The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mielenz, D.
Right arrow Articles by Jäck, H.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mielenz, D.
Right arrow Articles by Jäck, H.-M.
The Journal of Immunology, 2003, 171: 3091-3101.
Copyright © 2003 by The American Association of Immunologists

Immunoglobulin µ Heavy Chains Do Not Mediate Tyrosine Phosphorylation of Ig{alpha} from the ER-cis-Golgi 1

Dirk Mielenz, Anja Ruschel, Christian Vettermann and Hans-Martin Jäck2

Division of Molecular Immunology, Department of Internal Medicine III, Nikolaus-Fiebiger Center, University of Erlangen-Nürnberg, Erlangen, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Signals delivered by Ig receptors guide the development of functional B lymphocytes. For example, clonal expansion of early µ heavy chain (µHC)-positive pre-B cells requires the assembly of a signal-competent pre-B cell receptor complex (pre-BCR) consisting of a µHC, a surrogate L chain, and the signal dimer Ig{alpha}{beta}. However, only a small fraction of the pre-BCR is transported to the cell surface, suggesting that pre-BCR signaling initiates already from an intracellular compartment, e.g., the endoplasmic reticulum (ER). The finding that differentiation of pre-B cells and allelic exclusion at the IgH locus take place in surrogate L chain-deficient mice further supports the presence of a µHC-mediated intracellular signal pathway. To determine whether a signal-competent Ig complex can already be assembled in the ER, we analyzed the consequence of pervanadate on tyrosine phosphorylation of Ig{alpha} in J558L plasmacytoma and 38B9 pre-B cells transfected with either a transport-competent IgL chain-pairing or an ER-retained nonpairing µHC. Flow cytometry, combined Western blot-immunoprecipitation-kinase assays, and confocal microscopy revealed that both the nonpairing and pairing µHC assembled with the Ig{alpha}{beta} dimer; however, in contrast to a pairing µHC, the nonpairing µHC was retained in the ER-cis-Golgi compartment, and neither colocalized with the src kinase lyn nor induced tyrosine phosphorylation of Ig{alpha} after pervanadate treatment of cells. On the basis of these findings, we propose that a signal-competent Ig complex consisting of µHC, Ig{alpha}{beta}, and associated kinases is assembled in a post-ER compartment, thereby supporting the idea that a pre-BCR must be transported to the cell surface to initiate pre-BCR signaling.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The assembly of millions of V region exons from a pool of multiple V, D, and J gene segments is the molecular hallmark of B lymphocyte maturation and forms the basis for a large primary Ab repertoire in mice and humans (reviewed in refs. 1, 2, 3, 4). This process begins in early pro-B cells at the IgH locus and finishes in late pre-B cells at the Ig L chain locus. In general, a mature B cell presents only one kind of Ag receptor on the surface, a phenomenon called allelic exclusion (for review, see Ref. 5). Because V(D)J rearrangement is not always precise, maturing B lymphoid cells must be screened for the presence of functional Ig chains and one kind of surface Ig receptor at developmental checkpoints.

An early checkpoint has been identified at the transition from the late pro-B to the early pre-B cell stage, at which B-lineage cells are screened for the presence of a functional membrane-bound H-chain of IgM (µHC),3 i.e., one capable of forming a signal-competent Ig-like integral membrane complex, the so-called pre-B cell receptor (pre-BCR). A pre-BCR consists of a pair of µHC, a pair of surrogate light (SL) chains, which is composed of the polypeptides VpreB and {lambda}5, and the two signal-transducing subunits, Ig{alpha} and Ig{beta} (6, 7, 8, 9, 10). Pre-BCR-positive late pro-B cells develop into large, cycling pre-B cells and later into small, resting pre-B cells, in which rearrangement at the IgL locus begins (11). In contrast, pro-B cells with two nonproductively rearranged IgH genes as well as pro-B cells synthesizing dysfunctional µHCs (i.e., µHCs that cannot pair with SL and conventional L chains; Refs. 12 and 13) are blocked at the late pro-B cell stage. This quality control assures that only those pre-B cells with a functional µHC, i.e., one that is able to pair with a conventional IgL chain, clonally expand and reach the pool of small pre-B cells (12, 13). Several experiments support the hypothesis that pre-BCR signals are critical to initiate the proliferative expansion of pre-BCR-positive pre-B cells. For example, elevated numbers of pro-B cells, but no or only a few pre-B cells can be detected in the bone marrow of mice carrying homozygous deletions of genes encoding pre-BCR components such as VpreB and {lambda}5 (14, 15), Ig{alpha} (16), Ig{beta} (17), and µHCs (18, 19). Moreover, the frequency of cycling cells is increased in the pre-BCR-positive cell fraction (20). Most importantly, the induction of pre-BCR synthesis in pro-B cells, in which the expression of a µHC can be controlled via the tetracycline-inducible system, provides growth signals in pre-B cells in a stromal cell-dependent manner (21). Because most of the pre-BCR is retained in the ER of freshly isolated pre-B cells and only a small fraction (~2%) can be detected on the cell surface of pre-B cells and pre-B cell lines (21, 22, 23), it is still controversial whether the pre-BCR initiates signals already from an intracellular compartment, e.g., the endoplasmic reticulum (ER), or acquires signal competence after it has reached the cell surface (discussed in Ref. 24). The findings that a soluble recombinant pre-BCR molecule specifically interacts with stromal cells (25, 26) and that cross-linking of the pre-BCR in human pre-B cell lines stimulates protein tyrosine phosphorylation and calcium influx (27) support a ligand-dependent initiation of pre-BCR signals from the cell surface.

However, the synthesis of a complete surface pre-BCR is not an absolute requirement for pro-B cells to differentiate into mature B cells, because a delayed appearance of allelically excluded mature IgM-positive B cells is observed in peripheral lymphatic organs of mice with homozygous deletions of either {lambda}5, VpreB, or both {lambda}5 and VpreB (14, 15, 28). Therefore, signals participating in the control of allelic exclusion at the IgH locus are still delivered in the absence of a SL chain. Thus, one could speculate that an incomplete pre-BCR complex consisting of a µHC and Ig{alpha}{beta} initiates signals already from an intracellular compartment, thereby leading only to early pre-B cell differentiation and allelic exclusion at the IgH locus, but not to clonal expansion of µHC-positive pre-B cells. Because a µHC should be trapped in the ER-cis-Golgi in the absence of SL or IgL chain pairing, one could speculate that µHC-initiated signals that control allelic exclusion are delivered from the ER in either an Ig{alpha}{beta}-dependent or -independent manner. Ig{alpha}{beta}-dependent µHC-initiated signaling could, in principal, be possible form the ER, because µHCs associate with Ig{alpha}{beta} in the absence of {lambda}5 (29).

To address the question whether a µHC assembles into a BCR-like signal-competent complex already in the ER, we used the J558L-pervanadate culture system developed by Wienands et al. (30, 31). These authors found that incubation of surface IgM-positive J558L plasmacytoma cells with the phosphotyrosine phosphatase (PTP) inhibitor pervanadate (H2O2-vanadate) led to a tyrosine phosphorylation pattern similar to that observed after cross-linking surface IgM with anti-µHC Abs. This system further allows activation of preformed BCR and pre-BCR complexes without the need of using cross-linking anti-Ig Abs. When we analyzed the effect of pervanadate stimulation on tyrosine phosphorylation in J558L plasmacytoma cells and Abelson murine leukemia virus (AMuLV)-transformed 38B9 pre-B cells (32), both of which express either an IgL chain-pairing (i.e., a functional) or a nonpairing (i.e., a dysfunctional, ER-trapped) µHC, we found an increase in Ig{alpha} tyrosine phosphorylation only in cells that express a functional µHC on the cell surface. Hence, an ER-trapped, IgL chain-nonpairing µHC does not assemble into an signal-competent Ig complex, thereby supporting the idea that a pre-BCR must be transported to the cell surface to intiate pre-BCR signaling.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemicals

All chemicals were purchased from Sigma (Deisenhofen, Germany) or Roth (Karlsruhe, Germany) unless stated otherwise, cell culture medium and medium supplements were from Life Technologies (Eggenstein, Germany), and restriction enzymes were from New England Biolabs (Beverly, MA).

Cell lines, expression vectors, transfections, and retroviral transduction

All cell lines were grown in complete RMPI (RPMI 1640 containing 2 mM L-glutamine, 1 mM sodium pyruvate, 50 mM 2-ME, 10% FBS, 50 U/ml penicillin, and 50 µg/ml streptomycin) with 5% CO2. The plasmacytoma line J558L (30) stably transfected with Ig{alpha} (31) was a kind gift of Drs. M. Reth and J. Wienands. J558L-Ig{alpha} cells were transfected with µHC-encoding expression vectors pµgpt and pµ81X(F)gpt by electroporation (12), and stable transfectants were selected in complete RPMI supplemented with mycophenolic acid (1.25 µg/ml), xanthine (250 µg/ml), and hygromycin B (250 µg/ml). Single-cell clones were obtained by the limiting dilution method. The mammalian expression vector pµgpt encoding a functional µHC was described previously (33). pµ81X(F)gpt encoding a dysfunctional µHC was constructed by replacing the 7.5-kB SalI-XmaI fragment of pµgpt with the corresponding 10.4-kB SalI-XmaI-fragment from p81X(F)neo containing the IgH promoter, a rearranged VH81X segment and the intronic IgH enhancer region (34). The SL chain-positive, µHC-negative AMuLV-transformed pre-B line, 38B9 (32, 35), was transduced with retroviral vectors encoding either a SL chain-pairing (pELV81BC2-Cµ) or a nonpairing pELV81F-Cµ VH81X-bearing µHC. Stable cultures were selected, and single cell clones were established by limiting dilution. To create pELV81BC2-Cµ, pELV-C (Ref. 35 ; provided by Dr. F. Melchers, Basel, Switzerland) was linearized with EcoRI, blunt-ended, and religated. The SalI-HindIII VHDJH fragment in pELV-Cµ{Delta}Eco was then replaced with a corresponding SalI-HindIII fragment from a genomic clone harboring the the functional VH81XDJH1 rearrangement of the VH81X-IgM-producing hybridoma BC2 (Ref. 36); a gift of Dr. J. Kearney, Birmingham, AL). To generate pELV81F-Cµ, the EcoRI-HindIII fragment in pELV81BC2-Cµ was replaced by a corresponding VH81X fragment that was amplified from the cloned VH81XDJH rearrangement of the 18-81 subclone F, an A-MuLV pre-B cell line (13, 32), by PCR, using the forward primer GAATTCCCTTCCCATGACATGTCTTG (containing an EcoR1 site present in framework 2 of all VH81X sequences), and the backward primer GAAGCTTTGACTCTCTGAGGAGACGGTGACTGAGGTTCCTTG (containing HindIII, Cµ, and JH4 sequences). To generate viral particles, the ecotropic packaging cell line gp-e was transfected with the corresponding retroviral vectors and used to infect 38B9 cells using standard protocols (37).

Commercial Abs

Affinity-purified goat Abs against mouse {lambda}LC and µHC were purchased from Southern Biotechnology (Birmingham, AL), MOPC21 (IgG1,{kappa}) and anti-phosphotyrosine Abs coupled to agarose (clone PT66) from Sigma. Anti-phosphotyrosine mAb 2C8 and PY99 (both IgG1,{kappa}) were obtained from Nanotools (Teningen, Germany) and Santa Cruz Biotechnology (Santa Cruz, CA), respectively; anti-membrin (38) and anti-syntaxin 6 mAb (39) from Stressgen (Victoria, BC, Canada); polyclonal rabbit IgG Abs against lyn and syk from Santa Cruz Biotechnology; and normal rabbit serum from Pineda (Berlin, Germany). Affinity-purified and peroxidase-conjugated goat Abs against mouse Fc{gamma} and Cy3-conjugated donkey F(ab)2 fragments to rabbit IgG were obtained from Jackson ImmunoResearch Laboratories (distributed by Dianova, Hamburg, Germany) and peroxidase-conjugated goat Abs against rabbit IgG were from Bio-Rad (Hercules, CA).

Noncommercial Abs

Rat mAb against mouse Ig{alpha} (clone 79A3) was a gift from Dr. P. Cheng (40). Purified anti-Ig{beta} mAb T04 (41) was a gift of Dr. M. Reth. Monoclonal mouse IgG1,{kappa} Abs (clone 24C2.5) against the intracellular tail of mouse Ig{alpha} were produced by fusing SP2/0 myeloma cells with spleen cells from mice immunized with purified, recombinant GST fused to the cytoplasmic domain of murine Ig{alpha} {alpha} (aa 160–222). The bacterial expression vector encoding the GST-Ig{alpha} fusion protein was created as follows. First, the sequence encoding the cytoplasmic domain of mouse Ig{alpha} was amplified by PCR from a murine Ig{alpha} cDNA cloned into pUC19 (Ref. 42 ; a gift of Dr. M. Reth) with a 5'- (5'-GTC AGG ATC CAG GAA ACG GTG GCA AAA TGA G-3') and a 3'-Ig{alpha} primer (5'-CAG TGA ATT CTC ATT CCT GGC CTG GAT GC-3'). The PCR product was digested with BamHI and EcoR1 and cloned into pGEX2T (Amersham Pharmacia Biotech, Little Chalfont, U.K.). GST-Ig{alpha} was expressed in Escherichia coli BL21 and purified on immobilized glutathione according to the manufacturer’s instructions (Amersham Pharmacia Biotech). Hybridoma cells were selected in hypoxanthine-aminopterin-thymidine medium according to the Köhler-Milstein technique; culture medium was assayed for Abs against Ig{alpha} by ELISA and Western blotting. Ab purification was performed with standard procedures on protein G-Sepharose columns (Pierce, Rockford, IL).

Pervanadate stimulation of cells

Transfected and untransfected cells were washed, resuspended at a density of 5 x 106/ml in complete serum-free RPMI 1640, and starved at 37°C for at least 1 h. Initially, stimulation was performed for 3 min in 17- x 120-mm polypropylene tubes as described previously (31) with 50 µM sodium vanadate and 70 mM H2O2. Later experiments were performed for 3 min or as indicated with final concentrations of 100 µM sodium vanadate and 350 µM H2O2. Stimulation was terminated by the addition of 10 ml ice-cold PBS (137 mM NaCl, 2,7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4). Cells were collected by centrifugation for 2 min at 280 x g at 4°C, lysed, and analyzed by immunoblotting.

Cell lysis and SDS-PAGE

Cells (107/ml lysis buffer) were lysed on ice for 10 min with 1) RIPA buffer (150 mM NaCl, 1% Triton X-100, 0,1% SDS, 0,25% sodium deoxycholate, 1 mM sodium vanadate, 50 mM sodium fluoride, 1 mM PMSF, 5 mM EDTA, 25 mM Tris-HCl (pH 7.5)), 2) TNP buffer (35 mM NaH2PO4, 50 mM {beta}-glycerophosphate, 50 mM sodium pyrophosphate, 50 mM NaF, 150 mM NaCl, 1% Triton X-100, 1 mM sodium vanadate, 1 mM PMSF, 5 mM EDTA (pH 7.5)), 3) digitonin buffer (150 mM NaCl, 0.4–1% digitonin from Sigma or Roche, 1 mM sodium vanadate, 50 mM NaF, 1 mM PMSF, 5 mM EDTA, 25 mM Tris-HCl (pH 7.5)), or 4) NET buffer (same as digitonin buffer except that digitonin was replaced by 0.5% Nonidet P-40). Solubilized cells were cleared by centrifugation at 10,000 x g for 10 min, and supernatants (lysates) were analyzed. Pelleted material was vortexed once in lysis buffer and solubilized in SDS sample buffer (62.5 mM Tris-HCl (pH 6.8), 2% SDS, 50 mM DTT or 1% 2-ME, 10% glycerol, 0.002% bromphenol blue (43)) supplemented with 2 M urea for 30 min at 60°C and boiling for 5 min. The volume was twice the volume used for lysis of cells. SDS-PAGE was performed according to the method of Laemmli et al. (43). For electrophoretic SDS PAGE analysis of insoluble cell material, 2 M urea was included in the gel and all samples. Broad range m.w. standards were from Bio-Rad.

Western blot analysis

Electrophoretically separated proteins were transferred to nitrocellulose (0.2 µm; Schleicher & Schuell, Dassel, Germany) in 25 mM Tris, 192 mM glycine, 20% methanol (44) at 4°C. Membranes were blocked with 5% nonfat milk powder in TBST (25 mM Tris-HCl, 150 mM NaCl, 0,1% Tween 20 (pH 7.5)). Primary and secondary Abs were diluted in blocking solution. Blots were washed for 4 x 10 min in TBST and once in H2O and developed with an ECL kit. Membranes were stripped of bound Abs by incubation with 0.1 M glycine (pH 2.5), 0.5 M NaCl, 0.1% Tween 20, 1% 2-ME, 0.1% NaN3 for 2 x 10 min; washed extensively with TBST; and blocked again.

Immunoprecipitation, lyn kinase assay, and endoglycosidase H (endo H) digest

Immunoprecipitation. Appropriate Abs (5–10 µg/mg of lysate protein) were added to cell lysates, the mixture was rotated for 1 h at 4°C, and 20–50 µl of equilibrated protein A- or G-Sepharose (Pierce) were added and incubated for an additional hour. Immune complexes were collected by short pulse centrifugation, washed three times in lysis buffer, and boiled in 2 x SDS sample buffer. Tyrosine-phosphorylated proteins were immunoprecipitated with PT66-agarose and eluted with 10 mM phosphotyrosine in TNP buffer.

Lyn immune complex kinase assay. Cells were lysed in buffers as indicated in figure legends and lyn was immunoprecipitated. Lyn precipitate was washed three times with lysis buffer, once with PBS and once with PBS containing 10 mM MgCl2. Reactions were started by addition of 30 µl of 10 mM MgCl2, 20 µM ATP, 1 mM DTT, 120 mM NaCl, 74,000 Bq [{gamma}-32P]ATP (specific activity, >5,000 mCi/mmol; Amersham Pharmacia Biotech) and recombinant GST-Ig{alpha} (60 µM) and stopped after 15 min at 30°C by the addition of boiling SDS sample buffer. Gels were then stained with Coomassie Brilliant Blue, destained, and dried. Bands of interest were visualized by autoradiography and then cut out and analyzed by liquid scintillation counting. The Km of immunoprecipitated lyn for GST-Ig{alpha} was 38 µM.

Endo H digest. Immunoprecipitated µHCs were incubated with 100 µl of 0.5% SDS, 100 µg/ml BSA, 50 mM {alpha}-DTT, 10 mM Na2HPO4, 5 mM citric acid (pH 5.0) for 10 min at 95°C. Samples were collected by centrifugation and cooled on ice. The supernatant was divided in two halves, one of which was digested with 1 mU of endo H (Boehringer-Mannheim, Mannheim, Germany) for 2 h at 37°C.

Flow cytometry and confocal microscopy

Flow cytometric analysis was essentially performed as described previously (33). Briefly, for membrane staining, 2–5 x 105 cells were resuspended in PBS supplemented with 2% FBS, 0.1% NaN3 (FACS-PBS) for 10 min on ice, incubated with the appropriate Abs diluted in FACS-PBS for 20 min on ice, and washed twice with FACS-PBS. For cytoplasmic staining, cells were fixed in 4% paraformaldehyde in PBS, washed with PBS, and permeabilized with 0,1% Tween 20 at 37°C for 10 min. Cells were then stained as described above. Fluorescence analysis was performed with a Coulter flow cytometer (Fullerton, CA). For confocal microscopy, cells were washed in serum-free RPMI 1640, seeded on Teflon-coated, eight-well multitest slides (ICN, Aurora, OH) for 1 h at 37°C in 5% CO2, and stimulated by the addition of pervanadate to the medium. Cells were fixed in ice-cold 4% paraformaldehyde in PBS for 10 min, washed once with 100 mM glycine in PBS, permeabilized with 0.1% Triton X-100 in PBS for 5 min, and blocked with 3% BSA in PBS. Abs were diluted in 3% BSA in PBS and applied for 30 min at room temperature. Slides were washed for 3 x 5 min in PBS after each application, mounted in Moviol (Hoechst, Frankfurt, Germany), and examined with a Leica DMR confocal microscope (Leica, Deerfield, IL), software version 2.00.

Statistical analysis

Data were analyzed with a two-tailed Student t test. Values of p < 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To determine whether a membrane-anchored µHC can initiate BCR signals from an intracellular compartment, e.g., the ER-cis-Golgi, we first transfected µHC-negative murine J558L plasmacytoma cells with vectors encoding the membrane form of an IgL-pairing (i.e., functional) and a nonpairing (i.e., dysfunctional) µHC and analyzed the effect of the respective µHC on tyrosine phosphorylation of the signal transducer Ig{alpha}. As a dysfunctional µHC, we chose a µHC bearing a particular VH81X region. Because this VH81X-µHC does not pair with SL chain (34) and several {kappa}LCs (13), it should also not associate with {lambda}LC of J558L cells and, therefore, be retained in the ER-cis-Golgi via the chaperone IgH binding protein (BiP) (45). To assess the signaling capability of a µHC independent of its intracellular location, we used the J558L-pervandate in vitro model established by Wienands et al. (31, 46). The authors observed in this system that pervanadate treatment of J558L cells expressing a surface IgM receptor induces BCR signals similar to that observed after BCR cross-linking (31). Incubation of live cells with pervanadate (= H2O2-vanadate) inhibits protein tyrosine phosphatases (PTPs), which leads to a shift in the equilibrium of tyrosine phosphorylation and dephosphorylation in favor of tyrosine phosphorylation. The authors speculated from these findings that a BCR once it has reached the cell surface assembles a complex consisting of PTPs and protein tyrosine kinases and that this preformed complex can be activated in a surface IgM-dependent manner in J558L cells by pervanadate. If an ER-retained µHC assembles into a signal complex similar to that of a surface BCR complex, we would predict that the activation of an ER-trapped µHC by pervanadate induces tyrosine phosphorylation of the ITAM motifs of Ig{alpha}{beta}, the first downstream effects after BCR and pre-BCR signals have been initiated (Ref. 47 ; for review see Ref. 48).

Generation of J558L clones producing functional and dysfunctional µHC

We first established stable µHC-producing J558L lines by transfecting µHC-negative J558L-Ig{alpha} cells synthesizing {lambda}LC and Ig{alpha}{beta} (23) with either the pµgpt or the pV81XFµgpt vector encoding the membrane form of a functional (µfct) and a dysfunctional (µdys) µHC, respectively. Stable transfectants were selected, and single-cell clones were isolated by the limiting dilution method. Flow cytometric analysis with FITC-conjugated anti-µHC Abs detected comparable intracellular µHC levels in transfected J558L-Ig{alpha} clones producing the dysfunctional (µdys clone 5P) and the functional (µfct clone 10) µHC (Fig. 1A, cytoplasmic staining profiles). To determine whether the transfected µHCs pair with the endogenous {lambda}LC, we examined the presence of {lambda}LC in anti-µHC precipitates from lysates of J558L-µfct and J558L-µdys clones by Western blot analysis (Fig. 1B). Although the presence of µHC could be detected with anti-µHC abs in all precipitates (Fig. 2B, upper blot), strong signals for {lambda}LC were visible in J588L-µfct but not in J558L-µdys cells (Fig. 2B, lower blot), indicating that the dysfunctional µHC inefficiently associates with {lambda}LC. Thus, the µdysHC should be retained by BiP within the ER-cis-Golgi. As expected, surface µHC staining was detected only in a transfected J558L clone producing the functional but not in a clone producing the dysfunctional µHC (Fig. 1A, membrane staining). Similar results (data not shown) were obtained with two other J558L-µdys clones (3D and 5T) and one J588L-µfct clone (5.85).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 1. Analyses of Ig{alpha} and Ig chains in wild-type and µHC-transfected J558L cells. A, Flow cytometric analysis of µHC. Untransfected J558L cells (gray histograms) and J558L-Ig{alpha} cells transfected (open histograms) with the membrane form of either a dysfunctional (µdys, clone 5P) or a functional µHC (µfct, clone 10) were stained with FITC-conjugated goat Abs against µHC either after (cytoplasmic) or before (surface) detergent permeabilization of the cells and analyzed in a FACS. Similar results were obtained with the other µHC transfectants. Fluorescence intensities (FI) are shown in a logarithmic scale on the x-axis. B, Association of µHC with {lambda}LC. µHCs were immunoprecipitated (IP) from NET lysates (i.e., postnuclear supernatant of centrifuged NET cell lysates) of J558L-µfct (clone 10, lane 1 and clone 5.85, lane 2) and of J558L-µdys cells (clone 5P, lane 3 and clone 5T, lane 4), separated by SDS-PAGE, and transferred to nitrocellulose. µHCs and {lambda}LC were detected with HRP-conjugated goat Abs against µHC and {lambda}LC, respectively, and the ECL technique. Positions of molecular mass standard proteins in kilodaltons are indicated on the left. C, Flow cytometric analysis of Ig{alpha}. Untransfected J558L cells (a), J558L cells transfected with Ig{alpha} (J558L-Ig{alpha}; b), and J558L-Ig{alpha} cells transfected with the membrane form of either a dysfunctional (µdys clone 5P; c) or a functional µHC (µfct clone 10; d) were fixed, permeabilized, and stained with the mAb 24C2 specific for Ig{alpha} followed by FITC-conjugated, Fc{gamma}-specific secondary Abs and analyzed by FACS. Fluorescence intensities are shown in a logarithmic scale on the x-axis. D, Western blot analysis of Ig{alpha}. Lysates in 1/3 dilutions starting with 5 x 105 wild-type (J558L) and Ig{alpha}-transfected J558L cells (J558L-Ig{alpha}) were separated by SDS-PAGE and analyzed by Western blotting with anti-Ig{alpha} mAb 24C.5 (upper blots) and rabbit anti-actin Abs (lower blots). Positions of molecular mass standard proteins in kilodaltons, Ig{alpha}, and actin are indicated.

 


View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 2. Maturation analysis of functional and dysfunctional µHCs in transfected J558L-Ig{alpha} cells. A, Glycosylation analysis. Anti-µHC precipitates from NET lysis buffer (Mock), from the lysates of 5 x 106 J558L-µfctfct clone 10 in lanes 7 and 8) and J558L-µdys cells (µdys clones 3D in lanes 3 and 4, 5P in lanes 5 and 6, and 5T in lanes 9 and 10), and from 500 µl of NET lysis buffer supplemented with 500 ng of purified IgM/{kappa} from the mouse myeloma TEPC183 were incubated at 37°C with (+) or without (-) endo H, separated by 6% SDS-PAGE, and transferred to nitrocellulose. µHCs were detected with HRP-conjugated goat anti-µHC Abs and ECL. All samples were run on the same gel, but lanes 11 and 12 were developed for only ~10 s. Positions of molecular mass standard proteins in kilodaltons as well as glycosylated (glyc.), mature glycosylated, and nonglycosylated µHCs are indicated. B, Association of µHC with BiP. µHCs were immunoprecipitated with goat anti-µHC Abs from NET lysates of J558L-µfct (clone 10, lane 1) and J558L-µdys cells (clones 3D, 5P, and 5T in lanes 2–4). Immunoprecipitates were separated by SDS-PAGE and analyzed by immunoblotting for the presence of µHCs and BiP as described in Fig. 1A. Positions of molecular mass standard proteins are indicated in kilodaltons on the left. C, Subcellular localization of µHC. J558L-µdys cells (clone 5P) were fixed to coverslips, permeabilized, double-stained with FITC-conjugated anti-µHC Abs and either anti-membrin (µHC/membrin), anti-syntaxin 6 (µHC/syntaxin), or isotype-matched MOPC21 control Abs (µHC/isotypes); and analyzed by confocal microscopy. Bar, 10 µm.

 
Flow cytometric analyses with a monoclonal mouse Ab raised in our laboratory against the cytoplasmic domain of mouse Ig{alpha} (clone 24C2.5) revealed comparable levels of cytoplasmic Ig{alpha} in J558L-Ig{alpha} cells (Fig. 1C) as well as in J558L-Ig{alpha} clones transfected with the dysfunctional (µdys clone 5P) or the functional µHC gene (µfct clone 10). As expected, wild-type J558L cells did not stain with the mAb against mouse Ig{alpha} (Fig. 1C). Western blot analysis of total cell lysates from wild-type J558L and J558L-Ig{alpha} cells verified the specificity of the anti-Ig{alpha} mAb 24C2.5. (Fig. 1D); i.e., specific Ig{alpha} signals could be detected only in J558L-Ig{alpha} cells but not in wild-type J558L cells.

Cytoplasmic localization of functional and dysfunctional µHCs

µHCs as well as IgL and SL chains are translated on membrane-bound polysomes and translocated though the ER membrane. Immediately after entry into the ER lumen, the newly synthesized N termini of µHC, L, and SL chain bind to the ER-resident chaperone BiP and associate cotranslationally with each other to form either a pre-BCR (µHC-SL chain) or a BCR (µHC-L chain) (45). In addition, N-linked sugars of the high mannose type are added to µHCs in the ER. After Ig receptor complexes have reached the trans-Golgi, N-linked sugars of the high mannose type are removed and replaced by complex sugar forms (49). Thus, if a µdysHC is retained in the ER, it should remain associated with BiP and retain N-linked sugars of the high mannose type. To determine the glycosylation status of Ig chains, µHCs were immunoprecipitated from lysates of µHC-transfected J558L clones and digested with the endo H. Endo H removes only high mannose N-linked sugars added in the ER, whereas sugar moieties added in the trans-Golgi are resistant to endo H digestion. Therefore, a µHC retained in the ER should have a higher mobility after endo H treatment than a µHC that has been modified in the trans-Golgi. Western blot analysis revealed that the dysfunctional µHC in all examined J558L clones is entirely sensitive to endo H digestion (Fig. 2A, lanes 3–6, 9, and 10), whereas the functional µHC (Fig. 2A, lanes 7 and 8) is partially and a µHC of secreted IgM (TEPC183; Fig. 2A, lanes 11 and 12) is completely resistant to endo H digestion. Thus, the sugar moieties of the dysfunctional µHC are of the high mannose type and are not being modified in the trans-Golgi, suggesting that the dysfunctional µHC is indeed retained in the ER.

The ER retention of the dysfunctional µHC was further substantiated by the finding that the ER-resident chaperone BiP could be detected only by immunoblotting in anti-µHC precipitates from J558L clones producing the dysfunctional µHC (Fig. 2B, lanes 2–4), but not from clones producing the functional µHC (Fig. 2B, lane 1). BiP reaches the cis-Golgi and is recycled to the ER via its C-terminal KDEL sequence (50). Therefore, a dysfunctional µHC associated with BiP should behave similarly; i.e., it should be detected in the cis-Golgi but not in the trans-Golgi compartment. To verify the Golgi distribution of dysfunctional µHCs, we performed scanning confocal microscopy of a J558L-µdys clone double-stained with anti-µHC Abs and with Abs directed against either the cis-medial Golgi marker membrin (38) or the trans-Golgi marker syntaxin 6 (39). Fig. 2C demonstrates that the dysfunctional µHC does colocalize with the cis-medial-Golgi marker membrin, but not with the trans-Golgi marker syntaxin 6. We conclude from these findings that the dysfunctional VH81XµHC does not reach the trans-Golgi compartment, because it is retained by BiP in the ER and/or the cis-Golgi of J558L cells.

Effect of dysfunctional and functional µHCs on pervanadate-induced tyrosine phosphorylation in J558L cells

For the following experiments, we refer to a report by Wienands et al. (31), who found that cytoplasmic µHC do not form a preassembled signal transducing complex including active tyrosine kinases when transfected into J558L cells. However, the cells used in these experiments did not express Ig{alpha}; thus, no assembly of the BCR signal complex was possible. Therefore, we analyzed the potential signaling capacities of dysfunctional µHC in J558L cells coexpressing cytoplasmic, i.e., dysfunctional µHC in the presence of Ig{alpha} (see Fig. 1). To determine whether a dysfunctional, ER-retained µHC can induce signals similar to that of a functional, surface-exposed µHC, we treated J558L cells with H2O2 and sodium vanadate, which inhibits protein tyrosine phosphates and enables active BCR-associated kinases to phosphorylate substrates, such as Ig{alpha} (31). Proteins with phosphorylated tyrosine residues (PY proteins) were immunoprecipitated with a Sepharose-coupled Ab specific for phosphorylated tyrosine residues (anti-PY, clone PT66), electrophoretically separated and transferred to a membrane. Immunoblotting using a monoclonal anti-PY Ab (clone 2C8) revealed a PY band with an apparent molecular mass of 32 kDa (PY-p32 in Fig. 3, upper blot) only in J558L cells producing the functional µHC (µfct in Fig. 3), but not in untransfected J558L cells or in J558L clones transfected with a dysfunctional µHC (µdys in Fig. 3). The PY-p32 band is identical with that of Ig{alpha}, because it could be detected in anti-PY precipitates with the monoclonal anti-Ig{alpha} Ab (Fig. 3, lower blot).



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 3. Effect of dysfunctional and functional µHCs on pervanadate (vand.)-induced tyrosine phosphorylation of Ig{alpha} in J558L cells. Wild-type J558L (J558L in lanes 1 and 2), J558L-µdys (clone 3D in lanes 3 and 4, clone 5P in lanes 5 and 6, and clone 5T in lanes 7 and 8), and J558L-µfct cells (clone 10 in lanes 9 and 10) were incubated for 3 min in the absence (-) or presence (+) of 70 mM H2O2-50 µM vanadate and lysed in RIPA buffer. Proteins with phosphorylated tyrosine residues were immunoprecipitated with anti-PY Abs coupled to agarose (PT66-agarose). PY proteins were eluted, separated by 10% SDS-PAGE, transferred to nitrocellulose, and detected with anti-PY mAbs (clone 2C8) and appropriate HRP-conjugated secondary Abs and ECL (upper blot). After stripping of the membrane, Ig{alpha} was detected with anti-Ig{alpha} mAb clone 79A3 (lower blot). Positions of molecular mass standard proteins are indicated in kilodaltons on the left.

 
The lack of tyrosine-phosphorylated Ig{alpha} after pervanadate treatment was not due to the inability of the dysfunctional µHC to associate with the Ig{alpha}{beta} signal transducer, because strong signals for Ig{alpha} and Ig{beta} could be detected in anti-µHC precipitates from Digitonin lysates of J558L cells producing the dysfunctional µHC (Fig. 4A). However, to our surprise, weaker signals for µHC, Ig{alpha} as well as for Ig{beta} were detected in anti-µHC precipitates from J558L cells transfected with a functional µHC, despite the fact that lysates from equal numbers of J558L-µdys and J558L-µfct cells were used for immunoprecipitation. We reasoned that functional µHC-Ig{alpha}{beta} complexes might be less soluble in digitonin than dysfunctional µHC-Ig{alpha}{beta} complexes, thus being sedimented during centrifugation. Therefore, we analyzed the presence of µHC, Ig{alpha}, and the src kinase lyn in electrophoretically separated digitonin-soluble (s in Fig. 4B) and insoluble (p in Fig. 4B) fractions of µHC-transfected J558L cells before and after pervanadate stimulation. Immunoblotting revealed signals for both µHC and Ig{alpha} in the digitonin-soluble as well as in the insoluble fractions from untreated J558L-µfct cells. More importantly, signals for both proteins decreased in the soluble and increased in the insoluble fraction of digitonin lysates of cells that have been treated with pervanadate, which could be due to H2O2-mediated oxidative cross-linking of cysteine and tyrosine residues of µfctHC-Ig{alpha}{beta} complexes on the cell surface of J558L cells (51). The picture for J558L-µdys cells was quite different from that observed for J558L-µfct cells. Both µdysHC and Ig{alpha} could only be detected in the digitonin-soluble but not in the insoluble digitonin fraction of J558L-µdys cells (Fig. 4, upper blots), regardless of whether cells were treated with pervanadate.



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 4. Association of Ig{alpha} and Ig{beta} with functional and dysfunctional µHCs. A, Anti-µHC precipitates from digitonin lysates of J558L-Ig{alpha}dys (clones 5P and 5T, lanes 1 and 2, respectively), J558L-µfct cells (clone 10, lane 3), and nontransfected J558L cells (lane 4) were separated by 10% SDS-PAGE and transferred to nitrocellulose. Immunoblotting was performed with HRP-conjugated goat anti-µHC Abs (upper panel), the monoclonal anti-Ig{beta} Ab T04 (middle panel), and the monoclonal anti-Ig{alpha} Ab 79A3 (lower panel). Positions of molecular mass standard proteins are indicated in kilodaltons on the left. B, J558L-µdys (2 x 105; clone 5P) and J558L-µfct cells (clone 10) were incubated for 3 min in the absence (-) and presence (+) of 70 mM H2O2-50 µM vanadate (vand.). Cells were lysed in digitonin buffer, and lysates were separated by centrifugation in a soluble (s) and pellet (p) fraction. Pellet fractions were solubilized with SDS sample buffer supplemented with 2M urea. Proteins were separated by 10% SDS-PAGE, transferred to nitrocellulose, and analyzed for the presence of µHC, Ig{alpha}, and lyn with the indicated Abs. IP, Immunoprecipitate.

 
Comparable with µfctHC, levels of µdysHC and Ig{alpha} were decreased in the soluble fraction of cells treated with pervanadate. However, µdysHC did not reappear in the digitonin-insoluble cell fraction, suggesting that both proteins have an increased turnover rate in the presence of H2O2-vanadate. The decrease of µHC and Ig{alpha} in J558L-µdys cells was not due to an unspecific effect of the H2O2-vanadate treatment on general protein stability, because almost equal signals for lyn were detected in soluble and insoluble fractions regardless of whether H2O2-vanadate was added to the growth medium. This could point to a specific effect of H2O2 on the stability of ER-retained proteins, such as µdysHC-Ig{alpha}{beta} complexes. The fact that the concentration of H2O2 (70 mM) used by us and others (31) induced tyrosine phosphorylation even in the absence of the specific PTP inhibitor vanadate (data not shown), which was probably due to oxidation of the essential catalytic cysteine residue of PTPs (52), further shows that H2O2 can affect intracellular signaling.

Due to the above described stability problems, an increased turnover rate of µdysHC-Ig{alpha}{beta} complexes in the presence of H2O2-vanadate could explain why we did not detect tyrosine-phosphorylated Ig{alpha} in J558L-µdys cells treated with H2O2-vanadate. To exclude any effects of H2O2 on tyrosine phosphorylation, stability, and solubility of proteins, we titered H2O2 and vanadate concentrations (see Materials and Methods) and found that 350 µM H2O2 did induce tyrosine phosphorylation only in the presence (Fig. 5A, lanes marked with V) but not in the absence of 100 µM sodium vanadate (Fig. 5A, lanes marked with H). More importantly, the optimized pervanadate concentration (350 µM H2O2,100 µM vanadate) affected neither the turnover rate of µdysHC-Ig{alpha}{beta} nor the solubility of µfctHC-Ig{alpha}{beta} complexes, because signals for µdysHC and µfctHC did not change in soluble and pellet fractions of digitonin lysates from H2O2-vanadate-treated J558L cells when compared with that of untreated J558L cells (data not shown). Therefore, we are confident that the H2O2 concentration of 350 µM is sufficient to oxidize vanadate to the biochemically active pervanadate inhibitor but does not affect tyrosine phosphorylation, stability, and solubility of µHC-Ig{alpha}{beta} complexes.



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of pervanadate (vand.) treatment on tyrosine phosphorylation in wild-type and transfected J558L cells. A, untransfected J558L (2 x 106; lanes 1–3), J558L-Ig{alpha} (lanes 4–6), J558L-µdys (clone 5P, lanes 7–9), and J558L-µfct cells (clone 10, lanes 10–12) were incubated for 3 min in the absence (-) and presence of either 350 µM H2O2 (H) or 100 µM vanadate, 350 µM H2O2 (V). Lysates were separated by 10% SDS-PAGE, and immunoblotting was performed as described in Fig. 3 with monoclonal anti-PY Abs 2C8 and goat anti-{lambda}L Abs (anti-{lambda}). Positions of molecular mass standard proteins are indicated in kilodaltons on the left. B, J558L-µdys (107; clone 5P, lanes 1 and 2) and 5 x 106 J558L-µfct cells (clone 10, lanes 3 and 4) were incubated for 3 min in the absence (-) or presence (V) of 100 µM vanadate, 350 µM H2O2. Cells were lysed in TNP buffer, and lysates were immunoprecipitated (IP) with anti-PY-agarose (anti-PY). PY eluates were fractionated by 10% SDS-PAGE, and immunoblotting was performed as described in Fig. 3 with anti-PY mAb 2C8 (anti-PY). The position of Ig{alpha} is indicated on the right. C, The upper panel (expt. 1) shows the result of immunoblotting of the stripped membrane shown in B with anti-Ig{alpha} mAb 24C2.5. The lower panel (expt. 2) represents the result of a second independent experiment performed as described in B, except that J558L-µdys clone 5T and J558L-µfct clone 5.85 were used.

 
When we analyzed the induction of tyrosine phosphorylation in the presence of optimized concentrations of H2O2 and vanadate, we detected by immunoblotting three tyrosine-phosphorylated bands of ~43, 38, and 32 kDa in digitonin lysates of cells producing the functional (Fig. 5A, lane 12) but not of cells producing the dysfunctional µHC (lane 9). The presence as well as the identity of the PY-32 kDa band could be verified in electrophoretically separated anti-PY precipitates of J558L-µfct cells by immunoblotting with anti-PY Abs (Fig. 5B) and the monoclonal anti-Ig{alpha} Ab 24C2.5 (Fig. 5C), respectively. On the basis of these findings, we conclude that tyrosine phosphorylation of Ig{alpha} was induced through pervanadate treatment in J558L cells producing a functional but not in cells producing a dysfunctional µHC, supporting our previous results shown in Fig. 3.

Activity and subcellular localization of the src kinase lyn

Consistent with its substrate specificity (53), lyn, a member of the src tyrosine kinase family (54), is thought to catalyze tyrosine phosphorylation of Ig{alpha} (47). Thus, the lack of tyrosine phosphorylation of Ig{alpha} in J558L-µdys cells could be explained either by a decreased intrinsic activity of lyn in J558L-µdys cells upon pervanadate treatment or an enhanced activity in J558-µfct cells.

Therefore, we first determined lyn activity in J558L cells. Because 50% of lyn was insoluble in digitonin lysis buffer regardless whether pervanadate was present (Fig. 4B), we first examined the solubility of lyn in various lysis buffers (I to IV in Fig. 6A) and found by immunoblot analysis of total cell lysates that buffer IV (see Materials and Methods) solubilized lyn completely (compare lyn signals in Fig. 6A in soluble ‘s’ and pellet ‘p’ fractions of buffer IV). We next compared lyn activities in lysates from µHC-transfected and untransfected J558L cells before and after pervanadate stimulation in an immune complex kinase assay using [32P]ATP and recombinant GST-Ig{alpha} as lyn substrates (Fig. 6B). The incorporation of 32P in electrophoretically separated GST-Ig{alpha} was detected by autoradiography (Fig. 6B). This analysis revealed similar lyn activities in transfected and untransfected J588L cells, regardless whether pervanadate was present. Quantification of the signals shown in Fig. 6B confirmed that the activity of lyn in J558L cells producing the functional µHC did not significantly differ from that detected in J558L cells producing the dysfunctional µHC (Fig. 6C).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 6. Analysis of lyn activity in wild-type and transfected J558L cells. A, Solubilization of lyn. J558L-µfct cells (clone 10) were first stimulated with 350 µM H2O2, 50 µM sodium vanadate and lysed with the following buffers: buffer I, digitonin buffer; buffer II, 66% digitonin buffer, 33% TNP; buffer III, 33% digitonin buffer, 66% TNP; buffer IV, TNP. Lysates were separated by centrifugation into soluble (s) and pellet (p) fractions and resolved on a 10% SDS-PAGE as described in Fig. 4. Immunoblotting was performed with rabbit anti-lyn Abs. The positions of lyn (53/56 kD) are indicated on the right. B, Effect of pervanadate on lyn activity. J558L cells and indicated µHC-transfected J558L clones (µdys, clone 5P; µfct, clone 10) were incubated in the absence (-) or presence (+) of pervanadate (Vand.). Cells were lysed in TNP, and lysates were precipitated with rabbit anti-lyn Abs (lanes 2–14) or with isotype-matched Abs (lane 1). Immune complex kinase assays were performed with recombinant GST-Ig{alpha} (lanes 1 and 3–14) or GST (lane 2) as substrates. Kinase reactions were separated by 10% SDS-PAGE, and radioactivity was detected by autoradiography (upper panel). Aliquots of anti-lyn immunoprecipitates were separated by SDS-PAGE and analyzed by immunoblotting with rabbit anti-lyn Abs. Positions of GST-Ig{alpha} (upper panel) and immunoprecipitated lyn (lower panel) are indicated by arrows. C, Quantification of the radioactivity in excised GST-Ig{alpha} bands (B, upper panel) by liquid scintillation counting. Bars, SD of the mean activity of three excised lyn bands.

 
The lack of tyrosine phosphorylation of Ig{alpha} in J558L-µdys cells could also be due to the inability of lyn to associate with a µdysHC-Ig{alpha}{beta} complex. To determine whether lyn is associated with µHC-Ig{alpha}{beta} complexes in J558L cells, we performed combined immunoprecipitation-immunoblot assays. However, several attempts to identify lyn by immunoblotting in anti-µHC precipitates failed; i.e., we were unable to detect lyn in anti-µHC precipitates from digitonin lysates of either J558L-µdys cells or of J558L-µfct cells. Therefore, we analyzed the colocalization of µHC and lyn in pervanadate-stimulated cells doubled-stained with anti-lyn and anti-µHC Abs by scanning confocal laser microscopy (Fig. 7). This analysis revealed a patchy, but clear colocalization of µHC and lyn at the plasma membrane of J558L cells producing the functional µHC (Fig. 7, F–H). In contrast, in pervanadate-treated J558L-µdys cells, lyn was predominantly detected at the plasma membrane, whereas the dysfunctional µHC was clearly located in the cytoplasm (Fig. 7, C–E).



View larger version (75K):
[in this window]
[in a new window]
 
FIGURE 7. Colocalization analyses of µHC and lyn in µHC-transfected J558L-Ig{alpha} cells. J558L-µdys (clone 5P, A–E) and J558L-µfct cells (clone 10, F–H) were attached to Teflon-coated coverslips in serum-free medium for 1 h and stimulated with 350 µMH2O2, 50 µM vanadate for 3 min. Cells were fixed, washed, permeabilized, and double-stained either with isotype-matched control Abs (A and B) or FITC-conjugated goat anti-µHC and rabbit anti-lyn Abs (C–H). Rabbit Abs were detected with Cy3-conjugated anti-rabbit IgG Abs. Stained cells were analyzed by confocal laser scanning microscopy. Some cells from E and H were enlarged (*). Bar, 10 µM.

 
Effect of pervanadate treatment on tyrosine phosphorylation in 38B9 pre-B cells producing dysfunctional and functional µHCs

It is clear from the data presented thus far that a µHC unable to pair with IgL chains nevertheless assembles with Ig{alpha}{beta}, but does not induce Ig{alpha} tyrosine phosphorylation in pervanadate-stimulated plasmacytoma cells. This suggested that a pre-BCR must also be expressed on the surface to trigger signals leading to the transition of B lymphoid cells from the pro-B to the pre-B cell stage. To directly address this question, we first generated stable pre-B cell clones expressing µHC by transducing the AMuLV-transformed µHC-negative pre-B line 38B9 (32, 35) with IgH genes encoding either a SL chain-pairing (µfct) or nonpairing (µdys) µHC. The two µHC chains use the same VH81X segment but differ in their complementarity-determining region 3 and their ability to pair with SL and conventional L chains (13).

In contrast to noninfected 38B9 cells (first row in Fig. 8A), intracellular µHC could easily be identified at similar levels in both a stable clone producing a functional (µfct) and a dysfunctional (µdys), i.e., an ER-trapped µHC, by either flow cytometry (Fig. 8A) or Western blot analysis (Fig. 8B, middle blots). However, as expected from results with J588L-µHC clones (Fig. 1A), µHC could be detected, albeit at low levels, only on the surface of 38B9 cells producing a functional µHC (µfct in Fig. 8), but not on the surface of nontransduced 38B9 cells (38B9 in Fig. 8) or 38B9 cells producing a dysfunctional µHC (µdys in Fig. 8). The expression of a complete pre-BCR on the surface of 38B9-µfct cells could be confirmed by flow cytometry (data not shown) with the mAb SL156 that recognizes a complex of {lambda}5, VpreB and µHC (23).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 8. Effect of pervanadate stimulation on tyrosine phosphorylation in wild-type and transfected 38B9 cells. A, Flow cytometric analysis of µHC. Wild-type 38B9 cells (empty histograms) and 38B9 cells transduced with either a dysfunctional (µdys) or a functional µHC (µfct; clone 1; gray histograms) were stained with FITC-conjugated anti-µHC Abs either before (surface) or after the cells had been fixed and permeabilized (cytoplasmic) and analyzed by FACS. B, Untransfected, µdys-transfected 38B9 or µfct-transfected 38B9 cells (clones 1 and 17) were serum starved for 2 h and then placed in a 37°C water bath for 2 min without pervanadate stimulation (-) or stimulated with pervanadate (100 µM vanadate (vand.), 350 µM H2O2) for 30 s (30'') or 2 min (2'). Cells were immediately cooled with ice-cold PBS, spun down, and lysed in RIPA buffer. Equal amounts of protein were separated by SDS-PAGE, blotted on nitrocellulose, and analyzed with mAb PY99 against phosphotyrosine. The blot was stripped and subsequently stained with pAb against Syk, followed by secondary Abs, or with HRP-conjugated goat anti µHC pAb, and developed with ECL. Molecular mass positions are indicated on the left (kDa).

 
To determine the effect of a dysfunctional and functional µHC on pervanadate-induced tyrosine phosphorylation, wild-type and stably transduced 38B9 cells were serum starved and stimulated with pervanadate for 30 s and 2 min. Cells incubated in the absence of pervanadate for 2 min served a negative controls (Fig. 8B, -). Cellular lysates were analyzed by Western blotting with Abs specific for PY and µHC. Signals developed with anti-syk Abs served as the loading control.

Despite the fact that tyrosine phosphorylation could be detected even in the absence of pervanadate (see lanes marked with – in Fig. 8B) and could be slightly induced in wild-type 38B9 cells as well as 38B9-µdys cells, the induction of tyrosine phosphorylation of several proteins was clearly faster and stronger in two 38B9 clones producing surface pre-BCR (clones 1 and 17 in Fig. 8B). The same trend was observed for the induction of tyrosine phosphorylation of Ig{alpha}; i.e., after 2 min, pervanadate clearly induced a stronger signal of PY-Ig{alpha} in 38B9-µfct cells than in 38B9 wild-type and 38B9-µdys cells (Fig. 8B). This finding was confirmed by analyzing the presence of PY-Ig{alpha} in anti-PY precipitates from pervanadate-stimulated stable 38B9 infectants (data not shown).

In summary, we have shown in J558L plasmacytoma as well as in 38B9 pre-B cells that, in contrast to a functional µHC (i.e., one that can be transported with SL as well as IgL chain to the cell surface), a dysfunctional, ER-retained µHC does not facilitate tyrosine phosphorylation of Ig{alpha} on incubation with pervanadate. Therefore, we postulate that a pre-BCR must reach the cell surface to initiate signals in early µHC-positive pre-B cells.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Signals initiated by a functional pre-BCR consisting of a µHC, a SL chain, and the signal transducer Ig{alpha}{beta} are critical to induce clonal expansion of early pre-B cells producing a functional µHC, i.e., one that assembles with a conventional IgL chain into an Ag receptor (5, 21). This quality control assures that only those pre-B cells with an IgL-pairing µHC are clonally expanded and reach the small pre-B cell pool (13, 55). However, only a small fraction of the pre-BCR is detected on the cell surface (21, 22, 23), suggesting that pre-BCR signals might already be initiated from an intracellular compartment. In addition, µHC-positive pre-B cells develop into mature, allelically excluded BCR-positive B cells in SL chain-deficient mice (14, 15, 56, 57), indicating that a µHC alone, i.e., in the absence of SL chain pairing, might be able to initiate signals from an intracellular compartment, e.g., the ER.

To start addressing whether a signal-competent µHC-containing Ig receptor complex is already assembled in the ER, we assessed the influence of an IgL chain-pairing (i.e., functional and surface transport competent) and a nonpairing (i.e., ER-trapped and dysfunctional) µHC on pervanadate-induced protein tyrosine phosphorylation in J558L plasmacytoma and 38B9 pre-B cells. By our definition, dysfunctional µHCs contain unusual VH-D-JH joinings or complementarity-determining region 3 sequences that interfere with the correct folding of a VH region, and thus, with a ability of a H chain to form heterodimers with a SL as well as with a conventional IgL chain. The dysfunctional µHC used in this study uses a VH81X rearrangement and does not pair with SL chain (34), several {kappa}L chains (13), or the endogenous {lambda}L chain of J558L cells (this study). More importantly, endo H digestion, flow cytometry, and confocal microscopy confirmed that, in contrast to a functional µHC, the dysfunctional µHC does not reach the cell surface in J558L plasmacytoma and 38B9 pre-B cells. Unpaired µHCs remain associated with BiP (Ref. 45 ; Fig. 2) and are consequently trapped in the ER-cis-Golgi compartment. However, we confirmed that the ER-cis-Golgi-trapped dysfunctional µHC assembled with the signal-transducing dimer Ig{alpha}{beta} (Fig. 4), indicating that BiP does not disturb the association of an ER-trapped µHC with Ig{alpha}{beta}. Accordingly, it has already been shown previously that the lack of {lambda}5 does not affect the association of a membrane bound µHC with Ig{alpha}{beta} (29). Because BiP associates with unfolded ER-luminal parts of a µHC, we can also not imagine that BiP might influence the assembly of a signalosome at the cytoplasmic side of the Ig receptor. Therefore, J558L plasmacytoma as well as 38B9 pre-B cells producing an ER-trapped, dysfunctional VH81X-µHC-Ig{alpha}{beta} complex should be well suited to determine whether an ER-cis-Golgi-trapped µHC-Ig{alpha}{beta} complex can initiate signals from inside the cell.

Because we examined cytoplasmic µHCs, it was not possible to apply Ab-induced cross-linking. Inhibition of tyrosine phosphatases with pervanadate was applied instead, leading to increased cellular tyrosine phosphorylation if tyrosine kinases are active (58). In J558L-IgM cells, but not in IgM negative J558L cells, pervanadate induced a tyrosine phosphorylation pattern similar to that observed in cells treated with cross-linking anti-BCR Abs (31). On the basis of these findings, the authors suggested that a preactivated BCR-protein tyrosine kinase complex exists in nonactivated B cells and that changing the balance between tyrosine phosphorylation and dephosphorylation by pervanadate results in the tyrosine phosphorylation of protein substrates. Our experiments showed that careful titration of H2O2 is important because the concentration of H2O2 used by us and others (31) had unwanted side effects. For example, H2O2 induced tyrosine phosphorylation in the absence of vanadate (data not shown). This was, however, not surprising, because H2O2 has recently been postulated to be involved in BCR-mediated signal initiation (59). In addition, the levels of dysfunctional µHC as well as Ig{alpha} were decreased in the soluble fraction of digitonin lysates of H2O2-vanadate-treated J558L-µHCdys cells when compared with that of untreated J558L-µHCdys cells (Fig. 4). The finding that dysfunctional µHCs could not be detected in the digitonin-insoluble fractions of H2O2-vanadate-treated and untreated J558L-µHCdys cells suggests that H2O2 affected rather the degradation than the solubility of ER-trapped, dysfunctional µHCs. Because the 20S proteasome subunit can be activated by oxidative stress (60) and because ER-trapped Ig chains are degraded via the proteasome pathway (61, 62), high concentrations of H2O2 might accelerate the proteasome-mediated degradation of ER-trapped µHC, a hypothesis further supported by the finding that the degradation of dysfunctional µHCs was reduced when J558L-µHCdys cells were pretreated with the proteasome inhibitor MG132 before H2O2-vanadate treatment (our unpublished observation).

We therefore titered H2O2 to a concentration that did not influence the steady state levels of µdysHCs (results not shown) in H2O2-vanadate-treated J558L cells, but still induced tyrosine phosphorylation in the presence of vanadate (Fig. 5). Using these optimized pervanadate stimulation conditions, we found that tyrosine phosphorylation of Ig{alpha} could still be detected only in J558L cells producing a functional but not in J558L cells producing a dysfunctional ER-cis-Golgi-trapped µHC (Fig. 5), despite the fact that dysfunctional µHCs did associate with Ig{alpha} and Ig{beta} and were not degraded after H2O2-vanadate treatment. These findings clearly show that, in contrast to a membrane IgM-Ig{alpha}{beta} complex, an ER-cis-Golgi-trapped µHC-Ig{alpha}{beta} complex cannot be activated by H2O2-vanadate.

In contrast to J558L cells, tyrosine phosphorylation of Ig{alpha} and other proteins could already be induced at a low but reproducible level with pervanadate in wild-type AMuLV-transformed 38B9 pre-B cells as well as 38B9 cells transduced with a dysfunctional µHC (Fig. 8). This is most likely due to the presence of the constitutive active v-Abl tyrosine kinase in AMuLV-transformed pre-B cells38B9 cells, which results in tremendous tyrosine phosphorylation of many proteins after block of tyrosine phosphatases with pervanadate. Nevertheless, a clear increase in Ig{alpha} tyrosine phosphorylation was observed in pervanadate-stimulated 38B9 cells producing a surface exposed, functional µHC when compared with levels of PY-Ig{alpha} in wild-type 38B9 cells or cells synthesizing an ER-trapped dysfunctional µHC.

When compared cells with their wild-type counterparts, we observed in pervanadate-treated J558L-µdys as well as 38B9-µdys cells the appearance of some tyrosine phosphorylated proteins between 50 and 120 kDa, suggesting that some tyrosine kinases may become activated from an ER-resident µdysHC-Ig{alpha}{beta} complex in both cell types. Candidates are likely cytosolic kinases, because tyrosine kinases of the src family are constitutively membrane anchored and are predominantly concentrated in lipid rafts at the plasma membrane (63).

Indeed, lyn and the dysfunctional µHC-Ig{alpha}{beta} complex are physically separated in J558L-µdys cells, because scanning confocal microscopy detected the src kinase lyn, but not µHC, at the plasma membrane. In contrast, both proteins colocalized in J558L-µfct cells. Further, µHC, Ig{alpha} and lyn were enriched in the digitonin-insoluble fraction of J558L-µfct cells; in contrast, µHC and Ig{alpha} could be detected in the soluble but not in the digitonin-insoluble cell fraction of J558L-µdys cells (Fig. 4). These findings further support the idea that lyn and a dysfunctional µHC are physically separated and that µHC-Ig{alpha}{beta} complexes do not reach the trans-Golgi compartment. Thus, we conclude that a µHC-Ig{alpha}{beta} complex acquires Ig{alpha}{beta} signal competency after its association with src kinases, such as lyn, in a post-R-cis-Golgi compartment.

Some of these findings corroborate and extend previous results provided by Brouns et al. (22), who showed that ER-retained pre-BCR and BCR complexes from human Ramos B cells and Nalm-6 pre-B cells are not associated with the src kinase lyn, and are thus unlikely to transduce lyn-mediated signals. However, we did not purify proteins according to their glycosylation status with lectin chromatography (22) but rather took advantage of the fact that a µHC unable to pair with SL chain, or a conventional L chain, does not reach the cell surface (13), hence behaving like ER-resident pre-BCR complexes in Nalm-6 or BCR complexes in Ramos cells (22). Thus, to become connected to src kinases and further downstream events, a µHC-Ig{alpha}{beta} complex, which is assembled in the ER either in the context of a pre-BCR or a BCR, must reach the cell surface or at least the trans-Golgi compartment to meet src kinases. This is further supported by the finding, that tyrosine phosphorylation of the adaptor protein BLNK/SLP65, but not of lyn, was dependent on surface expression of the BCR (64), a finding that is consistent with our lyn activity measurements (Fig. 6). However, in contrast to this work, we went one step upstream and analyzed Ig{alpha} that provides a docking site for the Src homology 2 domain of BLNK (65), thus enabling tyrosine phosphorylation of BLNK by syk (66).

Our findings not only support the idea that an ER-trapped µHC does not initiate signals via tyrosine phosphorylation of Ig{alpha}{beta} but also explain why the dysfunctional VH81X-µHC used in this study failed to induce clonal expansion of pre-B cells in a JH knockout mouse transgenic for the VH81X-µHC (13). The fact that the transition of B lineage cells from the late pro-B/early pre-B to the small pre-B stage is severely compromised in mice that either produce a mutant µHC inable to assemble with Ig{alpha}{beta} (67) or fail to synthesize either membrane HCs (18) or SL chains (14, 15, 56, 57) further indicates that only early pre-B cells able to assemble an integral membrane pre-BCR efficiently proceed at a normal rate to the next developmental stage (reviewed in Refs. 68 and 69).

However, mature and allelically excluded Ag-responsive B cells accumulate at a low rate in peripheral lymphatic organs of SL chain-deficient mice (14, 15, 56, 57, 68), a finding that challenges the conclusion that the surface transport of a µHC and the assembly of a pre-BCR is absolutely required to signal the transit of cells from the pro-B to the small pre-B cells stage as well as allelic exclusion at the IgH locus (70). If one considers our finding that an ER-trapped µHC does not induce Ig{alpha}{beta}-mediated signals and assumes that all SL chain-nonpairing µHCs are entirely trapped within the ER, Ig{alpha}{beta}-independent signal pathways must be responsible for both inducing differentiation of SL chain-deficient, µHC-positive pre-B cells and mediating allelic exclusion in mature B cells. One candidate for a µHC-induced and Ig{alpha}{beta}-independent intracellular signal pathway might be the so-called unfolded protein response (UPR) pathway (71).

We cannot exclude that, depending on their VH sequences, some µHCs could reach the surface of pre-B cells in the absence of SL chain pairing and assemble into a signal-competent pre-BCR-like complex. In this case, however, Ig{alpha}{beta}-mediated µHC signals might result in allelic exclusion and differentiation but not in clonal expansion of µHC-positive pre-B cells, because either the density of cell surface µHC-Ig{alpha}{beta} complexes is too low or the partially assembled pre-BCR-like complex is unable to interact with a putative cross-linking stroma cell ligand (25). Comparative analyses of signals initiated by a µHC in either SL chain-deficient or normal pre-B cells will resolve which pathway is induced by a µHC in the absence of a complete SL chain.


    Acknowledgments
 
We thank Harald Bradl and Manuel Selg for critical reading of the manuscript; Michael Reth, Jürgen Wienands, Susan Pierce, and Paul Cheng for providing mAbs; and Christine Albert, Gudrun Hülsmann-Volkert, and Edith Roth for excellent technical assistance.


    Footnotes
 
1 The work was supported in part by Project Grant SFB466 and Research Grant JA 968/2 from the Deutsche Forschungsgemeinschaft (to H.-M.J.) and by Research Grant M3-Mielenz 0204181 from the ELAN-Fonds, University of Erlangen (to D.M.) This work was done in partial fulfillment of the M.Sc. by C.V. and A.R. Back

2 Address correspondence and reprint requests to Dr. Hans-Martin Jäck, Division of Molecular Immunology, Department of Internal Medicine III, Nikolaus-Fiebiger Center, University of Erlangen-Nürnberg, Glückstrasse 6, D-91054 Erlangen, Germany. E-mail address: hjaeck{at}molmed.uni-erlangen.de Back

3 Abbreviations used in this paper: µHC, IgH of IgM; SL, surrogate light; BCR, B cell receptor; pre-BCR, pre-B cell receptor; BiP, IgH-binding protein; ER, endoplasmic reticulum; PTP, phosphotyrosine phosphatase; PY, phosphotyrosine; AMuLV, Abelson murine leukemia virus; µfct, functional µHC; µdys, dysfunctional µHC; endo H, endoglycosidase H. Back

Received for publication August 9, 2002. Accepted for publication July 17, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References