| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Institut National de la Santé et de la Recherche Médicale, Unité 429, Hôpital Necker-Enfants Malades, Paris, France
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, C
, or C
) ensues, leading to the production of IgG, IgA, and IgE harboring the same V specificity (3, 6). A defect in the activation-induced cytidine deaminase (AID) protein (7) has been shown to lead to a dramatic decrease in the somatic hypermutation rate and inhibition of CSR in both hyper-IgM type 2 syndrome (HIGM2) patients (8) and AID-/- mice (9), suggesting that these two processes share a common mechanism. AID has also been shown to be absolutely required for SHM in vitro (10). Both CSR and SHM mechanisms require DNA breaks (11, 12, 13), which can lead subsequently to dsDNA breaks (DSBs). The occurrence of SHM-induced DSBs in the V region is controversial (10, 14, 15). In contrast, CSR-induced DSBs have been well established in mice, since CSR-induced DSBs have been reported in S regions (11), and CSR has been shown to require the repair protein histone H2AX (16) and the nonhomologous end-joining repair pathway, which is known to be involved in DSB repair (17, 18, 19). However, it has been recently shown that CSR can occur in the absence of DNA protein kinase activity (6, 20). The requirement for DNA breaks in both CSR and SHM raises the hypothesis that AID could be involved directly or indirectly in DNA break formation. Because of its homology with APOBEC-1, an RNA-editing enzyme (7), it has been proposed that AID might be an RNA-editing enzyme acting on endonuclease-encoding RNAs (3, 21). It has recently been shown that AID could also act on DNA by deaminating cytidine residues (22, 23). Both mechanisms could lead to AID-dependent DNA breaks. Although the requirement for AID in the generation of DSBs in the S region during CSR has never been shown directly, Petersen et al. (16) demonstrated that AID is, however, required for the formation of nuclear foci associated to DSBs repair during CSR. These data suggest that AID is involved either in DNA break formation or in a postcleavage event necessary for the formation of repair foci.
To test both hypotheses, DSB generation in CSR-induced B cells from HIGM2 patients presenting various mutations in the AID gene (8) was studied using ligation-mediated PCR (LM-PCR) (15). Our results strongly suggest that AID plays a crucial role in the induction of DNA breakage during CSR.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Eight patients from five families with HIGM2 syndrome, characterized by defective class switch recombination and defective generation of somatic hypermutations, were enrolled in the study after informed consent was obtained. Biallelic mutations in the AID gene were found in all patients, as previously described for six of eight patients: YS, ES, HS, YB, MB, and MR, i.e., P1-P6 in Ref. 8 . The other two patients (JT and YK) carry a homozygous missense mutation in exon 3 (Table I)
|
Frozen tonsil biopsies from a control and an AID-deficient patient (YB) were incubated overnight at 37°C in lysis buffer (48% urea, 2% SDS, 10 mM EDTA, 0.3 M NaCl, and 10 mM Tris) with 100 µg of proteinase K (Roche, Indianapolis, IN). DNA was extracted with phenol chloroform, precipitated with ethanol and 0.2 M NaCl, washed with 70% ethanol, and resuspended in TE buffer (10 mM Tris-HCl (pH 8) and 1 mM EDTA).
Cell activation
To study activated B cells, PBMC were isolated by Ficoll-Hypaque (Axis-Shield PoC AS, Oslo, Norway) density gradient centrifugation. PBMC were activated with 500 ng/ml recombinant soluble CD40 ligand (sCD40-L; Immunex, Seattle, WA) and 100 U/ml rIL-4 (R&D Systems, Minneapolis, MN) for 5 days. Proliferation was assessed by [3H]thymidine uptake.
Activated B cells were stained with FITC-conjugated anti-CD19 mAb (Immunotech, Marseilles, France) and propidium iodide (PI; Sigma-Aldrich, Taufkirchen, Germany) to stain dead cells and were then sorted by FACS using a FACStarPlus flow cytometer (BD Biosciences, Franklin Lakes, NJ). Isolated viable activated B cells (CD19+PI-) were >94% pure.
To study activated T cell, PBMC were cultured for 7 days with 50 ng/ml OKT3 mAb (Janssen-Cilag, Scaffhausen, Switzerland) and 40 U/ml rIL-2 (Chiron, Amsterdam, The Netherlands). To purify viable T cells and exclude B cells that might have been activated in culture, activated cells were stained with FITC-conjugated anti-CD4 mAb (Immunotech), FITC-conjugated anti-CD8 mAb (Immunotech), PE-conjugated anti-CD19 mAb (Immunotech), and PI and were sorted by FACS using a FACStarPlus flow cytometer (BD Biosciences). Isolated viable activated T cells (CD4+CD8+CD19-PI-) were >96% pure.
DNA isolation and detection of DNA DSBs by LM-PCR
To avoid adventitious DNA breakage, activated sorted cells was embedded in low melting temperature agarose, and DNA was extracted as described previously (15). LM-PCR was used to detect blunt-ended double-strand breaks. DNA was ligated to the double-stranded blunt end Bw linker as previously described (11) with T4 DNA ligase (Promega, Madison, WI). To verify DNA integrity, exon 2 of AID was amplified by PCR using 1 µl of the plug in all samples and by a semiquantitative PCR in controls and patients YS, HS, and ES, using primers and conditions previously described (8).
Specific amplification was performed using a seminested PCR strategy. For amplification of the Sµ region, DNA extracted from 25,000 cultured purified cells or 250 ng of DNA extracted from tonsil biopsies was used as starting material. Semi-nested PCR were performed using the Bw1 and Sµ ext primers (Sµ ext: atggaagccagcctggctgt) in the primary LM-PCR, and Bw1 and Sµ int primers (Sµ int: agcctggctgtgcaggaacc) in the secondary LM-PCR. Conditions for the first PCR were as follows: denaturation at 94°C for 1 min, annealing at 64°C for 1 min, and extension at 72°C for 2 min. After 25 cycles, extension was continued at 72°C for an additional 10 min. For the second-round amplification, conditions were the same, except for the annealing temperature (67°C) and the number of cycles (24).
Conditions for the amplification of the VH3–23, and Cµ regions were identical with those described for the amplification of the Sµ region, except for the annealing, which was performed at 58°C for the first PCR and at 63°C for the second PCR. Twenty and 25 cycles of amplification were conducted in the first and the second rounds of amplification, respectively. The primers used were VH3–23 ext (cagtggatacgtgtggcagt), VH3–23 int (tggcagtttctgaccaggg), Cµ ext (actctgacatcagcagtacc), and Cµ int (cttcccatcagtcctgagag). Sµ primers sequences are shown in Fig. 2.
|
LM-PCR products were separated on 2% agarose gels, and Southern blotting was performed using gene-specific oligonucleotide 32P-labeled 5' end probes (sp. act., >178,000 cpm/µl). Because the specific activity varies, a positive control was systematically added to each hybridization assay (i.e., LM-PCR product from control B cells for hybridization with the Sµ probe, and LM-PCR product from HincII-digested DNA for hybridization with the Cµ probe). The following probes were used: Sµ (tcagaaatggactcagatgg), VH3–23 (gttcatttgcagatacagcg), and Cµ (aagtacgcagccacctcaca). (exposure time, 24 h)
Cloning and sequencing of LM-PCR products
An aliquot of the purified LM-PCR product was ligated into the pCRII vector. TOP10 chemically competent cells were transformed using the TA cloning kit (Invitrogen, San Diego, CA). Clones were individually sequenced with the Big Dye DNA sequencing kit (PerkinElmer, Norwalk, CT), using M13 forward and reverse primers and an ABI PRISM 377 DNA Sequencer (PE Applied Biosystems, Foster City, CA).
Detection of DSBs in restriction enzyme-digested DNA
DNA from control tonsil biopsies or PBMC (1 µg) was digested overnight at 37°C with HincII restriction enzyme (Promega), which generates blunt ends. In other experiments digested DNA was also diluted with untreated DNA at dilutions from 1/10 to 1/1000. After linker ligation, DSBs were detected in Cµ regions by LM-PCR using 250 ng of total DNA and Cµ hybridization probe.
CSR activity
PBMC were cultured in the presence of 500 ng/ml sCD40-L and 100 U/ml IL-4. On day 5, RNA from activated cells was isolated with TRIzol (Invitrogen), and the presence of I-CH germline and functional VH-C1 and VH-C transcripts was assessed by RT-PCR as previously described (25, 26). IgE was measured in 12-day supernatants by ELISA (25).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To assess at what stage of the CSR process AID is involved, we analyzed the occurrence of DSBs during in vitro CSR using the LM-PCR technique. Peripheral blood B cells from controls (C1–C7) and AID-deficient patients were activated by recombinant sCD40-L and IL-4, a combination known to strongly induce CSR to IgE and IgG in human B cells (25). After 5 days of culture, DNA from CD19+PI- viable B cells purified by FACS was analyzed for the presence of DSBs in the Sµ region. Hybridization with the labeled Sµ probe revealed bands in all 13 samples from seven controls. The number of bands detectable from one donor to another was variable (Fig. 1A). The approximate size of the bands varied from 50–2600 bp. Cloning and sequencing of the LM-PCR products from each control (C1–C7) confirmed that the linker was ligated to the Sµ region at various sites (Fig. 2) in 55% of clones (41 of 75). In the other clones, nonspecific linker-linker ligations were detected.
|
We therefore verified the role of AID in CSR-induced DSBs in HIGM2 patients. In B cells from four patients (YS, HS, ES, and MB), no DSBs were observed after hybridization with the Sµ probe (Fig. 1A). B cells from patients ES and MB were tested twice, giving identical results. In patient MR, very faint bands were detected, but were probably not different from the background observed in T cells (Fig. 1B). In three patients (JT, YK, and YB), however, a small number of breaks could be occasionally detected. In patients YK and JT, cloning and sequencing of LM-PCR products showed that the linker was ligated to the Sµ region at different sites in 
50% of clones (10 of 23 in patient YK, and four of eight in patient JT; Fig. 2).
The defective occurrence of DSB in AID-deficient B cells was not related to a defective sCD40-L plus IL-4 activation as assessed by normal B cell proliferation (mean, 70,410 ± 49,830 cpm for patients vs 59,670 ± 45,420 cpm for control after [3H]thymidine incorporation) and normal expression of I-CH germline transcripts (Fig. 3A). Moreover, a control amplification of the AID gene gave evidence that equivalent amounts of genomic DNA were tested in all samples (Fig. 3B). This was confirmed by a semiquantitative PCR analysis performed for the three patients’ samples available (Fig. 3C).
|
As shown in Table I, all tested AID patients showed defective in vivo CSR. However, a very low level of IgG could only be detected in patient YB’s serum sample. In vitro induction of CSR toward IgE of patients B cells by sCD40-L and IL-4 was also absent, as determined by the IgE concentration in culture supernatants (<0.1 vs 8–32 pg/ml in controls) and by the analysis of VH-C functional transcripts (Table I and Fig. 3A). Based on our experience and data reported in the literature (27), IgG1 is the main IgG isotype produced by B cells after in vitro stimulation with sCD40-L and IL-4. Consequently, the presence of functional VH-C1 transcripts was assessed. No functional VH-CH1 transcripts could be detected in B cells of all tested patients (n = 5; Table I). DSB could be inconstantly observed in patient YB, although no CSR could be detected in vitro in the same culture, further suggesting that the LM-PCR technique is highly sensitive. However, in B cells from patient YK, in which a few DSBs in the Sµ region have been reproducibly detected, a transcript larger than VH-CH1 transcripts was detected (data not shown). Sequencing revealed that this transcript corresponded to a unique monoclonal VH-CH3 transcript. VH-CH3 was most likely amplified because of the sequence homology between CH3 and CH1. This result indicates that in these culture conditions, residual CSR might have occurred in this patient’s B cells, which correlates with the detection of DSBs in the Sµ region. As this patient carries a homozygous mutation (A415G) in the AID gene, resulting in a missense mutation (M139V), it could be hypothesized that residual AID activity might account for residual induction of DNA breaks in the Sµ region and residual induction of CSR. This does not exclude some, as yet unexplained, variations unrelated to the AID activity level, as shown by minute variations in serum levels of IgG and DSBs occurrence in siblings YB and MB (Table I and Fig. 1A).
Detection of DNA DSB in the VH region
Since previous data have shown the occurrence of DSBs during SHM (14, 15), even in AID-deficient murine B cells (28, 29), we checked for the occurrence of DSBs in VH regions of DNA extracted from control and AID-deficient tonsils using the LM-PCR technique.
In control DNA, several bands were revealed following hybridization with the VH3–23 probe (Fig. 1D), providing evidence of frequent occurrence of DSBs in the VH region. Cloning and sequencing of the LM-PCR products showed that in the V(D)J rearranged allele, as well as in the unrearranged allele, the linker was ligated to the VH3–23 region at different sites with similar frequencies (data not shown). No DSB, however, were detected in the Cµ region (Fig. 1C).
In patient YB’s tonsils, DSBs were also detected in the VH3–23 region, and the frequency was similar to that observed in control DNA (Fig. 1D). Patient’s B cells as well as controls displayed DSBs in both rearranged and unrearranged alleles.
Since DNA DSBs were found in both rearranged and unrearranged alleles in tonsils from a control as well as in B cells from an AID-deficient patient, carrying very few SHM (0.1%/bp patient P4 in Ref. 8), it is doubtful that the DNA DSBs are related to SHM, as previously suggested (10, 28). This was confirmed by the detection of DSBs in VH regions from activated T cells (Fig. 1E). DSB were also observed in VH regions from sCD40-L- plus IL-4-activated B cells from controls and patients YS, HS, and ES, although no such DSB were observed in the same experiments in Sµ regions (Fig. 1E). One cannot, however, exclude the possibility that a small fraction of DSBs in the V region observed in control B cells might truly be related to SHM (14, 15).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
It was not possible to analyze SHM-induced DSBs, mostly because a reliable in vitro induction system is not available, but data from experiments performed in AID-deficient mice and AID dominant negative B cell lines provided evidence for the occurrence of AID-independent DSBs during SHM (28, 29). These findings together with ours suggest that AID could function differently during CSR (upstream of the DSBs) and SHM (downstream of the DSBs). This hypothesis appears, however, unlikely, given the similarities of both processes, illustrated by the reported presence of mutations within S regions during CSR (30) and within V regions during SHM. Mutations in both regions cannot be observed in the absence of AID (16, 30). An alternative hypothesis reconciling all available data were recently suggested based on the fact that AID-independent DSBs observed in V regions were shown to be mostly unrelated to the SHM process (10, 28). Accordingly, AID would act upstream of DSBs in the CSR process. Because of its homology with the RNA-editing APOBEC-1 (7), AID could edit RNA encoding an endonuclease (3, 21). However, strong evidence has recently been provided that AID acts directly on DNA by deamination of cytidine into uracil residues. Evidence for a DNA-editing activity of AID has been recently provided. AID has been shown to deaminate cytosine residues on DNA after transfection in Escherichia coli (23). Moreover, several groups have concomitantly demonstrated in in vitro experiments that AID exerts its activity on ssDNA and that transcription targets its effect to dsDNA by generating secondary structures that lead to ssDNA (24, 31, 32, 33, 34). Indirect evidence has also been provided in vivo by the description of an impaired CSR in mice deficient in uracil-N-glycosylase (22, 35). Such DNA alterations, when occurring in S regions, might be the initial step toward CSR-induced DSBs. As shown in Fig. 2, the CSR-induced DNA breaks that we observed do not preferentially occur on C residues. This reflects the fact that DSBs are probably the consequence of ssDNA breaks occurring on two C residues in close proximity on each DNA strand, leading to secondary DSBs following base excision repair (21, 36). The required repair mechanisms are known to be distinct in SHM and CSR. DNA breaks are repaired by mismatch repair enzymes (37) and error-prone polymerases in SHM (38, 39, 40) and by the nonhomologous end-joining system in CSR (17, 18, 19). Specific targeting of the Ig loci by AID presumably depends on cofactors, most likely widely expressed (41, 42), the identification of which will shed some light onto the AID-dependent maturation process of the Ab repertoire.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Anne Durandy, Institut National de la Santé et de la Recherche Médicale, Unité 429, Hôpital Necker-Enfants Malades, 149 rue de Sèvres, 75015 Paris, France. E-mail address: durandy{at}necker.fr
3 Abbreviations used in this paper: SHM, somatic hypermutation; AID, activation-induced cytidine deaminase; C, constant region; CSR, class switch recombination; DSB, double-strand break; HIGM2, hyper-IgM syndrome type 2; LM-PCR, ligation-mediated PCR; PI, propidium iodide; S region, switch region; sCD40-L, soluble CD40 ligand.
Received for publication January 24, 2003. Accepted for publication July 2, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-H2AX focus formation and mutations at sites of class switching. Nature 414:660.[Medline]
This article has been cited by other articles:
|
|
 |
|
  C. E Schrader, J. E.J Guikema, X. Wu, and J. Stavnezer The roles of APE1, APE2, DNA polymerase {beta} and mismatch repair in creating S region DNA breaks during antibody class switch Phil Trans R Soc B, March 12, 2009; 364(1517): 645 - 652. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Garcia-Pineres, A. Hildesheim, L. Dodd, T. J. Kemp, J. Yang, B. Fullmer, C. Harro, D. R. Lowy, R. A. Lempicki, and L. A. Pinto Gene Expression Patterns Induced by HPV-16 L1 Virus-Like Particles in Leukocytes from Vaccine Recipients J. Immunol., February 1, 2009; 182(3): 1706 - 1729. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. J. Guikema, C. E. Schrader, N. G. J. Leus, A. Ucher, E. K. Linehan, U. Werling, W. Edelmann, and J. Stavnezer Reassessment of the Role of Mut S Homolog 5 in Ig Class Switch Recombination Shows Lack of Involvement in cis- and trans-Switching J. Immunol., December 15, 2008; 181(12): 8450 - 8459. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Arudchandran, R. M. Bernstein, and E. E. Max Single-strand DNA breaks in Ig class switch recombination that depend on UNG but not AID Int. Immunol., November 1, 2008; 20(11): 1381 - 1393. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Peron, A. Metin, P. Gardes, M.-A. Alyanakian, E. Sheridan, C. P. Kratz, A. Fischer, and A. Durandy Human PMS2 deficiency is associated with impaired immunoglobulin class switch recombination J. Exp. Med., October 27, 2008; 205(11): 2465 - 2472. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Perlot, G. Li, and F. W. Alt From the Cover: Antisense transcripts from immunoglobulin heavy-chain locus V(D)J and switch regions PNAS, March 11, 2008; 105(10): 3843 - 3848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Schrader, J. E. J. Guikema, E. K. Linehan, E. Selsing, and J. Stavnezer Activation-Induced Cytidine Deaminase-Dependent DNA Breaks in Class Switch Recombination Occur during G1 Phase of the Cell Cycle and Depend upon Mismatch Repair J. Immunol., November 1, 2007; 179(9): 6064 - 6071. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Wu and J. Stavnezer DNA polymerase {beta} is able to repair breaks in switch regions and plays an inhibitory role during immunoglobulin class switch recombination J. Exp. Med., July 9, 2007; 204(7): 1677 - 1689. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Xue, C. Rada, and M. S. Neuberger The in vivo pattern of AID targeting to immunoglobulin switch regions deduced from mutation spectra in msh2-/- ung-/- mice J. Exp. Med., September 4, 2006; 203(9): 2085 - 2094. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Wang, N. Whang, R. Wuerffel, and A. L. Kenter AID-dependent histone acetylation is detected in immunoglobulin S regions J. Exp. Med., January 23, 2006; 203(1): 215 - 226. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Schrader, E. K. Linehan, S. N. Mochegova, R. T. Woodland, and J. Stavnezer Inducible DNA breaks in Ig S regions are dependent on AID and UNG J. Exp. Med., August 15, 2005; 202(4): 561 - 568. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yu, D. Roy, M. Bayramyan, I. S. Haworth, and M. R. Lieber Fine-Structure Analysis of Activation-Induced Deaminase Accessibility to Class Switch Region R-Loops Mol. Cell. Biol., March 1, 2005; 25(5): 1730 - 1736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Li, Z. Luo, and M. D. Scharff Differential regulation of histone acetylation and generation of mutations in switch regions is associated with Ig class switching PNAS, October 26, 2004; 101(43): 15428 - 15433. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Arudchandran, R. M. Bernstein, and E. E. Max Single-Stranded DNA Breaks Adjacent to Cytosines Occur during Ig Gene Class Switch Recombination J. Immunol., September 1, 2004; 173(5): 3223 - 3229. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Begum, K. Kinoshita, M. Muramatsu, H. Nagaoka, R. Shinkura, and T. Honjo De novo protein synthesis is required for activation-induced cytidine deaminase-dependent DNA cleavage in immunoglobulin class switch recombination PNAS, August 31, 2004; 101(35): 13003 - 13007. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Schrader, J. Vardo, E. Linehan, M. Z. Twarog, L. J. Niedernhofer, J. H.J. Hoeijmakers, and J. Stavnezer Deletion of the Nucleotide Excision Repair Gene Ercc1 Reduces Immunoglobulin Class Switching and Alters Mutations Near Switch Recombination Junctions J. Exp. Med., August 2, 2004; 200(3): 321 - 330. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Rush, S. D. Fugmann, and D. G. Schatz Staggered AID-dependent DNA double strand breaks are the predominant DNA lesions targeted to S{micro} in Ig class switch recombination Int. Immunol., April 1, 2004; 16(4): 549 - 557. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Kenter, R. Wuerffel, C. Dominguez, A. Shanmugam, and H. Zhang Mapping of a Functional Recombination Motif that Defines Isotype Specificity for {micro}->{gamma}3 Switch Recombination Implicates NF-{kappa}B p50 as the Isotype-specific Switching Factor J. Exp. Med., March 1, 2004; 199(5): 617 - 627. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
in controls and * in HIGM2 patients. No peculiar targeting was observed. The Sµ region was amplified by LM-PCR using the Sµ int (underlined) and the Bw1 primers, and the PCR products were cloned and sequenced with the consensus M13 forward and reverse primers. The Sµ sequence data are available from GenBank under accession number NT-010168.
