|
|
||||||||









* Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom; and
DNAX Research Institute, Palo Alto, CA 94304
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In this study, we have identified the homologue of the CD200 receptor in humans, and show that it is expressed at the surface of myeloid cells and T cells and that it binds CD200. A second related gene was analyzed in humans and an additional four genes in mice that we have designated CD200 receptor-like (CD200RL) 5 proteins. Two of the mouse gene products were shown to pair with the immunoreceptor tyrosine-based activation motif-containing adapter protein, DAP12, creating the potential for activating signal transduction.
| Materials and Methods |
|---|
|
|
|---|
Human mast cells were derived from freshly isolated cord blood, as previously described (9, 10). Mouse C57BL/6 mast cells were derived from bone marrow of 2- to 3-wk-old mice. Bone marrow cells were cultured in DMEM (BioWhittaker, Walkersville, MD) supplemented with 10% FCS (HyClone, Logan, UT), 1.0 mM sodium pyruvate, 0.1 mM nonessential amino acids, 0.3 mg/ml of L-glutamine, 20 mM HEPES, 50 µM 2-ME, 50 ng/ml of recombinant stem cell factors (PeproTech, Rocky Hill, NJ), and 30 ng/ml of murine rIL-3. After 2 wk, the cells were cultured in RPMI 1640 medium containing the same supplements as above minus the stem cell factor, but with the addition of 5 ng/ml of murine rIL-4. Ba/F3, a pro-B cell line, was kindly provided by T. Kitamura (University of Tokyo, Tokyo, Japan). A cDNA containing the CD8 leader segment followed by the FLAG peptide epitope and joined to the extracellular, transmembrane, and cytoplasmic domains of mouse DAP12 (mDAP12) was subcloned into the retroviral vector pMX-neo (11). Plasmid DNA of this construct was transfected into the Pheonix ecotropic virus packaging cell line (G. Nolan, Stanford University, Stanford, CA), and viruses obtained were used to infect Ba/F3 cells. Ba/F3-mDAP12 cells stably express cytoplasmic FLAG-tagged mDAP12. Mouse and human peripheral blood leukocytes were prepared from peripheral blood by hypotonic lysis of RBC. Mouse splenic leukocytes were prepared from single cell suspensions after hypotonic lysis of RBC.
The following anti-mouse leukocyte Abs were obtained from BD Biosciences (San Jose, CA): FITC-DX5, FITC-CD4, FITC-CD8, FITC-CD19, FITC-CD11b, and CyChrome-CD3. The following anti-human leukocyte Abs were obtained from BD Biosciences: FITC-CD3, FITC-CD4, FITC-CD8, FITC-CD19, FITC-CD14, FITC-CD16, CyChrome-CD56, CyChrome-CD3, and CyChrome-CD14. FITC-conjugated anti-human IgE (anti-hIgE) was obtained from Kirkegaard & Perry Laboratories (Gaithersburg, MD). Anti-mouse CD200R (DX109, rat IgG1, OX110, rat IgG1), anti-mouse CD200RLa (DX87, rat IgG2c), and anti-mouse CD200RLb (DX116, rat IgG1) were generated from rats using immunogenic fusion proteins consisting of the extracellular domains of the various CD200R genes fused to the Fc domain of hIg (mCD200R-hIg, mCD200RLa-hIg, mCD200RLb-hIg), except for OX110, in which mCD200RCD4d3+4 was used. Anti-human CD200R (DX136, rat IgG2a) was generated from a rat immunized with a fusion protein consisting of the extracellular domain of hCD200R fused to the Fc domain of hIg (hCD200R-hIg). Anti-human mCD200R (OX108, mouse IgG1) was generated from a BALB/c mouse immunized with hCD200RCD4d3+4 (see below).
Cloning of hCD200R
The National Center for Biotechnology Information (NCBI) expressed sequence tag (EST) database was screened using the rat cDNA sequence of CD200R (GenBank accession AF231392) utilizing the BLASTN program (12). A weak match was identified in the 3' nontranslated region with clone IMAGE:2054703. This clone was ordered from NCBI, and further sequencing revealed an open reading frame that contained an apparent insertion that affected the reading frame before the proposed transmembrane domain. The full-length hCD200R sequence was then amplified from cDNA generated from human lung poly(A)+ RNA (Clontech, Palo Alto, CA) by PCR using oligonucleotides cccactgttgatggggtaag (sense) and gactcgaggaaactgttcacacttgctcc (antisense with XhoI site underlined), and the products were reamplified in a nested PCR using the same antisense oligonucleotide, but gcagagcggccgcaaacagaaatgctc (sense) to introduce a NotI site (underlined) for cloning. Products were cloned into appropriately digested PCRScript (Stratagene, La Jolla, CA) vector, and sequencing of three clones identified two alleles that differed at 3 aa in the extracellular region (Fig. 1).
|
mCD200RLa was cloned from normal bone marrow-derived mast cells using a DAP12 trap technique, as previously described (13). In brief, a cDNA library was prepared from normal mouse mast cells in a pJEF14 vector. cDNA cloning by transient expression in 293T/FLAG-DAP12 cells was performed, as previously described (13). Transfected cells were screened for cDNA-encoded proteins that were capable of pairing with DAP12 and translocating FLAG-tagged DAP12 to the cell surface. Cell surface DAP12 was then visualized using the anti-FLAG M2 mAb (Kodak, Rochester, NY) and PE-conjugated goat anti-mouse second step (Caltag, Burlingame, CA). Cells expressing surface FLAG-DAP12 were sorted on a FACS cell sorter (BD Biosciences), and plasmid DNA was recovered. After three rounds of cell sorter selection, single plasmid colonies were used for transfection, and positive clones were selected and DNA inserts sequenced. mCD200RLb was identified by homology search of the NCBI EST database and a full-length cDNA isolated by standard PCR cloning techniques from mouse bone marrow-derived mast cells. mCD200RLc was identified by homology search of the NCBI EST database. A full-length clone of mCD200RLc has not yet been isolated; however, mCD200RLc is
90% identical at the amino acid level with mCD200RLa.
Analysis of the human and mouse genomes
The NCBI human and mouse genome databases were searched using BLAST (12), and corresponding genes and related genes were identified.
Ability of CD200RL proteins to pair with DAP12
cDNAs encoding full-length hCD200RLa, mCD200RLa, and mCD200RLb were subcloned into the pMX-pie retrovirus expression vector. Plasmid DNAs representing the various genes were transfected into the Phoenix ecotropic virus packaging cell line (G. Nolan), and the viruses subsequently obtained were used to infect Ba/F3-mDAP12 cells, as previously described (11). In the absence of a pairing partner, FLAG-tagged DAP12 remains within the cytoplasm of Ba/F3-mDAP12; however, if the CD200RL proteins can pair with DAP12, the FLAG epitope will appear on the cell surface of Ba/F3-mDAP12. After 12 wk in selection conditions, the Ba/F3-mDAP12 cells infected with the various CD200RL genes were analyzed by flow cytometry for the surface expression of the FLAG epitope of DAP12 (anti-M2 Ab; Sigma-Aldrich, St. Louis, MO). These cells were also stained with mAbs specific for the various CD200RL proteins.
CD200 binding to CD200R and CD200RL proteins
Fusion proteins, consisting of the extracellular domains of mCD200 and hCD200 fused to the Fc region of hIg (mCD200-hIg, hCD200-hIg), were used to investigate the ability of the mouse and human CD200R and CD200RL proteins to bind a soluble form of CD200. Stable transfectants of Ba/F3-expressing mCD200R, hCD200R, and Ba/F3-mDAP12-expressing mCD200RLa or mCD200RLb were generated by retroviral infections, as previously described. One microgram of mCD200-hIg, hCD200-hIg, or control-hIg was used to stain
106 cells of the various receptor transfectants for 20 min at 4°C. After washing, the cells were then stained with a PE-conjugated goat anti-hIg Ab (20 min at 4°C; Caltag), washed, and analyzed on a FACScan (BD Biosciences). For receptor Ab-blocking experiments, blocking mAbs against the CD200Rs were incubated with cells (2 µg/106 cells) for 20 min at 4°C before the addition of the mouse or human CD200-hIgs.
Construction, expression, and purification of soluble recombinant proteins
The CD200-hIg fusion proteins contain two CD200 extracellular regions, but for kinetic studies a monomeric hCD200CD4d3+4 was expressed by CHO.K1 cells using the expression vector pEE14 and subsequently purified from spent tissue culture medium by immunoaffinity chromatography using an OX68 mAb-Sepharose 4B column (3). Before BIAcore analysis, the purified CD200 protein was fractionated by gel filtration on a Superdex S-200 column (Pharmacia, Uppsala, Sweden) to exclude larger protein aggregates that are known to influence binding measurements. The soluble biotinylated forms of rat and mouse CD200R were produced, as described (3), and the human form was generated in an identical fashion after amplifying the entire extracellular region (including the signal sequence) using oligonucleotides gaaatctagaaaacagaaatgctctgcccttggag (sense with XbaI site underlined) and tttggcagtcgacacaggaagtagctctatgtacagactc (antisense with SalI site) in the pEF-BOS-CD4d3+4bio-XB vector (14). The boundary of the hCD200R protein with CD4 domain 3 was ELLPVSTSIT (CD4 linker in bold).
Measurement of affinities using surface plasmon resonance
Affinity and kinetic data were collected using a BIAcore 2000 at 37°C, as described (3). Briefly,
5,000 response units (RU) of streptavidin were coupled to a CM5 research grade chip using amine coupling. In separate experiments, biotinylated rat, mouse, or human CD200RCD4d3+4 proteins were immobilized at high (
1,600 RU), medium (
850 RU), and low (
400 RU) levels in three flow cells and control CD4d3+4 (
2,200 RU) in the fourth flow cell. Serially diluted monomeric hCD200CD4d3+4 purified soluble chimeric proteins were then injected at the indicated active concentrations over all four flow cells connected in series. The extinction coefficient, 40,534 M-1cm-1, was determined by amino acid analysis. The minimal fraction of purified protein able to bind the hCD200R was determined by depletion using avidin-Sepharose agarose beads (Sigma-Aldrich) coated in biotinylated rat CD200RCD4d3+4 as compared with biotinylated CD4d3+4. Depleted and control fractions were resolved by SDS-PAGE and densitometrically analyzed using ImageQuant software. At least 90% of hCD200 protein could be depleted by rat CD200R, and active protein concentration was calculated by taking this into account. KD values were obtained by both nonlinear curve fitting and Scatchard transformations to the binding data. The koff binding rate constant was obtained by fitting a 1:1 binding model to the kinetic data using the BIA evaluation 3.0 software, and these data are shown in Table I. In addition, koff rate constants were also determined by fitting a first order exponential decay curve to normalized data over the dissociation phase (see Fig. 4c), and these were in good agreement.
|
|
For the determination of gene expression, previously described cDNA libraries generated from a variety of mouse and human cell types and tissues were used (15). Gene expression was determined by real-time quantitative PCR using an ABI GeneAmp 5700 sequence detection system and the reporter fluorescent dye, SYBR (PerkinElmer Applied Biosystems, Foster City, CA). In brief, 20 ng of cDNA in PCR buffer contained 200 µM dATP, dCTP, and dGTP; 400 µM dUTP; 4 mM MgCl2; 1.25 U of AmpliTaq DNA polymerase; 0.5 U Amp-Erase uracil-N-glycocylase; 900 nM of each primer; and 250 nM probe. The thermal cycling conditions were: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of amplification at 95°C for 15 s and 60°C for 1 min for denaturing and anneal extension, respectively. PCR amplification of the housekeeping gene ubiquitin was performed for each sample to control for sample loading and to allow for normalization between samples, according to the manufacturers instructions (PerkinElmer). Each data point was evaluated for integrity by analysis of amplification plots and dissociation curves and the ubiquitin normalized data were expressed as the fold gene expression. Primers used in this study were designed with Primer Express software (PerkinElmer). The following primers were used (sense primer is given first): mCD200R, AGGAG GATGAAATGCAGCCTTA, TGCCTCCACCTTAGTCACAGTATC;mCD200RLa, GGAGGACTCTGGCTTTGATGTTA, CCCGTCCTTTCAC TGAACAAC; mCD200RLb, CCATAGAACTGAGTCAAGGTACAATGA, TCCTACGTTAAGAAGAATAATCACCAAA; hCD200R, TGGGAGGTCCACAATGTGTCTA, TGTACAGACTCTTGTTGCCAGTCA.
Flow cytometry
Flow cytometric analysis was performed on freshly isolated peripheral blood leukocytes from normal 5- to 7-wk C57BL/6 mice, normal human peripheral blood leukocytes, and human monocyte-derived dendritic cells, as previously described (16). C57BL/6 splenocytes were also analyzed for the expression of mCD200R and mCD200RL proteins. Cells were incubated with biotinylated rat mAbs specific for mouse or human CD200 receptor family members (or appropriate isotype controls) for 20 min at 4°C, washed, and then stained with a PE-conjugated streptavidin (CalTag, Burlingame, CA). After blocking with a cocktail of mouse and rat serum, the cells were incubated for 20 min with FITC-conjugated and CyChrome-conjugated mAbs against leukocyte differentiation Ags, after which the cells were washed, fixed, and analyzed using a FACScan (BD Biosciences).
| Results |
|---|
|
|
|---|
EST databases were screened using rat CD200R cDNA, and a candidate sequence for the hCD200R was identified and named hCD200R. cDNA clones were isolated from human lung cDNA by PCR, and sequencing revealed two alleles that differed at 3 aa in the extracellular region (Fig. 1). In addition, an alternative variant (hCD200Ri) was identified that contained an extra segment of sequence contiguous to the signal peptide that corresponded to an exon and thus presumably represents an alternatively spliced variant cDNA (Fig. 1). The hCD200R is a type I cell surface glycoprotein containing two Ig-like domains in the common V/C2 set arrangement (17) with a hydrophobic transmembrane sequence and a substantial cytoplasmic region. A comparison of this sequence with that of the rodent CD200 receptors showed that all the extracellular cysteine residues were conserved and the protein was also highly glycosylated, containing eight potential N-linked glycosylation sites (Fig. 1). All three tyrosine residues that are predicted to lie in the cytoplasmic portion of the molecule were also conserved, and the rat protein has been shown to be phosphorylated upon pervanadate treatment (3). Phylogenetic analysis of CD200R and proteins shown to have the highest levels of similarity from database searches revealed some sequence similarity to the ligand, CD200, and other Ig superfamily members (Fig. 2), as reported previously (3). hCD200R showed closest similarity to human herpesvirus entry protein HveC and related proteins HveB (nectin2) and HveD (poliovirus receptor or CD155). HveC, previously known as poliovirus-related protein PRR1, permits entry of herpes simplex viruses through interaction with the envelope glycoprotein D (18, 19).
|
To analyze the ability of mouse and human CD200R to bind CD200, we used soluble fusion proteins consisting of the extracellular domains of mouse and human CD200 fused to the Fc binding domain of hIg and Ba/F3 cell transfectants expressing either mCD200R or hCD200R. As shown in Fig. 3, mCD200 and hCD200 bound to their respective receptors, and ligand binding could be completely blocked by specific mAb to these receptors (see below).
|
0.5 µM at 37°C. Kinetic analysis of the interaction yielded an off rate
0.1 s-1 - (equivalent to a t1/2 of 7 s) at different levels of hCD200R immobilization, indicating that kinetic measurements were not grossly affected by rebinding or mass transport effects (Fig. 4C). These measurements were repeated using soluble biotinylated forms of both the rat and mouse CD200R produced in an identical manner, and the data are presented in Table I. This revealed that the hCD200 interacted with CD200R with similar kinetics to the equivalent interaction in rats and mice. hCD200 showed some cross species binding to both mouse and rat CD200R, but binding to mCD200R was weaker, with about a 10-fold faster dissociation rate that explained why hCD200-hIg did not bind mCD200R (data not shown). Identification and structural characterization of genes related to CD200R in mice and humans
In addition to the mCD200R cloned previously (3), two cDNAs for genes closely related to CD200R were isolated from normal bone marrow-derived mouse mast cells. These two proteins, named mCD200RLa and mCD200RLb, showed extensive sequence similarity in the extracellular regions to the mCD200R, but displayed short cytoplasmic regions devoid of known signaling motifs. Unlike mCD200R, the transmembrane regions of these two genes contained a positively charged amino acid, lysine (Fig. 1). Because mCD200RLa was also isolated by DAP12 trapping (see Materials and Methods), the lysine in the transmembrane was expected to form a salt bridge with DAP12, allowing these proteins to pair. Transduction of mCD200RLa and mCD200RLb into Ba/F3 cells stably expressing a FLAG-tagged murine DAP12 resulted in the cell surface expression of DAP12 and the associated CD200RL proteins (Fig. 5).
|
200 kbp) and within
400 kbp of the CD200 gene itself.
|
Distribution of CD200R and CD200RL gene products by mRNA analysis
The distribution of CD200R was determined by a highly sensitive quantitative RT-PCR method in a panel of cDNA libraries from a variety of purified cell types and normal tissues from both mice and humans (Figs. 7 and 8). Using PCR primers that specifically identify CD200R mRNA, it was clear that CD200R shared a similar cellular and tissue distribution in both species. The highest levels of expression were observed in bone marrow-derived macrophages from the mouse, and monocyte-derived dendritic cells in humans. Significant gene expression, however, was also seen in polarized Th2 T cells, mast cells, and dendritic cells of both mice and humans. Interestingly, although mouse bone marrow-derived macrophages expressed very high levels of CD200R mRNA, freshly isolated human peripheral blood monocytes expressed only low levels of CD200R mRNA. The differentiation status of these particular cell types is, however, not comparable, and it is thus possible that CD200R expression is up-regulated on tissue macrophages. B cells, fibroblasts, and endothelial cells from both mice and humans expressed little, if any, detectable CD200R mRNA. In whole tissues, the highest expression of CD200R mRNA was observed in bone marrow, lymph nodes, spleen, and lung, while the lowest expression was seen in liver, spinal cord, and kidney (Figs. 7 and 8). Tissue macrophages of the CNS (microglia) are known to express low levels of CD200R in the rat (3); however, in whole spinal cord tissues, the level of mRNA contributed by these cells was negligible. The thymus was the only tissue that showed differential expression between mice and humans. Mouse thymus showed significant expression of CD200R mRNA, whereas human thymus had essentially undetectable levels.
|
|
RI. Strong mCD200RLa expression was also seen in bone marrow-derived macrophages and dendritic cells, and to a lesser extent in polarized Th2 T cells. mCD200RLb, however, was primarily expressed in mast cells and polarized Th2 T cells and to a lesser degree in bone marrow-derived dendritic cells. Unlike mCD200R and mCD200RLa, mCD200RLb was undetectable in bone marrow-derived macrophages and was expressed at relatively low levels in bone marrow-derived dendritic cells. cDNA for hCD200RLa was isolated from peripheral blood, but was not found in significant levels in cDNA libraries. Analysis of the amino acid sequence revealed that it lacked two cysteines when compared with the mouse homologue and other genes in this group (Fig. 1). This may explain why hCD200RLa was not expressed even in the presence of DAP12, DAP10, Fc
R1
, or CD3
. Indeed, reintroducing the cysteine residues restored expression in the presence of DAP12 (G. Brooke, unpublished data). It is likely therefore that hCD200RLa is nonfunctional in humans. Distribution of mouse and human CD200R by mAb staining
mAb specific for mCD200R and hCD200R were generated to investigate the cellular distribution of the CD200R protein. In mouse peripheral blood, mCD200R (DX109) was strongly expressed on all granulocytes (CD11b+, Gr-1++) and monocytes (CD11b++, Gr-1-) with weaker labeling of most T cells (CD3+) (Fig. 9). T cell staining for CD200R was primarily restricted to CD4+ T cells (data not shown). Weak mCD200R expression was observed on a subset of NK cells (DX5+, CD3-), NKT cells (CD3+, DX5+), and B cells (CD19+). In the spleen, mCD200R showed an identical cellular expression pattern to that observed in the peripheral blood, although with somewhat higher levels of expression of CD200R on splenic T cells (data not shown). Consistent results were obtained with another rat anti-mouse CD200R mAb OX110 (data not shown).
|
RI++; data not shown) expressed high levels of hCD200R. Similar to mouse peripheral blood, the majority of human monocytes expressed moderate levels of hCD200R; this expression was significantly up-regulated when monocytes were induced to differentiate into dendritic cells in vitro (CD14+/-, HLA-DR++) in the presence of GM-CSF and IL-4 (data not shown). The majority of NK cells (CD56+, CD3-) did not express hCD200R. Low levels of hCD200R expression, however, were observed on a subset of the CD56 bright NK cells (CD56++, CD3-) as well as NKT cells (CD56+, CD3+). A small subset of B cells (CD19+) demonstrated hCD200R expression in most donors analyzed. hCD200R was not expressed on freshly isolated peripheral blood platelets or RBC (data not shown). Similar results were obtained with an anti-human mCD200R mAb OX108 (data not shown).
|
Rat mAb specific for mCD200RLa (DX87) and mCD200RLb (DX116) were generated to investigate the expression of these proteins on mouse leukocytes. Unlike mCD200R, mCD200RLa was not expressed on T cells (Fig. 11). Strong expression of mCD200RLa was observed on NK cells, monocytes, and a subset of NKT cells, while low expression was seen on B cells and granulocytes. Although data for peripheral blood leukocytes are shown, similar expression patterns were also observed on splenic populations of leukocytes (data not shown). mCD200RLb, although strongly expressed on bone marrow-derived mast cells (data not shown), was not significantly expressed on peripheral blood leukocytes (Fig. 11).
|
To analyze the ability of mCD200 to bind mCD200RLa and mCD200RLb, we used soluble fusion proteins consisting of the extracellular domains of mCD200 fused to the Fc binding domain of hIg and Ba/F3 cell transfectants expressing either mCD200RLa or mCD200RLb. Although mCD200-hIg readily bound to transfectants expressing the mCD200R protein (Fig. 3), we were unable to demonstrate any significant binding of mCD200 to either the mCD200RLa or mCD200RLb proteins (data not shown). Attempts to demonstrate mCD200 binding to these receptors by varying mCD200 concentrations, binding times, and binding temperatures have also failed to show specific receptor binding. Presumably, mCD200RLa and mCD200RLb bind alternative ligands despite the relatively high sequence similarity to the mCD200R.
| Discussion |
|---|
|
|
|---|
Analysis of mRNA expression in mouse and human cDNA libraries reveals that CD200R is expressed in a variety of cell types of the myeloid/monocytic lineage, in particular, macrophages, dendritic cells, and mast cells. Interestingly, CD200R mRNA is also highly expressed in polarized Th2 T cells in both mice and humans, indicating that this receptor may have a more extensive immunological role than previously anticipated because it has a broader distribution than observed with the original anti-rat CD200R mAb (3). mAbs specific for mCD200R and hCD200R were generated to investigate the expression of CD200R protein on freshly isolated leukocyte populations. In both mice and humans, CD200R is prominently expressed on peripheral blood neutrophils. Because neutrophils play a major role in most inflammatory responses (23), the high expression levels of CD200R suggest that this receptor may play an important regulatory role in neutrophil biology; this concept has been reviewed (5). Experiments are presently underway to investigate the functional role of CD200R in neutrophil phagocytosis, superoxide production, and chemokine responses.
As expected from the mRNA distribution analysis, CD200R is also expressed on freshly isolated CD4+ T cells from mouse and human peripheral blood. The mRNA analysis showed a restricted expression of CD200R to polarized Th2 cells; however, cellular expression of the protein indicates that the majority of CD4+ T cells in the mouse and human peripheral blood expressed CD200R. It is possible that CD200R is down-regulated by the cytokines required to polarize Th1 cells, while remaining stably expressed on committed Th2 cells. The expression of CD200R on Th2 cells has important implications for immune regulation. Th2 cells have been strongly implicated in variety of pathological conditions, including allergy, asthma, and hypersensitivity (24, 25, 26, 27). Proinflammatory cytokines, such as IL-3, IL-4, IL-5, IL-13, and GM-CSF, are produced by Th2 cells and are believed to be the major factors in allergic pathologies, such as inflammation, mucous hypersecretion, and airway constriction. The strong expression of CD200R, an inhibitory receptor, on Th2 cells may indicate that this receptor plays an important regulatory role in Th2-mediated responses. The expression of CD200R on Th2 cells also suggests that therapeutic strategies directed toward triggering CD200R on Th2 cells may function to inhibit allergic inflammation and associated pathologies. The distribution of CD200R and related proteins is summarized in Table II.
|
Mast cells, which are derived from hemopoietic progenitors, play a critical effector role in allergic diseases and IgE-dependent immune responses. Engagement of the high affinity FcR for IgE on mast cells and basophils triggers a series of biochemical events resulting in the secretion of a variety of inflammatory mediators, including histamine, sulfated proteoglycans, proteinases, and cytokines (28). The prominent expression of CD200R on both mouse and human mast cells suggests that this receptor may function as a constitutive regulator of mast cell biological responses. Although we have not yet investigated the expression of CD200R on freshly isolated mast cells, mast cells derived from hemopoietic progenitors clearly express both high levels of specific mRNA for CD200R as well as cell surface protein (data not shown). Previous in vivo studies have implicated the CD200R in the regulation of experimental autoimmune encephalomyelitis (EAE) and collagen-induced arthritis (3, 4, 7). The conclusion from these studies was that CD200R played a major role in the regulation of these autoimmune models by modulating macrophage function. Macrophages are known to contribute to the onset and severity of brain inflammation in the EAE model (29). Several recent studies using mast cell-deficient mice, however, have shown that EAE and collagen-induced arthritis are dependent upon functional mast cells (30, 31). It is possible, therefore, that some of the effects of CD200R in these models are manifested through the regulation of mast cell functions. The molecular and biological functions of CD200R expression on mast cells are presently a major focus of ongoing studies.
Two of the mouse genes of the CD200 receptor family (mCD200RLa and mCD200RLb) associate with DAP12 and require DAP12 for stable cell surface expression. DAP12 is a small disulfide-bonded homodimer that is structurally similar to Fc
RI
chain and the TCR
chain (32, 33). The transmembrane domain of DAP12 contains a negatively charged aspartic acid residue that allows pairing with a variety of cell surface receptors with positively charged amino acid residues in their transmembrane regions. The cytoplasmic domain of DAP12 contains a consensus immunoreceptor tyrosine-based activation motif, which when phosphorylated recruits protein tyrosine kinases (32, 33, 34, 35). Pairing of mCD200RLa and mCD200RLb with DAP12 clearly defines these proteins as potentially activating receptors. mCD200RLa and mCD200RLb do not bind mCD200, despite extensive sequence similarity in the extracellular regions at least for CD200RLa (84 and 39% identity for CD200RLa and CD200RLb with CD200R, respectively). The ligands of CD200RLa and CD200RLb and the functional and biological significance of these receptors are unknown; however, it is possible that these receptors have evolved to interact with viral proteins in a manner similar to that recently described for a DAP12 pairing member of the Ly-49 family and mouse CMV (36, 37). The human homologue of mCD200RLa, hCD200RLa, is structurally very similar to the mouse gene, including the positively charged residue in the transmembrane domain. It seems likely that hCD200RLa is a nonfunctional gene, as no expression could be detected despite many attempts with a variety of adapter molecules.
CD200R is a member of a group of proteins expressed on myeloid cells, but we now report expression on many T cells in mouse and human in contrast to earlier data in the rat (3). In the mouse, there is clearly a form that can give an activating signal through DAP12, and in this regard it resembles other gene families such as signal regulatory proteins and killer Ig-related receptors that have both activating and inhibitory forms (38, 39, 40, 41). Manipulating the CD200R has been shown to affect immune responses, but these data indicate that the cells being affected may include both myeloid cells and T cells. Importantly, the definition of a family of closely related CD200R-like proteins (at least in the mouse) suggests that different effects in vivo and in vitro may be expected using CD200-Fc fusion proteins, shown in this study to be specific for CD200R, and Abs against the various related members that may show different cross-reactivities.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Wellcome Trust Sanger Institute, Genome Campus, Hinxton, Cambridge CB10 1SA, U.K. ![]()
3 G.J.W., H.C., J.H.P., and A.N.B. contributed equally to this study. ![]()
4 Address correspondence and reprint requests to Dr. A. Neil Barclay, Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, U.K. E-mail address: Neil.Barclay{at}path.ox.ac.uk, or Dr. Joseph H. Phillips, DNAX Research, 901 California Avenue, Palo Alto, CA 94304-1104. E-mail address: joe.phillips{at}dnax.org ![]()
5 Abbreviations used in this paper: CD200RL, CD200 receptor-like; EAE, experimental autoimmune encephalomyelitis; h, human; m, mouse; RU, response unit; EST, expressed sequence tag. ![]()
Received for publication April 14, 2003. Accepted for publication July 9, 2003.
| References |
|---|
|
|
|---|
(PRR2
or HveB) and nectin2
are low-efficiency mediators for entry of herpes simplex virus mutants carrying the Leu25Pro substitution in glycoprotein D. J. Virol. 74:1267.
with KARAP/DAP-12. Eur. J. Immunol. 30:2147.[Medline]
This article has been cited by other articles:
![]() |
R. Mihrshahi, A. N. Barclay, and M. H. Brown Essential Roles for Dok2 and RasGAP in CD200 Receptor-Mediated Regulation of Human Myeloid Cells J. Immunol., October 15, 2009; 183(8): 4879 - 4886. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, M. Stanford, J. Liu, C. Barrett, L. Jiang, A. N. Barclay, and G. McFadden Inhibition of Macrophage Activation by the Myxoma Virus M141 Protein (vCD200) J. Virol., September 15, 2009; 83(18): 9602 - 9607. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Gorczynski, Z. Chen, W. He, I. Khatri, Y. Sun, K. Yu, and I. Boudakov Expression of a CD200 Transgene Is Necessary for Induction but Not Maintenance of Tolerance to Cardiac and Skin Allografts J. Immunol., August 1, 2009; 183(3): 1560 - 1568. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gorczynski, I. Khatri, L. Lee, and I. Boudakov An Interaction between CD200 and Monoclonal Antibody Agonists to CD200R2 in Development of Dendritic Cells That Preferentially Induce Populations of CD4+CD25+ T Regulatory Cells J. Immunol., May 1, 2008; 180(9): 5946 - 5955. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kojima, K. Obata, K. Mukai, S. Sato, T. Takai, Y. Minegishi, and H. Karasuyama Mast Cells and Basophils Are Selectively Activated In Vitro and In Vivo through CD200R3 in an IgE-Independent Manner J. Immunol., November 15, 2007; 179(10): 7093 - 7100. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lyons, E. J. Downer, S. Crotty, Y. M. Nolan, K. H. G. Mills, and M. A. Lynch CD200 Ligand Receptor Interaction Modulates Microglial Activation In Vivo and In Vitro: A Role for IL-4 J. Neurosci., August 1, 2007; 27(31): 8309 - 8313. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kretz-Rommel, F. Qin, N. Dakappagari, E. P. Ravey, J. McWhirter, D. Oltean, S. Frederickson, T. Maruyama, M. A. Wild, M.-J. Nolan, et al. CD200 Expression on Tumor Cells Suppresses Antitumor Immunity: New Approaches to Cancer Immunotherapy J. Immunol., May 1, 2007; 178(9): 5595 - 5605. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Chitnis, J. Imitola, Y. Wang, W. Elyaman, P. Chawla, M. Sharuk, K. Raddassi, R. T. Bronson, and S. J. Khoury Elevated Neuronal Expression of CD200 Protects Wlds Mice from Inflammation-Mediated Neurodegeneration Am. J. Pathol., May 1, 2007; 170(5): 1695 - 1712. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Moreaux, D. Hose, T. Reme, E. Jourdan, M. Hundemer, E. Legouffe, P. Moine, P. Bourin, M. Moos, J. Corre, et al. CD200 is a new prognostic factor in multiple myeloma Blood, December 15, 2006; 108(13): 4194 - 4197. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fujimoto, H. Takatsu, and H. Ohno CMRF-35-like molecule-5 constitutes novel paired receptors, with CMRF-35-like molecule-1, to transduce activation signal upon association with FcR{gamma} Int. Immunol., October 1, 2006; 18(10): 1499 - 1508. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. R. Rezaee, C. Cunningham, A. J. Davison, and D. J. Blackbourn Kaposi's sarcoma-associated herpesvirus immune modulation: an overview J. Gen. Virol., July 1, 2006; 87(7): 1781 - 1804. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Orabona, P. Puccetti, C. Vacca, S. Bicciato, A. Luchini, F. Fallarino, R. Bianchi, E. Velardi, K. Perruccio, A. Velardi, et al. Toward the identification of a tolerogenic signature in IDO-competent dendritic cells Blood, April 1, 2006; 107(7): 2846 - 2854. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang and J. H. Phillips Identification of tyrosine residues crucial for CD200R-mediated inhibition of mast cell activation J. Leukoc. Biol., February 1, 2006; 79(2): 363 - 368. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Suzuki, F. Schirra, S. M. Richards, N. S. Treister, M. J. Lombardi, P. Rowley, R. V. Jensen, and D. A. Sullivan Estrogen's and Progesterone's Impact on Gene Expression in the Mouse Lacrimal Gland Invest. Ophthalmol. Vis. Sci., January 1, 2006; 47(1): 158 - 168. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Jenmalm, H. Cherwinski, E. P. Bowman, J. H. Phillips, and J. D. Sedgwick Regulation of Myeloid Cell Function through the CD200 Receptor J. Immunol., January 1, 2006; 176(1): 191 - 199. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. van Beek, F. Cochrane, A. N. Barclay, and T. K. van den Berg Signal Regulatory Proteins in the Immune System J. Immunol., December 15, 2005; 175(12): 7781 - 7787. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fallarino, C. Orabona, C. Vacca, R. Bianchi, S. Gizzi, C. Asselin-Paturel, M. C. Fioretti, G. Trinchieri, U. Grohmann, and P. Puccetti Ligand and cytokine dependence of the immunosuppressive pathway of tryptophan catabolism in plasmacytoid dendritic cells Int. Immunol., November 1, 2005; 17(11): 1429 - 1438. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Shiratori, M. Yamaguchi, M. Suzukawa, K. Yamamoto, L. L. Lanier, T. Saito, and H. Arase Down-Regulation of Basophil Function by Human CD200 and Human Herpesvirus-8 CD200 J. Immunol., October 1, 2005; 175(7): 4441 - 4449. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hatherley, H. M. Cherwinski, M. Moshref, and A. N. Barclay Recombinant CD200 Protein Does Not Bind Activating Proteins Closely Related to CD200 Receptor J. Immunol., August 15, 2005; 175(4): 2469 - 2474. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Cameron, J. W. Barrett, L. Liu, A. R. Lucas, and G. McFadden Myxoma Virus M141R Expresses a Viral CD200 (vOX-2) That Is Responsible for Down-Regulation of Macrophage and T-Cell Activation In Vivo J. Virol., May 15, 2005; 79(10): 6052 - 6067. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-X. Chen, H. He, and R. M. Gorczynski Synthetic peptides from the N-terminal regions of CD200 and CD200R1 modulate immunosuppressive and anti-inflammatory effects of CD200-CD200R1 interaction Int. Immunol., March 1, 2005; 17(3): 289 - 296. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Cherwinski, C. A. Murphy, B. L. Joyce, M. E. Bigler, Y. S. Song, S. M. Zurawski, M. M. Moshrefi, D. M. Gorman, K. L. Miller, S. Zhang, et al. The CD200 Receptor Is a Novel and Potent Regulator of Murine and Human Mast Cell Function J. Immunol., February 1, 2005; 174(3): 1348 - 1356. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Taylor, K. McConnachie, C. Calder, R. Dawson, A. Dick, J. D. Sedgwick, and J. Liversidge Enhanced Tolerance to Autoimmune Uveitis in CD200-Deficient Mice Correlates with a Pronounced Th2 Switch in Response to Antigen Challenge J. Immunol., January 1, 2005; 174(1): 143 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Voehringer, D. B. Rosen, L. L. Lanier, and R. M. Locksley CD200 Receptor Family Members Represent Novel DAP12-associated Activating Receptors on Basophils and Mast Cells J. Biol. Chem., December 24, 2004; 279(52): 54117 - 54123. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang, H. Cherwinski, J. D. Sedgwick, and J. H. Phillips Molecular Mechanisms of CD200 Inhibition of Mast Cell Activation J. Immunol., December 1, 2004; 173(11): 6786 - 6793. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fallarino, C. Asselin-Paturel, C. Vacca, R. Bianchi, S. Gizzi, M. C. Fioretti, G. Trinchieri, U. Grohmann, and P. Puccetti Murine Plasmacytoid Dendritic Cells Initiate the Immunosuppressive Pathway of Tryptophan Catabolism in Response to CD200 Receptor Engagement J. Immunol., September 15, 2004; 173(6): 3748 - 3754. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Chen, K. Doffek, S. L. Sugg, and J. Shilyansky Phosphatidylserine Regulates the Maturation of Human Dendritic Cells J. Immunol., September 1, 2004; 173(5): 2985 - 2994. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Foster-Cuevas, G. J. Wright, M. J. Puklavec, M. H. Brown, and A. N. Barclay Human Herpesvirus 8 K14 Protein Mimics CD200 in Down-Regulating Macrophage Activation through CD200 Receptor J. Virol., July 15, 2004; 78(14): 7667 - 7676. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gorczynski, Z. Chen, Y. Kai, L. Lee, S. Wong, and P. A. Marsden CD200 Is a Ligand for All Members of the CD200R Family of Immunoregulatory Molecules J. Immunol., June 15, 2004; 172(12): 7744 - 7749. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Han, O. D. Goularte, K. Rufner, B. Wilkinson, and J. Kaye An Inhibitory Ig Superfamily Protein Expressed by Lymphocytes and APCs Is Also an Early Marker of Thymocyte Positive Selection J. Immunol., May 15, 2004; 172(10): 5931 - 5939. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Rosenblum, E. Olasz, J. E. Woodliff, B. D. Johnson, M. C. Konkol, K. A. Gerber, R. J. Orentas, G. Sandford, and R. L. Truitt CD200 is a novel p53-target gene involved in apoptosis-associated immune tolerance Blood, April 1, 2004; 103(7): 2691 - 2698. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |