environment and Mucus Production during Respiratory Syncytial Virus Infection J. Immunol., February 1, 2006; 176(3): 1937 - 1942. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. K. Crellin, R. V. Garcia, O. Hadisfar, S. E. Allan, T. S. Steiner, and M. K. Levings Human CD4+ T Cells Express TLR5 and Its Ligand Flagellin Enhances the Suppressive Capacity and Expression of FOXP3 in CD4+CD25+ T Regulatory Cells J. Immunol., December 15, 2005; 175(12): 8051 - 8059. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yasutomi, Y. Ohshima, N. Omata, A. Yamada, H. Iwasaki, Y. Urasaki, and M. Mayumi Erythromycin Differentially Inhibits Lipopolysaccharide- or Poly(I:C)-Induced but Not Peptidoglycan-Induced Activation of Human Monocyte-Derived Dendritic Cells J. Immunol., December 15, 2005; 175(12): 8069 - 8076. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Seya, K. Funami, M. Taniguchi, and M. Matsumoto Antibodies against human Toll-like receptors (TLRs): TLR distribution and localization in human dendritic cells Innate Immunity, December 1, 2005; 11(6): 369 - 374. [Abstract] [PDF]
|
|
|
|
|
|
C. F. Narvaez, J. Angel, and M. A. Franco Interaction of Rotavirus with Human Myeloid Dendritic Cells J. Virol., December 1, 2005; 79(23): 14526 - 14535. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. de Bouteiller, E. Merck, U. A. Hasan, S. Hubac, B. Benguigui, G. Trinchieri, E. E. M. Bates, and C. Caux Recognition of Double-stranded RNA by Human Toll-like Receptor 3 and Downstream Receptor Signaling Requires Multimerization and an Acidic pH J. Biol. Chem., November 18, 2005; 280(46): 38133 - 38145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nishiya, E. Kajita, S. Miwa, and A. L. DeFranco TLR3 and TLR7 Are Targeted to the Same Intracellular Compartments by Distinct Regulatory Elements J. Biol. Chem., November 4, 2005; 280(44): 37107 - 37117. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. A. Derbigny, M. S. Kerr, and R. M. Johnson Pattern Recognition Molecules Activated by Chlamydia muridarum Infection of Cloned Murine Oviduct Epithelial Cell Lines J. Immunol., November 1, 2005; 175(9): 6065 - 6075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Prehaud, F. Megret, M. Lafage, and M. Lafon Virus Infection Switches TLR-3-Positive Human Neurons To Become Strong Producers of Beta Interferon J. Virol., October 15, 2005; 79(20): 12893 - 12904. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Sanghavi and T. A. Reinhart Increased Expression of TLR3 in Lymph Nodes during Simian Immunodeficiency Virus Infection: Implications for Inflammation and Immunodeficiency J. Immunol., October 15, 2005; 175(8): 5314 - 5323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Jack, N. Arbour, J. Manusow, V. Montgrain, M. Blain, E. McCrea, A. Shapiro, and J. P. Antel TLR Signaling Tailors Innate Immune Responses in Human Microglia and Astrocytes J. Immunol., October 1, 2005; 175(7): 4320 - 4330. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Bell, I. Botos, P. R. Hall, J. Askins, J. Shiloach, D. M. Segal, and D. R. Davies The molecular structure of the Toll-like receptor 3 ligand-binding domain PNAS, August 2, 2005; 102(31): 10976 - 10980. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Pal, C. S. Kaetzel, K. Brundage, C. A. Cunningham, and C. F. Cuff Regulation of polymeric immunoglobulin receptor expression by reovirus J. Gen. Virol., August 1, 2005; 86(8): 2347 - 2357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Orinska, E. Bulanova, V. Budagian, M. Metz, M. Maurer, and S. Bulfone-Paus TLR3-induced activation of mast cells modulates CD8+ T-cell recruitment Blood, August 1, 2005; 106(3): 978 - 987. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Choe, M. S. Kelker, and I. A. Wilson Crystal Structure of Human Toll-Like Receptor 3 (TLR3) Ectodomain Science, July 22, 2005; 309(5734): 581 - 585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. C. Parker, M. K. B. Whyte, S. K. Dower, and I. Sabroe The expression and roles of Toll-like receptors in the biology of the human neutrophil J. Leukoc. Biol., June 1, 2005; 77(6): 886 - 892. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yasuda, P. Yu, C. J. Kirschning, B. Schlatter, F. Schmitz, A. Heit, S. Bauer, H. Hochrein, and H. Wagner Endosomal Translocation of Vertebrate DNA Activates Dendritic Cells via TLR9-Dependent and -Independent Pathways J. Immunol., May 15, 2005; 174(10): 6129 - 6136. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Vijay-Kumar, J. R. Gentsch, W. J. Kaiser, N. Borregaard, M. K. Offermann, A. S. Neish, and A. T. Gewirtz Protein Kinase R Mediates Intestinal Epithelial Gene Remodeling in Response to Double-Stranded RNA and Live Rotavirus J. Immunol., May 15, 2005; 174(10): 6322 - 6331. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Li, Z. Chen, N. Kato, M. Gale Jr., and S. M. Lemon Distinct Poly(I-C) and Virus-activated Signaling Pathways Leading to Interferon-{beta} Production in Hepatocytes J. Biol. Chem., April 29, 2005; 280(17): 16739 - 16747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Tissari, J. Siren, S. Meri, I. Julkunen, and S. Matikainen IFN-{alpha} Enhances TLR3-Mediated Antiviral Cytokine Expression in Human Endothelial and Epithelial Cells by Up-Regulating TLR3 Expression J. Immunol., April 1, 2005; 174(7): 4289 - 4294. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Rudd, E. Burstein, C. S. Duckett, X. Li, and N. W. Lukacs Differential Role for TLR3 in Respiratory Syncytial Virus-Induced Chemokine Expression J. Virol., March 15, 2005; 79(6): 3350 - 3357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Decker, H. Singh-Jasuja, S. Haager, I. Kotter, and H.-G. Rammensee Nucleosome, the Main Autoantigen in Systemic Lupus Erythematosus, Induces Direct Dendritic Cell Activation via a MyD88-Independent Pathway: Consequences on Inflammation J. Immunol., March 15, 2005; 174(6): 3326 - 3334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Guillot, R. Le Goffic, S. Bloch, N. Escriou, S. Akira, M. Chignard, and M. Si-Tahar Involvement of Toll-like Receptor 3 in the Immune Response of Lung Epithelial Cells to Double-stranded RNA and Influenza A Virus J. Biol. Chem., February 18, 2005; 280(7): 5571 - 5580. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
