The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deva, R.
Right arrow Articles by Nigam, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deva, R.
Right arrow Articles by Nigam, S.
The Journal of Immunology, 2003, 171: 3047-3055.
Copyright © 2003 by The American Association of Immunologists

Candida albicans Induces Selectively Transcriptional Activation of Cyclooxygenase-2 in HeLa Cells: Pivotal Roles of Toll-Like Receptors, p38 Mitogen-Activated Protein Kinase, and NF-{kappa}B

Rupal Deva1, Pattabhiraman Shankaranarayanan, Roberto Ciccoli and Santosh Nigam2

Eicosanoid and Lipid Research Division and Centre for Experimental Gynecology and Breast Research, Department of Gynecology, University Medical Centre Benjamin Franklin, Free University of Berlin, Berlin, Germany


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Candidiasis, in its mucocutaneous form as well as in an invasive form, is frequently associated with high morbidity. PGE2, which is generated by enzymatic activity of cyclooxygenases (COXs) 1 and 2, has been shown to trigger morphogenesis in Candida albicans. In the present study, we investigated whether C. albicans altered COX-2 expression in HeLa cells. RT-PCR and Western blot analyses revealed a time-dependent biphasic behavior of COX-2 mRNA expression and COX-2 protein level. COX-1 protein remained unaffected. Neutralization with Abs against Toll-like receptors (TLR) 2 and 4 inhibited the Candida-induced production of PGE2, suggesting a vital role for TLRs in the recognition and signaling in mammalian cells upon infection with C. albicans. Transient transfections with COX-2 promoter-luciferase construct and various inhibitors of mitogen-activated protein kinases (MAPK), such as protein kinase C (PKC) inhibitor GF203190X, p38MAPK inhibitor SB203109, and extracellular-regulated kinases 1 and 2 inhibitor PD98509 showed that C. albicans up-regulates selectively COX-2, but not COX-1, through p38MAPK and PKC pathways. No involvement of other stress kinases, e.g., c-Jun NH2-terminal kinase and extracellular-regulated kinases 1 and 2, was observed. Transient transfection of NF-{kappa}B promoter construct and dominant negative plasmid of I{kappa}B{beta} kinase showed that COX-2 transcription is mediated through p38MAPK and NF-{kappa}B pathways. That NF-{kappa}B up-regulates p38MAPK is novel and is in contradiction to earlier reports in which NF-{kappa}B was shown to inhibit p38MAPK. In conclusion, multiple converging signaling pathways, involving TLRs followed by PKC, p38MAPK, and/or NF-{kappa}B, are triggered by C. albicans in activation of COX-2 gene.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
In recent years, invasive fungal infections increased, predominantly in cancer patients and other immunosuppressed individuals (1, 2, 3, 4, 5). Candidemia and invasive candidiasis are frequently associated with high morbidity and not seldom with high mortality rates. Candida albicans is dimorphic and can either grow as blastospores (budding) or switch to a filamentous form depending on the environmental status (3). It is represented in >50% of candidemia cases as the hallmark of bloodstream infections. It is also the causative agent in various mucocutaneous infections such as vulvovaginal candidiasis (VVC),3 which is believed to affect ~75% of female patients during the child-bearing period (5). Although a number of antifungal drugs are applied, the treatment of VVC is often long lasting and unsatisfactory due to frequent recurrences and development of drug resistance. The latter is attributed to a great extent to formation of morphologically distinct phenotypes of Candida albicans, such as yeast-like blastospores, germ tubes, pseudohyphae, true hyphae, and chlamydospores.

The ability of C. albicans to establish a persistent infection is critically dependent on cellular signals that regulate release of factors from target cells responsible for replication of pathogen. This cell signaling is designed to serve the purpose of cell survival for both host and pathogen. Infection by C. albicans of host tissue and cells is mediated through surface receptors, such as mannose, {beta}-glucan, integrins, etc. (6, 7, 8) and has been found to release proinflammatory cytokines and large amount of arachidonic acid (AA) from host cells. AA is subsequently converted by lipoxygenases and cyclooxygenases (COXs) to eicosanoids (9, 10, 11, 12). In a previous report, we showed for the first time that AA stimulated not only growth of C. albicans and inhibited the antimycin A-resistant alternative oxidase but was also used exclusively as a sole carbon source (13). The most striking observation was, however, that two-thirds of it were transformed to carbohydrates via glyoxylate shunt of citrate cycle (13). Support for this observation came recently from Lorenz and Fink (14), who found that the phagocytosis of C. albicans by macrophages up-regulated genes encoding principal enzymes of glyoxylate cycle, isocitrate lyase, and malate synthase, which are required for the virulence of fungus.

Because C. albicans has been reported to produce PGE2 in HeLa cells (15), and PGE2 has been shown to induce germ-tube formation in C. albicans (16), a vicious cycle seems to be operative in mucocutaneous candidiasis, in which the infected host tissue releases AA and PGE2. Earlier we have shown that AA is also converted by C. albicans to 3(R)-hydroxyoxylipins, e.g., 3-hydroxyeicosatetraenoic acid and 3,18-dihydroxyeicosatetraenoic acid (13, 17). In analogy to AA metabolism by Dipodascopsis uninucleata, both endogenous and host-derived 3-hydroxyoxylipins are subsequently used by C. albicans as positive bioregulators for its growth and virulence (13, 18). Inasmuch as PGE2 exerts immunosuppressive and vasodilatory activities and enhances vascular permeability, a pathogenic invasion by C. albicans is even more facilitated.

Because cyclooxygenase is the rate-limiting enzyme that catalyzes the oxygenation of AA to PG endoperoxides, which in turn are transformed enzymatically to PGs, we addressed this study to investigate the regulation of COX-2 gene expression in C. albicans-treated HeLa cells. HeLa cells were chosen because in a previous study we found enhancement of PGE2 synthesis in HeLa cells on infection with C. albicans (15). In addition, this model HeLa cell/C. albicans closely represents the VVC. Our data demonstrate that C. albicans induces selectively COX-2 gene expression and protein synthesis in HeLa cells. Moreover, these effects, which are enhanced by oxidant stress, are mediated in a redundant manner in which p38MAPK and/or NF-{kappa}B are part of mitogen-activated protein kinase (MAPK) and protein kinase C (PKC) signal transduction pathways. Thereby the critical role played by Toll-like receptors (TLR) 2 and 4 in the C. albicans-induced cell signaling pathways has also been emphasized.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials

DMEM, peptone, and glucose were purchased from Difco Laboratories (Augsburg, Germany). Indomethacin was supplied by Sigma (Taufkirchen, Germany). Inhibitors SB 202190, PD98059, PDTC, GF203190X, NS398, and dexamethasone were purchased from Calbiochem (Germany). Rabbit polyclonal Abs against human COX-2 and COX-1 were from Cayman (Ann Arbor, MI). Abs against p38MAPK, extracellular regulated kinases (ERKs) 1 and 2, c-Jun NH2-terminal kinase (JNK), and rabbit IgG conjugated to HRP were supplied by Santa Cruz Biotechnology (Heidelberg, Germany). Western blotting detection reagents (ECL) were purchased from Amersham Pharmacia Biotech., (Freiburg, Germany). Neutralization Abs (without sodium azide) against TLR-2 and TLR-4 were purchased from eBioscience, and those against IL-1{beta} were purchased from Peprotech (London, U.K.). Plasmid pNF-{kappa}B-Luc was obtained from Clontech (Heidelberg, Germany). Plasmids were transfected using PolyFect transfection reagent (Qiagen, Hilden, Germany), and assayed using la uciferase reporter assay system obtained from Promega (Madison, WI). For extraction of RNA, the RNAeasy system from Qiagen was used.

Organism and cell culture

HeLa cells and C. albicans 1386 (a clinical isolate from bronchomycosis) were obtained from Deutsche Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Germany). HeLa cells were grown in DMEM containing 10% FCS, 50 U/ml penicillin, and 50 µg/ml streptomycin. C. albicans was grown in Sabouraud glucose broth containing 1% peptone in a rotary shaker at 120 rpm for 36 h at 37°C. The cells were then separated from the medium by centrifugation at 3000 x g for 5 min, washed three times with PBS, and finally resuspended in 1 ml of fresh DMEM for each experiment. C. albicans with multiplicity of infection of 5 (MOI 5) was added to the HeLa cells in DMEM containing 1% FCS, and the mixture was incubated at 37°C in an atmosphere containing 5% CO2 and 95% air.

SDS-PAGE and Western blot analysis

Cell lysates were prepared by treating cells with buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 1% SDS, 10 mM sodium orthovanadate, 2 mM PMSF, 20 µg/ml leupeptin, 2 µM pepstatin A, and 20 µg/ml of aprotinin). Lysates were sonicated for 20 s on ice and centrifuged at 10,000 x g for 10 min. Protein concentration of the supernatant was determined with a Bio-Rad kit (Bio-Rad, Hercules, CA). SDS-PAGE performed under reducing conditions on 10% polyacrylamide gels The resolved protein were transferred onto a nitrocellulose membrane, incubated with desired primary Abs and then probed with appropriate HRP-conjugated secondary Ab. Blots were detected with a ECL Western blot detection system according to the manufacturer's instructions.

Effect of various antagonists on C. albicans-induced COX-2 or on PGE2 formation

HeLa cells (106), untransfected or transfected with COX-2 promoter construct, NF-{kappa}B-pLUC, IKK{beta}-DN (hereafter designated as IKK-DN) were treated either with diluent, p38MAPK inhibitor SB202190 (0.1–10 µM), ERK1/2 inhibitor PD98059 (10 µM), free radical scavenger pyrrolidine-dithiocarbamate (PDTC; 20 µM), PKC inhibitor GF203190X (0.1–30 µM), COX-2 inhibitor NS398 (10 µM), or COX-1 inhibitor resveratrol (20 µM) and SC-560 (100 µM) for 1 h before infection with C. albicans. When necessary, concentrations of inhibitors were increased to achieve a more pronounced effect.

Neutralization experiments

HeLa cells were preincubated for 1 h with 20 µg/ml Ab solution of TLR-2 and TLR-4 or IL-1{beta}. C. albicans was then added at MOI 5:1 for 6 h. The cell culture supernatants were collected, and Abs were removed by incubation with protein A agarose. The stripped supernatants were analyzed for PGE2 by ELISA.

Effect of pro- and antioxidant on C. albicans-induced COX-2

HeLa cells, untransfected or transfected as described above, were pretreated either with 100 µM L-buthionine sulfoximine (BSO) for 24 h and then stimulated with C. albicans with MOI 1:5 for 6 h or were incubated for the same time with both 200 µM N-acetylcysteine (NAC) and C. albicans (MOI 1:5) for 6 h. Cells were harvested for Western analysis and ELISA as described above.

Measurement of COX activity

HeLa cells were grown in 10% DMEM as a monolayer in a 12-well plate until 60% of confluency was attained. Cells were then treated with vehicle or specific inhibitors for 1 h before infection with C. albicans at MOI 5 for 6 h. Cells were then spun at 2000 x g, and supernatant was collected. PGE2 synthesis was assayed by ELISA from Cayman, as described previously (15).

Measurement of COX-2 promoter activity

COX-2 promoter activity was determined by transient expression of a COX-2 5'-flanking region in HeLa cells grown to 70% confluency. COX-2 promoter construct was made as described (19) with minor modifications. PCR amplification of the promoter region of COX-2 from human genomic DNA was performed with GGGGTACCACATTTAGCGTCCCTGCA (KpnI) (forward), GGAAGCTTCGGACGTGCTCCT (HindIII) (reverse) primers. The fragment was digested and cloned into pGL3 basic vector (Promega). In each well,1.5 µg of plasmid DNA were introduced using PolyFect reagent (Qiagen). Control plasmid pRSVLACZ was used to normalize for transfection efficiency. The expressed luciferase activity was measured in a scintillation counter (Perkin-Elmer, Freidburg, Germany). In each experiment, pGL3 basic was used as an empty expression vector.

RT-PCR-cDNA was reverse transcribed from the total RNA (1 µg) extracted from HeLa cells using RNAeasy extraction kit according to the manufacturer’s instructions. PCR amplification was performed for 30 cycles using the rat/ovine/human COX-2 gene-specific primers 5'-GTC ACA AGA TGG CAA AAT GCT G-3' (sense) and 5'-TAA GAT AAC ACT GCA GTG GCT C-3' (antisense). The cycling parameters were the following: 30 s at 94°C for denaturation; 30 s at 60°C for primer annealing; and 60 s at 72°C for polymerization. {beta}-Actin RT-PCR with the same amount of cDNA was performed (amplification for 20 cycles) using specific GAPDH primers 5'-TCGGAGTCAACGGATTTGGTCGTA-3' (sense) and 5'-ATGGACTGTGGTCATGAGTCCTTC-3' (antisense) to normalize COX-2 expression. The PCR products were separated on 1% agarose gel containing ethidium bromide and visualized.

Transient transfections

HeLa cells were transfected with respective plasmid, such as p-NF-{kappa}B-LUC (pNF-{kappa}B-LUC) (Clontech), IKK-DN plasmid (kindly provided by Dr. S. Ghosh, HHMI, Yale University, New Haven, CT), or COX-2 promoter construct according to manufacturer’s instruction. pNF-{kappa}B-LUC consists of four tandem repeats of NF-{kappa}B consensus sequence coupled to the luciferase gene. IKK-DN construct conducted a point mutation in the kinase domain (K44A), thus inhibiting the phosphorylation and subsequent cleavage of the I{kappa}B proteins. Briefly, cells were grown in DMEM containing 10% FCS until 50% confluency. Cells were then washed and transfected with 1.5 µg of plasmid DNA using PolyFect reagent. Experiments were performed 18–24 h after transfection. The ratio of COX-2 promoter construct to the respective dominant negative plasmids for transfection experiments was 1:1.

Densitometric analysis

The density of the bands of Western blotting or RT-PCR was quantified by scanning densitometry and expressed as normalized values to {beta}-actin or GAPDH, respectively.

Statistics

Data are presented as mean ± SD. Statistical comparisons between groups were made using Student’s t test for paired observations. Significance was achieved at p < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
C. albicans induces synthesis of COX-2 protein in HeLa cells and enhances PGE2 production

On stimulation of HeLa cells (106) with C. albicans (MOI 1:5), RT-PCR and Western blot analyses showed a time-dependent induction of COX-2-mRNA (Fig. 1A) and COX-2 protein synthesis (Fig. 1B), respectively. The densitometric scanning measurement of the COX-2 immunoreactivity revealed an ~4-fold increase for protein and >1.5 fold for COX-2 mRNA within 6 h over the basal value (Fig. 1C). The mRNA increased further to almost 3-fold of the basal value in 24 h, whereas the COX-2 protein decreased slightly during this period. MOIs <5 for HeLa cells and C. albicans did not show any significant expression of COX-2 protein (not shown), suggesting a threshold for the infection status. Stimulation of HeLa cells with C. albicans, however, did not affect COX-1 immunoreactivity (Fig. 1B). To investigate whether the enhanced COX-2 protein synthesis also exhibited increased PG formation, PGE2 was measured in supernatant of HeLa cell-C. albicans incubation mixture. A 4-fold increase in PGE2 over the basal level was observed, and this increase was markedly inhibited by NS398, a selective COX-2 inhibitor, as well as by nonselective COX-1/COX-2 inhibitors indomethacin and diclofenac (Fig. 1D). These findings are consistent with our earlier report on PGE2 synthesis in a vaginal C. albicans isolate from a patient with recurrent candidiasis (15). To investigate the differential pattern of induction for COX-2 protein and COX-2 mRNA, HeLa cells were treated with 100 nM PGE2 for 6 h and compared with cells challenged with C. albicans. A significant increase in the levels of COX-2 mRNA in PGE2-treated infected cells was observed (Fig. 2). Concomitant treatment of HeLa cells with cycloheximide (10 µM) and PGE2 (100 nM) abolished the COX-2 up-regulation induced by PGE2, and this effect did not differ from that of cycloheximide alone (not shown). These data indicate that the initially synthesized PGE2 by Candida-infected HeLa cells functions as a trigger for further induction of COX-2 gene.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 1. C. albicans induces the COX-2 mRNA expression and synthesis of COX-2 protein and PGE2 but not COX-1 protein in HeLa cells. Cells were treated with C. albicans at MOI 5 for various periods of time. A, Total RNA (1 µg) was extracted, and RT-PCR analysis was performed. PCR was performed for COX-2 (upper panel), as well as for GAPDH (lower panel) as a control to ensure that RNA amounts were equal. Data are representative of four separate experiments. B, Lysate protein prepared from HeLa cells infected with C. albicans for 0, 6, 12, and 24 h was loaded onto a 10% SDS-PAGE and subsequently transferred onto nitrocellulose. Immunoblots were probed with Abs specific for COX-1 and COX-2. The immunoblot is representative of three separate experiments. C, Densitometric quantification of COX-2 protein normalized to {beta}-actin and of COX-2 mRNA normalized to GAPDH. D, HeLa cells were treated with nonselective COX inhibitors indomethacin and diclofenac, selective COX-2 inhibitor NS398 and COX-1 inhibitor SC-560 for 1 h. After the medium was replaced, cells were infected with C. albicans (MOI 5) for 6 h. The supernatant was collected, and PGE2 production was determined by ELISA. Data are given as mean ± SD (n = 3). Significant difference between untreated cells and infected cells is indicated by p < 0.001 (*), and that between infected cells plus inhibitors vs infected cells alone is indicated by p < 0.05 (**) or p < 0.01 (***).

 


View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 2. Induction of COX-2 gene expression by PGE2. Cells were treated with 100 nM PGE2 and with C. albicans at MOI 5 (control) for 6 h. Total RNA (1 µg) was extracted, and RT-PCR analysis was performed. PCR was performed for COX-2 as well as for GAPDH as a control to ensure that RNA amounts were equal. PCR data are representative of three separate experiments.

 
C. albicans induces PGE2 synthesis through TLRs

TLRs have been shown earlier to be involved in the antifungal defense mechanism in Drosophila and bacterial defense in humans (20, 21). To determine the involvement of these receptors in the interaction of HeLa cells with C. albicans, neutralization experiments were performed. Surface TLR-2 and TLR-4 receptors were blocked by neutralizing concentrations of respective Abs before the cells were infected with C. albicans at MOI 5. In this system, the production of PGE2 by HeLa cells induced by Candida infection was almost completely abrogated, underlining the importance of TLRs in the interaction of HeLa cells with C. albicans (Fig. 3). Abs against IL-1{beta} cytokine, which has been shown to be produced by C. albicans (22) and to trigger the signaling cascade in smooth muscle cells (23), however, failed to inhibit the induction of PGE2 (Fig. 3).



View larger version (11K):
[in this window]
[in a new window]
  		FIGURE 3. Neutralization with TLR-2 and 4 Abs inhibits the synthesis of PGE2. HeLa cells were preincubated with 20 µg/ml anti-TLR-2, TLR-4, and IL-1{beta} Abs separately for 1 h. Cells were then challenged with C. albicans (MOI 5) for 6 h. The cell culture supernatants were stripped of the Abs by incubation with protein A-agarose and were subsequently used for PGE2 ELISA. Data are given as mean ± SD (n = 3). Significant difference between untreated cells and infected cells is indicated by p < 0.001 (*), and that between infected cells treated with Abs vs infected cells alone is indicated by p < 0.001 (**). Cells treated with IL-1{beta} Ab do not show any significant difference in levels of PGE2.

 
C. albicans-induced synthesis of COX-2 protein mimics oxidative stress-mediated signaling

To find whether C. albicans-induced activation of COX-2 expression is dependent on antioxidant potential of HeLa cells, cells transfected with COX-2 promoter were depleted of glutathione either by pretreatment with 100 µM BSO, an inhibitor of glutathione, for 24 h or with 200 µM N-acetylcysteine, an antioxidant, for 18 h for enhancing cellular glutathione content. On incubation of cells with C. albicans at MOI 5, almost a 3-fold increase in COX-2 promoter activity was observed (Fig. 4). Taken into consideration that BSO-treated cells alone caused only 2-fold increase in COX-2 promoter activity (Fig. 4), BSO treatment of infected cells failed to increase the COX-2 promoter activity beyond the level obtained with C. albicans alone, suggesting that a maximum depletion of intracellular glutathione was achieved by C. albicans at MOI 5. In contrast, cells with increased glutathione levels abrogated the C. albicans-induced activation of COX-2 (Fig. 4), indicating a strong prooxidant behavior of Candida infection. Determination of glutathione content by ELISA in cells infected with C. albicans with and without pretreatment of BSO revealed glutathione levels of 28.3 ± 1.0 nmol/mg protein (n = 3) for untreated cells, 11.8 ± 1.1 nmol/mg protein (n = 3) for C. albicans-infected cells, and 8.0 ± 0.5 nmol/mg protein (n = 3) for BSO-pretreated cells infected with C. albicans. This supported our observations depicted in Fig. 4.



View larger version (10K):
[in this window]
[in a new window]
  		FIGURE 4. Prooxidant role of C. albicans in the induction of COX-2 expression. HeLa cells transfected with 1.5 µg of a human -327/+59 COX-2 promoter-luciferase reporter construct were either preincubated with 100 µM BSO for 24 h and then infected with C. albicans (MOI 5) for 6 h or coincubated with 200 µM NAC and C. albicans (MOI 5) for 6h. COX-2 promoter activity was measured and given as mean relative light units (RLU) ± SD (n = 3). Significant difference between untreated cells and infected cells is indicated by * p < 0.01 (*), and that between infected cells and NAC-treated cells is indicated by p < 0.01 (**).

 
C. albicans-induced synthesis of COX-2 protein and PGE2 formation is prevented by inhibitors of p38MAPK, PKC, and reactive oxygen species (ROS)

Oxidative stress has been suggested to activate cell signaling via MAPK family, which has been implicated in the regulation of cell growth and differentiation (24, 25). To investigate the pathways of C. albicans-induced activation of COX-2 in HeLa cells, various inhibitors of second messenger pathways were applied. Neither COX-2 expression nor PGE2 formation was inhibited by ERK1/2 inhibitor PD98059 (Fig. 5, A and B). In contrast, inhibitors of p38MAPK (SB202190) and PKC (GF203190X) suppressed significantly C. albicans-induced COX-2 immunoreactivity (Fig. 5A). The suppression of COX-2 immunoreactivity was accompanied by a dose-dependent decrease in C. albicans-induced PGE2 formation (Fig. 5B), whereby the inhibition by SB202190 was more pronounced than that by GF203190X. Whereas SB 202190 at a concentration of 0.1 µM inhibited almost 50% of PGE2 synthesis and at 10 µM concentration abolished it, PKC inhibitor GF203190X suppressed the PGE2 synthesis by only 50% at 30 µM (Fig. 5B). To investigate whether this deviation in suppression of COX-2 protein from the corresponding PGE2 levels by PKC inhibitor GF203190X is caused by COX-1 contribution to PGE2 synthesis, we pretreated the cells with increasing concentrations of COX-1 inhibitors resveratrol or SC-560. Whereas resveratrol suppressed PGE2 synthesis completely (not shown), confirming its inefficacy as a specific COX-1 inhibitor (26), SC-560 reduced the PGE2 level significantly in Candida-infected cells (Fig. 1D). Moreover, free radical scavenger PDTC was also capable of inhibiting C. albicans-induced COX-2 activation markedly, as shown by assaying COX-2 promoter activity (Fig. 5C) and PGE2 formation (Fig. 5D), suggesting the involvement of ROS and NF-{kappa}B.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 5. C. albicans-induced COX-2 and PGE2 synthesis is suppressed by inhibitors of p38MAPK, PKC, and free radical scavenger. HeLa cells untransfected or transfected with 1.5 µg of a human -327/+59 COX-2 promoter-luciferase reporter were treated with various inhibitors, e.g., SB202190, GF203190X, PD98059 or PDTC for 1h before infection with C. albicans at MOI 5 for 6 h. A, Cell lysate protein was prepared from untransfected cells pretreated with 10 µM SB202190 or 10 µM PD98059 for 1 h and then challenged with C. albicans for 6 h. Lysate protein was prepared, loaded onto a 10% SDS-PAGE, and subsequently transferred onto nitrocellulose. Immunoblots were probed with Ab specific against COX-2. Actin served as a control for loading protein. The exposure is representative of a single experiment performed three times. B, Untransfected cells were treated with 0.1 µM, 1.0 µM, and 10 µM SB203190; with 0.1 µM, 1.0 µM, 10 µM, and 30 µM GF203190X; or with 10 µM PD98059 for 1 h before infection with C. albicans (MOI 5). After 6 h, supernatant was collected by centrifugation of incubation mixture and used for PGE2 assay by ELISA. Values are mean ± SD for three separate experiments. Significant difference between untreated cells and infected cells is indicated by p < 0.01 (*), between infected cells plus 10 µM or 30 µM GF203190X vs infected cells alone by p < 0.05 (**), and between infected cells plus 10 µM SB203190 vs infected cells alone by p < 0.01 (***). C, HeLa cells transfected with 1.5 µg of a human -327/+59 COX-2 promoter-luciferase reporter construct were preincubated with vehicle, 20 µM PDTC, or 30 µM PDTC before infection with C. albicans at MOI 5 for 6 h. Luciferase activity was measured, and values are reported as mean RLU ± SD (n = 3). DNA content in each reaction was kept constant at 2 µg by using empty vector. Significant difference between untreated cells and infected cells is indicated by p < 0.01 (*), and between infected cells plus PDTC vs infected cells alone by p < 0.01 (**). D, Untransfected HeLa cells were preincubated with vehicle, 0.1 µM PDTC, 1 µM PDTC, or 10 µM PDTC before infection with C. albicans at MOI 5 for 6 h. The supernatant obtained after centrifugation of incubation mixture was used for PGE2 assay by ELISA. Values are mean ± SD for three separate experiments. Significant difference between untreated cells and infected cells is indicated by p < 0.001 (*), and that between infected cells plus PDTC vs infected cells alone is indicated by p < 0.01 (**) and by p < 0.001 (***).

 
C. albicans induces activation of p38MAPK via PKC in HeLa cells

Western blot analysis using specific Abs against p38MAPK and phosphorylated p38MAPK revealed that C. albicans rapidly increased both p38MAPK and phosphorylated p38MAPK levels, with a maximal effect occurring at MOI 5 (Fig. 6A). This increase of both proteins was, however, abrogated when HeLa cells were pretreated with 10 µM p38MAPK inhibitor SB202109 (Fig. 6B). To determine the upstream kinases, we pretreated HeLa cells with PD98059 (10 µM), PDTC (20 µM), and GF203190X (10 µM) for 1 h before incubating with C. albicans at MOI 5. Western analysis of the lysate showed significant inhibition of phosphorylated and nonphosphorylated p38MAPK proteins by GF203190X and PDTC (Fig. 6B), which was also confirmed by densitometric scanning analysis (not shown), pinpointing PKC and NF-{kappa}B as upstream regulators of p38MAPK. No such inhibition was, however, observed with PD98059, an inhibitor of ERK-1/2 (Fig. 6A). Also, Western blot analysis failed to show any activation of ERK1/2 and JNK by C. albicans (Fig. 6C). NF-{kappa}B is commonly located in cytoplasma in an inactive state as a heterodimer bound to its inhibitory protein I{kappa}B. After stimulation with agonists, NF-{kappa}B is detached from I{kappa}B and translocates to the nucleus to activate the target genes (27). To investigate the role of NF-{kappa}B in the C. albicans-induced activation of p38MAPK and COX-2, HeLa cells were transfected with IKK dominant negative plasmid before challenging with C. albicans. Significant inhibition of p38MAPK was observed in Western blot analysis (Fig. 6B), suggesting the regulation of p38MAPK via the NF-{kappa}B-dependent pathway.



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 6. C. albicans-induced COX-2 is p38MAPK-dependent but independent of JNK and ERK1/2. HeLa cells with or without pretreatment with inhibitors PD98059 (10 µM), GF203190X (20 µM), SB202109 (10 µM), or PDTC (20 µM) were treated with C. albicans at MOI 5 for 6 h. Lysate protein was prepared, and Western analysis was performed. Immunoblots shown are representative of three separate experiments. A, Lysate protein from cells (25 µg/lane) with or without pretreatment with inhibitors PD98059 (10 µM) or GF203190X (20 µM) was prepared after infection with C. albicans (MOI 5), electrophoresed, transferred onto nitrocellulose, and probed with Ab specific for p38MAPK. B, Lysate protein from cells with or without pretreatment with inhibitors SB202109 (10 µM) or PDTC (20 µM) or GF203190X (20 µM) was prepared after infection with C. albicans, electrophoresed, and probed with Abs specific for p38MAPK (upper panel) or phosphorylated p38MAPK (lower panel). In some experiments, HeLa cells were transfected with 1 µg of expression vector for dominant negative I{kappa}B kinase (IKK-DN) before challenging with C. albicans. Here also, lysate protein was electrophoresed, transferred onto nitrocellulose, and probed with Ab specific for p38MAPK (far right lane). Actin served as a control for loading protein. C, HeLa cells were treated with vehicle and C. albicans (MOI 5) for 6 and 12 h. Lysate protein was prepared, electrophoresed, and probed with Abs specific for JNK and ERK1/2.

 
Role of NF-{kappa}B in C. albicans-induced activation of COX-2 in HeLa cells

In COX-2 gene promoter, elements for NF-{kappa}B, NF, IL-6, and cAMP-responsive element have been found to be crucial for the regulation of transcription (28, 29). Inasmuch as free radical scavenger PDTC partially inhibited COX-2 activation and PGE2 synthesis, we performed experiments without exposing cells to TNF or cytokines, thus simulating in vivo conditions during the infection. To investigate whether C. albicans stimulated NF-{kappa}B, HeLa cells were transfected with pNF-{kappa}B-Luc plasmid or COX-2 promoter construct and subsequently infected with C. albicans for 6 h at MOI 5. Luciferase activity was measured using luciferase reporter assay. C. albicans up-regulated NF-{kappa}B and COX-2 activities 4-fold of the basal value (Fig. 7A). Surprisingly, pretreatment of cells with SB202190 and GF203190X, inhibitors of p38MAPK and PKC, respectively, did not abrogate NF-{kappa}B and COX-2 promoter activities, indicating alternative pathways for the COX-2 activation. To clarify the role of NF-{kappa}B in COX-2 activation, HeLa cells were cotransfected with COX-2 promoter construct and IKK-dominant negative plasmid or with pNF-{kappa}B-Luc plasmid and IKK-dominant negative plasmid. After challenging transfected cells with C. albicans (MOI 5) for 6 h, inhibition of >60% of COX-2 and >70% of NF-{kappa}B promoter activities were observed (Fig. 7B). These observations show that signaling pathways other than via p38MAPK and NF-{kappa}B may be operative in C. albicans-induced activation of COX-2 gene.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 7. C. albicans-induced NF-{kappa}B activity is partially dependent on PKC and p38MAPK and mediates the induction of COX-2. A, In one set of experiments HeLa cells were transfected with 1.5 µg of a human COX-2 promoter construct ligated to luciferase and 0.2 µg of empty vector. In another set of experiments, HeLa cells were transfected with 1.5 µg of pNF-{kappa}B-LUC plasmid ligated to luciferase and 0.2 µg of empty vector. Cells were then pretreated with vehicle or 20 µM SB202190 or 10 µM GF203190X for 1 h, followed by infection with C. albicans (MOI 5) for 6 h. Luciferase activity was measured for COX-2 and NF-{kappa}B promoter activities, and values are reported as mean RLU ± SD (n = 3). For NF-{kappa}B activity significant difference between control and infected cells is indicated by p < 0.001 (*), between infected cells and infected cells plus SB202190 by p < 0.05 (**), and between infected cells and infected cells plus GF203190X by p < 0.01 (***). For COX-2 promoter activity, significant difference between control and infected cells is indicated by p < 0.001 (*), between infected cells and infected cells plus SB202190 by p < 0.01 (***) and between infected cells and infected cells plus GF203190X by p < 0.05 (**). B, In one set of experiments, HeLa cells were transfected with 1.5 µg of a human COX-2 promoter construct ligated to luciferase and 0.2 µg of empty vector. In another set of experiments, HeLa cells were transfected with 1.5 µg of pNF-{kappa}B-LUC plasmid ligated to luciferase and 0.2 µg of empty vector. Columns representing IKK-DN received 1.5 µg of dominant negative plasmid for IKK. In both sets of experiments, cells were infected with vehicle or C. albicans for 6 h. Luciferase activity was measured for COX-2 und NF-{kappa}B promoter activities, and values were reported as mean RLU ± SD (n = 3). Significant difference between control and infected cells is indicated by p < 0.001 (*) and between infected cells and infected cells plus IKK-DN by p < 0.01 (**).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
PGE2 plays a crucial role in the morphogenesis of C. albicans and has been shown to stimulate germ tube formation (16). Conversely, we have shown recently that C. albicans isolated from vaginal tract of a patient with VVC when cocultured with HeLa cells caused significant release of PGE2 (15). These observations led us to investigate the activation of COXs in HeLa cells by C. albicans in a coculturing model of C. albicans-HeLa cells maintaining MOI 5:1.

In the present study, we demonstrate for the first time that COX-2 mRNA, COX-2 protein, and COX-2 activity are selectively induced by C. albicans in HeLa cells in a time- and dose-dependent manner, whereas the constitutively expressed COX-1 gene was barely affected (Fig. 1, A and B). The differential pattern in time course of COX-2 mRNA expression (peak at 24 h) and COX-2 protein level (maximum at 6 h) is, however, intriguing. The fact that exogenously added PGE2 (100 nM) augmented the expression of COX-2 mRNA in 6 h (Fig. 2) and cycloheximide caused significant reduction of COX-2 expression (not shown) pinpoints a de novo protein synthesis triggered by initially formed PGE2. Although EP receptors have rarely been suggested as a link for signaling via p38MAPK or PKC (30), our observations provide evidence that PGE2 induces both p38MAPK and PKC possibly via PGE2 receptors (EP). The PGE2-induced up-regulation of COX-2 leads to drastic increase of PGE2 formation (23), which plays a major role in morphogenesis of C. albicans (16) and candidiasis (22). Absence of increase in COX-2 protein expression after 6 h may also be attributed to posttranscriptional regulation of the COX-2 gene, in which RNA-binding proteins bind to the 3'-untranslated region of the COX-2 mRNA and inhibit its translation (31). Also, we do not rule out the occurrence of PGE2-mediated positive feedback regulation at the transcriptional level in a comparable time course between COX-2 mRNA and COX-2 protein, as shown by Schrör et al. (32), although differences in experimental setups between both laboratories prohibit any direct comparison. The selective activation of COX-2 gene was in agreement with the inflammatory status of the Candida-infected HeLa cells, because at MOI <=1, which describes the common microbial status of C. albicans in organs, COX-2 protein as well as PGE2 synthesis were hardly detectable (not shown).

TLRs have been identified in humans as an important component of innate immunity against microbial pathogens. Spaetzle/Toll and other similar proteins were first discovered in Drosophila melanogaster, and their interactions were shown to induce antifungal defense by the production of drosomycin, an antifungal compound (21). TLRs recognize various components of bacterial pathogen such as peptidoglycans and lipoproteins (TLR-2) (33, 34), lipopolysaccharides (TLR-4) (34), and bacterial DNA (TLR-9) (35). Experiments with TLR-4-deficient mice revealed an important role for TLRs in combating candidiasis (36). The signaling pathways induced by TLRs vary with respect to interactions involving MyD88, TIRAP, Tollip, and p85 proteins (37), as well as NF-{kappa}B (38). Neutralization experiments with Abs blocking TLR-2 and TLR-4 demonstrate that these receptors play a critical role in the signal transduction pathway induced by C. albicans (Fig. 3). Candida infection also induces the production of cytokines such as IL-1{beta} (22), which may subsequently trigger signal transduction cascade in HeLa cells. However, neutralization experiments performed with specific IL-1{beta} Abs ruled out this pathway (Fig. 3).

Increased ROS formation is a common consequence of many pathologies, including infection and inflmmation, and provides a link between signaling pathways and transcriptional events that regulate the large number of genes. The consequences of enhanced oxidative stress are expressed in release of proinflammatory cytokines, growth factors, and a large number of transcription factors (39). Assay of intracellular glutathione content in HeLa cells revealed that the Candida infection alone caused drastic depletion of glutathione, thus enhancing the oxidative stress and consequently COX-2 promoter activity. Conversely, NAC, an antioxidant, and PDTC, a free radical scavenger, strongly decreased the COX-2 activity (Figs. 4 and 5). These findings are consistent with the earlier reports in which oxidative stress has been assigned a key role in the activation of COX-2 (40), and depletion of glutathione was shown to be associated with increased susceptibility to infection (41).

Oxidative stress has also been linked with intracellular MAP kinase signaling pathways (24, 25), which lead to up-regulation of COX-2 gene expression (42, 43). p38MAPKs are members of the MAPK superfamily and can be activated in response to cellular stress (44), ischemia/reperfusion (45), endotoxins, and inflammatory cytokines (46). Although p38MAPK activation in other cell systems has been reported to be mediated by G protein-coupled receptors (47, 48), the upstream signaling mechanisms for its activation is far from clear. Thus, C. albicans-induced activation of COX-2 showed the stimulation of p38MAPK pathway without any involvement of ERK1/2 and stress-activated protein kinase/JNK pathways (Fig. 6, A–C). Moreover, the p38MAPK pathway was not only suppressed by p38MAPK inhibitor SB202190, but also by GF203190X, a PKC inhibitor (Fig. 6, A and B), which suggests that the PKC activation occurs upstream of p38MAPK and is an obligatory event in C. albicans-mediated COX-2 induction in HeLa cells. Furthermore, total suppression of COX-2 protein expression by SB202190 and GF203190X (Fig. 5A), but their differential inhibitory activities with respect to concomitant PGE2 synthesis is striking. Whereas SB202190 completely inhibited the PGE2 synthesis, GF203190X suppressed PGE2 only partially (Figs. 5, A and B). If it holds true that the residual PGE2 in GF203190X-pretreated cells is contributed by COX-1 as shown by the use of selective COX-1 inhibitor SC-560 (Fig. 1D), it can be concluded that SB202190-mediated inhibition of PGE2 is caused by both COX-1 and COX-2. This conclusion was also supported by the presence of residual COX-2 promoter activity found in COX-2- and NF-{kappa}B-transfected cells pretreated with SB202190 and GF203190X (Fig. 7A) as well as in cells cotransfected with IKK-DN plasmid and COX-2 promoter construct or pNF-{kappa}B-Luc plasmid (Fig. 7B).

One of the redox-sensitive transcription factors was recognized as NF-{kappa}B (49). NF-{kappa}B commonly exists as a heterodimer of p50 and p65 peptides, bound to its inhibitory protein I{kappa}B, which masks its nuclear localization. After stimulation with agonists, I{kappa}B is cleaved and phosphorylated by IKK complex and then degraded by the 26S proteasome (50, 51). Subsequently, NF-{kappa}B translocates to the nucleus, where it docks to DNA at binding sites within the promoter region of target genes (24, 27). Cleavage of I{kappa}B requires an oxidizing milieu and appears to be one of the mechanisms by which ROS activate NF-{kappa}B (52). Assay of NF-{kappa}B activity in presence of the free radical scavenger PDTC and in cells transiently transfected with NF-{kappa}B plasmid and dominant negative vector of IKK, showed the important signaling role of NF-{kappa}B in C. albicans-induced COX-2 activation (Figs. 5 and 7). This is not surprising, because several consensus sequences for NF binding, e.g., NF-{kappa}B, NF-IL6 and cAMP-responsive element binding sites, found in the 5'-flanking region of the COX-2 gene, have been reported as regulatory sequences in COX-2 induction by various agonists in different cell types (29). However, as discussed above, careful analysis of NF-{kappa}B and COX-2 promoter activities using various inhibitors and dominant negative vectors showed a residual COX-2 promoter activity, which pinpoints the involvement of pathways other than via NF-{kappa}B and p38MAPK for COX-2 activation. This is not fully in agreement with previous reports, because pharmacological inhibition of NF-{kappa}B activation has been shown to abolish the COX-2 gene expression (53).

The NF-{kappa}B-mediated activation of p38MAPK protein synthesis (Fig. 6B) is novel and has been described for the first time in this study. However, this pathway is totally in contradiction to earlier reports, in which sustained activation of p38MAPK has been shown to inhibit the NF-{kappa}B activity (54). The mechanism involved in this cross-talk between NF-{kappa}B and p38MAPK is not yet clear and needs further investigation. However, it is tempting to assume that NF-{kappa}B after translocating and binding to DNA promoter may turn on synthesis of proteins which might be directed to activate p38MAPK. This assumption is supported by a recent report, in which IKK has been shown to negatively modulate TNF-{alpha}-induced JNK activity most probably through the induction of NF-{kappa}B target genes encoding proteins such as X-chromosome-linked inhibitor of apoptosis (55).

In conclusion, the overall mechanism for COX-2 activation in candidiasis is likely to involve multiple converging signal transduction pathways and oxidative stress. This holds especially true for NF-{kappa}B-mediated cellular actions as well as for MAP kinases, where different combinations of stress kinases, such as ERK, p38MAPK, etc., together with protein kinase C and tyrosine kinases lead to different actions in the cell. The same may apply for Candida infection of HeLa cells, in which specific inhibition of PKC, p38MAPK, NF-{kappa}B as well as their activator proteins revealed that these signaling pathways for the activation of COX-2 by C. albicans are required, albeit these are dissociated from morphogenetic alterations in C. albicans itself. For the first time, we have shown the vital role of TLR-2 and 4 in the recognition and subsequent signaling in HeLa cells, suggesting its importance in VVC. Thus, our study offers a deeper insight into the host-pathogen interaction, which may lead to development of effective therapeutic strategies.


   Acknowledgments
 
We thank Dr. Steve Prescott, Salt Lake City, UT, for supplying COX-2 promoter construct and Dr. Sankar Ghosh, New Haven, CT, for IKK-DN plasmid. We also thank Natalia Groza for transfection studies. Also gratefully acknowledged is helpful discussion with Dr. Igor Ivanov.


   Footnotes
 
1 R.D. the is recipient of stipends from Schering AG, Berlin, Germany, and VW-Stiftung, Hannover, Germany. This study constituted a part of R.D.’s thesis. Back

2 Address correspondence and reprint requests to Dr. Santosh Nigam, Eicosanoid Research Division and Centre for Experimental Gynecology and Breast Research, University Medical Centre Benjamin Franklin, Free University Berlin, Hindenburgdamm 30, D-12200 Berlin, Germany. E-mail address: nigam{at}zedat.fu-berlin.de Back

3 Abbreviations used in this paper: VVC, vulvovaginal candidiasis; AA, arachidonic acid; BSO, L-buthionine sulfoximine; COX, cyclooxygenases; ERK, extracellular-regulated kinase; IKK, I{kappa}B{beta} kinase; IKK-DN, I{kappa}B kinase {beta} dominant negative; JNK, c-Jun NH2-terminal kinase; MOI, multiplicity of infection; MAPK, mitogen-activated protein kinase; p38MAPK, p38 mitogen-activated protein kinase; NAC, N-acetylcysteine; RLU, relative light units; PDTC, pyrrolidine dithiocarbamate; ROS, reactive oxygen species; TLR, Toll-like receptors; PKC, protein kinase C. Back

Received for publication October 24, 2002. Accepted for publication July 17, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bow, E. J.. 1998. Invasive fungal infections in patients receiving intensive cytotoxic therapy for cancer. Br J Haematol. 101:(Suppl. 1):1.
  2. De Pauw, D. E., J. F. Meis. 1998. Progress in fighting systemic fungal infections in haematological neoplasia. Support Care Cancer 6:31.[Medline]
  3. Odds, F. C.. 1988. Genital candidosis. F.C. Odds, ed. In Candida and Candidosis: a Review and Bibliography 2nd ed.124. Baillière Tindall, London.
  4. Lengeler, K. B., R. C. Davidson, C. D’souza, T. Harashima, W. C. Shen, P. Wang, X. Pan, M. Waugh, J. Heitman. 2000. Signal transduction cascades regulating fungal development and virulence. Microbiol. Mol. Biol. Rev. 64:746.[Abstract/Free Full Text]
  5. Fidel, P. L., J. D. Sobel, Jr. 1996. Immunopathogenesis of recurrent vulvovaginal candidiasis. Clin. Microbiol. Rev. 9:335.[Abstract]
  6. Kitz, D. J., P. D. Stahl, J. R Little. 1992. The effect of a mannose-binding protein on macrophage interactions with Candida albicans.. Cell. Mol. Biol. 38:407.[Medline]
  7. Kanbe, T. H., M. A. Jutila, J. E. Cutler. 1993. Evidence that mannans from Candida albicans are responsible for the adherence of yeast forms to spleen and lymph nodes. Infect. Immun. 61:2578.[Abstract/Free Full Text]
  8. Hostetter, M. K.. 1996. An integrin-like protein in Candida albicans: implications for pathogenesis. Trends Microbiol. 4:242.[Medline]
  9. Castro, M., N. V. C. Ralston, I. Timothy, M. M. S. Rohrbach, A. H. Limper. 1994. Candida albicans stimulates arachidonic acid liberation from alveolar macrophages through {alpha}-mannan and {beta}-glucan cell wall components. Infect. Immun. 62:3138.[Abstract/Free Full Text]
  10. Castro, M., J. A. Bjoraker, M. S. Rohrbach, A. H. Limper. 1996. Candida albicans induces the release of inflammatory mediators from human peripheral blood monocytes. Inflammation 20:107.[Medline]
  11. Filler, S. G., B. O. Ibe, P. M. Luckett, J. U. Raj, J. E. Edwards, Jr. 1991. Candida albicans stimulates endothelial cell eicosanoid production. J. Infect. Dis. 164:928.[Medline]
  12. Noverr, M. C., S. M. Phare, G. B. Toews, M. J. Coffey, G. B. Huffnagle. 2001. Pathogenic yeasts Cryptococcus neoformans and Candida albicans produce immunomodulatory prostaglandins. Infect. Immun. 69:2957.[Abstract/Free Full Text]
  13. Deva, R., R. Ciccoli, T. Schewe, J. L. Kock, S. Nigam. 2000. Arachidonic acid stimulates cell growth and forms a novel oxygenated metabolite in Candida albicans.. Biochim. Biophys. Acta 1486:299.[Medline]
  14. Lorenz, M. C., G. R. Fink. 2001. The glyoxylate cycle is required for fungal virulence. Nature 412:83.[Medline]
  15. Deva, R., R. Ciccoli, L. Kock, S. Nigam. 2001. Involvement of aspirin-sensitive oxylipins in vulvovaginal candidiasis. FEMS Microb. Lett. 198:37.[Medline]
  16. Kalo-Klein, A., S. S. Witkin. 1990. Prostaglandin E2 enhances and {gamma} interferon inhibits germ tube formation in Candida albicans. Infect. Immun. 58:260.[Abstract/Free Full Text]
  17. Van Dyk, M. S., J. L. F. Kock, D. J. Coetzee, O. P. H. Augustyn, S. Nigam. 1991. Isolation of a novel arachidonic acid metabolite 3-hydroxy-5,8,11,14-eicosatetraenoic acid (3-HETE) from the yeast Dipodascopsis uninucleata.. FEBS Lett. 283:195.[Medline]
  18. Kock, J. L. F., P. Venter, D. Linke, T. Schewe, S. Nigam. 1998. Biological dynamics and distribution of 3-hydroxy fatty acids in the yeast Dipodascopsis uninucleata as investigated by immunofluorescence microscopy: evidence for a putative regulatory role in the sexual reproductive cycle. FEBS Lett. 427:345.[Medline]
  19. Tazawa, R, X. M. Xu, K. K Wu, L. H. Wang. 1994. Characterization of the genomic structure, chromosomal location and promoter of human prostaglandin H synthase-2 gene. Biochem. Biophys. Res. Commun. 203:190.[Medline]
  20. Lemaitre, B., E. Nicolas, L. Michaut, J. M. Reichhart, J. A. Hoffmann. 1996. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86:973.[Medline]
  21. Sieling, P. A., R. L. Modlin. 2002. Toll-like receptors: mammalian "taste receptors" for a smorgasbord of microbial invaders. Curr. Opin. Microbiol. 5:70.[Medline]
  22. Schaller, M., R. Mailhammer, H. C. Korting. 2002. Cytokine expressions induced by Candida albicans in a model of cutaneous candidiasis based on reconstructed human epidermis. J. Med. Microbiol. 51:672.[Abstract/Free Full Text]
  23. Bonazzi, A., M. Bolla, C. Bucellati, A. Hernandez, S. Zarini, T. Vigano, F. Fumagalli, S. Viapiani, S. Ravasi, P. Zannini, et al 2000. Effect of endogenous prostaglandin E2 on interleukin-1{beta}-induced cyclooxygenase-2 expression in human airway smooth muscle. Am. J. Crit. Care Med. 162:2272.[Abstract/Free Full Text]
  24. Tago, K., M. Funakoshi, H. Mano, K. Yanagisawa, M. Hayakawa, K. Kuroiwa, H. Iwahana, T. Kasahara, S. Tominaga. 2001. Presence of a genistein-responsive inhibitory mechanism on interleukin-1{alpha}-induced NF-{kappa}B activation. Eur. J. Biochem. 268:6526.[Medline]
  25. Wang, X., J. L. Martindale, Y. Liu, N. J. Holbrook. 1998. The cellular response to oxidative stress: influences of mitogen-activated protein kinase signalling pathways on cell survival. Biochem. J. 333:291.
  26. Subbaramaiah, K., W. J. Chung, P. Michaluart, N. Telang, T. Tanabe, H. Inoue, M. Jang, J. M. Pezzuto, A. J. Dannenberg. 1998. Resveratrol inhibits cyclooxygenase-2 transcription and activity in phorbol ester-treated human mammary epithelial cells. J. Biol. Chem. 273:21875.[Abstract/Free Full Text]
  27. Shakov, A. N., M. A. Collart, P. Vassalli, S. A. Nedospasov, C. V. Jongeneel. 1990. {kappa}B-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumour necrosis factor {alpha} gene in primary macrophages. J. Exp. Med. 171:35.[Abstract/Free Full Text]
  28. Kosaka, T, A. Miyata, H. Ihara, S. Hara, T. Sugimoto, O. Takeda, E. Takahashi, T. Tanabe. 1994. Characterization of the human gene (PTGS2) encoding prostaglandin-endoperoxide synthase 2. Eur. J. Biochem. 221:889.[Medline]
  29. Inoue, H., C. Yokoyama, S. Hara, Y. Tone, T. Tanabe. 1995. Transcriptional regulation of human prostaglandin-endoperoxide synthase-2 gene by lipopolysaccharide and phorbol ester in vascular endothelial cells: involvement of both nuclear factor for interleukin-6 expression site and cAMP response element. J. Biol. Chem. 270:24965.[Abstract/Free Full Text]
  30. Fiebich, B. L., S. Schleicher, O. Spleiss, M. Czygan, M. Hüll. 2001. Mechanisms of prostaglandin E2-induced interleukin-6 release in astrocytes: possible involvement of EP4-like receptors, p38 mitogen-activated protein kinase and protein kinase C. J. Neurochem. 79:950.[Medline]
  31. Dixon, D. A., C. D. Kaplan, T. M. McIntyre, G. A. Zimmerman, S. M. Prescott. 2000. Post-transcriptional control of cyclooxygenase-2 gene expression. The role of the 3'-untranslated region. J. Biol. Chem. 275:11750.[Abstract/Free Full Text]
  32. Schroer, K., Y. Zhu, M. A. Saunders, W. G. Deng, X. M. Xu, J. Meyer-Kirchrath, K. K. Wu. 2002. Obligatory role of cyclic adenosine monophosphate response element in cyclooxygenase-2 promoter induction and feedback regulation by inflammatory mediators. Circulation 105:2760.[Abstract/Free Full Text]
  33. Yoshimura, A., E. Lien, R. R. Ingalls, E. Tuomanen, R. Dziarski, D. Golenbock. 1999. Cutting edge: recognition of Gram-positive bacterial cell wall components by the innate immune system occurs via Toll-like receptor 2. J. Immunol. 163:1.[Abstract/Free Full Text]
  34. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. V. Huffel, X. Du, S. Birdwell, E. Alejos, M. Silva, C. Galanos, et al 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085.[Abstract/Free Full Text]
  35. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  36. Netea, M. G., C. A. Van Der Graaf, A. G. Vonk, I. Verschueren, J. W. Van Der Meer, B. J. Kullberg. 2002. The role of Toll-like receptor (TLR) 2 and TLR4 in the host defense against disseminated candidiasis. J. Infect. Dis. 185:1483.[Medline]
  37. Takeuchi, O., S. Akira. 2001. Toll-like receptors: their physiological role and signal transduction system. Int. Immunopharmacol. 1:625.[Medline]
  38. Aliprantis, A. O., R. B. Yang, M. R. Mark, S. Suggett, B. Devaux, J. D. Radolf, G. R. Klimpel, P. Godowski, A. Zychlinsky. 1999. Cell activation and apoptosis by bacterial lipoproteins through toll-like receptor-2. Science 285:736.[Abstract/Free Full Text]
  39. Napoli, C., F. De Nigris, W. Palinski. 2001. Multiple role of reactive oxygen species in the arterial wall. J. Cell Biochem. 82:674.[Medline]
  40. Feng, L., Y. Xia, G. E. Garcia, D. Hwang, C. B. Wilson. 1995. Involvement of reactive oxygen intermediates in cyclooxygenase-2 expression induced by interleukin-1, tumor necrosis factor-alpha, and lipopolysaccharide. J. Clin. Invest. 95:1669.
  41. Villa, P., P. Ghezzi. 1995. Effect of N-acetyl-L-cysteine on sepsis in mice. Eur. J. Pharmacol. 292:341.[Medline]
  42. Guan, Z., S. Y. Buckman, B. W. Miller, L. D. Springer, A. R. Morrison. 1998. Interleukin-1{beta}-induced cyclooxygenase-2 expression requires activation of both c-Jun NH2-terminal kinase and p38MAPK signal pathways in rat renal mesangial cells. J. Biol. Chem. 273:28670.[Abstract/Free Full Text]
  43. Subbaramaiah, K., W. J. Chung, A. J. Dannenberg. 1998. Ceramide regulates the transcription of cyclooxygenase-2: evidence for involvement of extracellular signal-regulated kinase/c-Jun N-terminal kinase and p38 mitogen-activated protein kinase pathways. J. Biol. Chem. 273:32943.[Abstract/Free Full Text]
  44. Ushio-Fukai, M., R. W. Alexander, M. Akers, K. K. Griendling. 1998. p38 Mitogen-activated protein kinase is a critical component of the redox-sensitive signaling pathways activated by angiotensin II: role in vascular smooth muscle cell hypertrophy. J. Biol. Chem. 273:15022.[Abstract/Free Full Text]
  45. Bogoyevitch, M. A., P. E. Glennon, M. B. Andersson, A. Clerk, A. Lazou, C. J. Marshall, P. J. Parker, P. H. Sugden. 1994. Endothelin-1 and fibroblast growth factors stimulate the mitogen-activated protein kinase signaling cascade in cardiac myocytes: the potential role of the cascade in the integration of two signaling pathways leading to myocyte hypertrophy. J. Biol. Chem. 269:1110.[Abstract/Free Full Text]
  46. Lee, J. C., J. T. Laydon, P. C. McDonnell, T. F. Gallagher, S. Kumar, D. Green, D. McNulty, M. J. Blumenthal, J. R. Heys, S. W. Landvatter, et al 1994. A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 372:739.[Medline]
  47. Kramer, R. M., E. F. Roberts, B. A. Strifler, E. M. Johnstone. 1995. Thrombin induces activation of p38MAP kinase in human platelets. J. Biol. Chem. 270:27395.[Abstract/Free Full Text]
  48. Krump, E., J. S. Sanghera, S. L. Pelech, W. Furuya, S. Grinstein. 1997. Chemotactic peptide N-formyl-Met-Leu-Phe activation of p38 mitogen-activated protein kinase (MAPK) and MAPK-activated protein kinase-2 in human neutrophils. J. Biol. Chem. 272:937.[Abstract/Free Full Text]
  49. Mercurio, F., A. M. Manning. 1999. Multiple signals converging on NF-{kappa}B. Curr. Opin. Cell Biol. 11:226.[Medline]
  50. Baldwin, A. S., Jr. 1996. The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
  51. Ling, L., Z. Cao, D. V. Goeddel. 1998. NF-{kappa}B-inducing kinase activates IKK-{alpha} by phosphorylation of Ser-176. Proc. Natl. Acad. Sci. USA 95:3792.[Abstract/Free Full Text]
  52. Hamilton, T. A., J. A. Major, D. Armstrong, J. M. Tebo. 1998. Oxidized LDL modulates activation of NF-{kappa}B in mononuclear phagocyte by altering the degradation of I{kappa}Bs. J. Leukocyte Biol. 64:667.[Abstract]
  53. Hwang, D., B. C. Jang, G. Yu, M. Boudreau. 1997. Expression of mitogen-inducible cyclooxygenase induced by lipopolysaccharide: mediation through both mitogen-activated protein kinase and NF-{kappa}B signaling pathways in macrophages. Biochem. Pharmacol. 54:87.[Medline]
  54. Alpert, D., P. Schwenger, J. Han, J. Vilcek. 1999. Cell stress and MKK6b-mediated p38MAP kinase activation inhibit tumor necrosis factor-induced I{kappa}B phosphorylation and NF-{kappa}B activation. J. Biol. Chem. 274:22176.[Abstract/Free Full Text]
  55. Tang, G., Y. Minemoto, B. Dibling, N. H. Purcell, Z. Li, M. Karin, A. Lin. 2001. Inhibition of JNK activation through NF-{kappa}B target genes. Nature 414:313.[Medline]



This article has been cited by other articles:


Home page
 Am. J. Respir. Cell Mol. Bio.Home page
K. A. Brant and J. P. Fabisiak
Nickel Alterations of TLR2-Dependent Chemokine Profiles in Lung Fibroblasts Are Mediated by COX-2
Am. J. Respir. Cell Mol. Biol., May 1, 2008; 38(5): 591 - 599.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
I. Valera, N. Fernandez, A. G. Trinidad, S. Alonso, G. D. Brown, A. Alonso, and M. S. Crespo
Costimulation of Dectin-1 and DC-SIGN Triggers the Arachidonic Acid Cascade in Human Monocyte-Derived Dendritic Cells
J. Immunol., April 15, 2008; 180(8): 5727 - 5736.
[Abstract] [Full Text] [PDF]

Home page
 Eur Respir JHome page
H. Slevogt, L. Maqami, K. Vardarowa, W. Beermann, A. C. Hocke, J. Eitel, B. Schmeck, A. Weimann, B. Opitz, S. Hippenstiel, et al.
Differential regulation of Moraxella catarrhalis-induced interleukin-8 response by protein kinase C isoforms
Eur. Respir. J., April 1, 2008; 31(4): 725 - 735.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
V. Muller, D. Viemann, M. Schmidt, N. Endres, S. Ludwig, M. Leverkus, J. Roth, and M. Goebeler
Candida albicans Triggers Activation of Distinct Signaling Pathways to Establish a Proinflammatory Gene Expression Program in Primary Human Endothelial Cells
J. Immunol., December 15, 2007; 179(12): 8435 - 8445.
[Abstract] [Full Text] [PDF]

Home page