|
|
||||||||

Thymocytes of Adult Mice Originate from Fetal Precursors 1
Unité du Développement des Lymphocytes, Centre National de la Recherche Scientifique Unité de Recherche Associée 1961, Institut Pasteur, Paris, France
| Abstract |
|---|
|
|
|---|

T cells constitute a distinct adult 
T cell subset characterized by the expression of a TCR composed of V
1C
4 and V
6C
chains with limited junctional sequence diversity. However, several features of the expressed Thy-1dull TCR-
genes, in particular the absence or minimal presence of N region diversity and the almost invariable D
2-J
1 junction, are typical of rearrangements often found in the fetal thymus. In this study, we have investigated the origin of these cells. Few Thy-1dull 
thymocytes developed in syngeneic radiation adult chimeras, regardless of whether the recipient mice were given adult bone marrow or fetal liver cells as a source of hemopoietic precursors. In contrast, normal numbers of Thy-1dull 
T cells developed in fetal thymi grafted into adult syngeneic recipients. Interestingly, the majority of Thy-1dull 
thymocytes present in the grafts were of graft origin, even when most conventional 
and 
thymocytes in the grafted thymi originated from T cell precursors of recipient origin. Single-cell PCR analyses of the nonselected TCR-
rearrangements present in adult Thy-1dull 
thymocytes revealed that more than one-half of these cells represent the progenies of a limited number of clones that greatly expanded possibly during the first weeks of life. Finally, the second TCR-
allele of a large number of Thy-1dull 
T cells contained incomplete TCR-
rearrangements, thus providing an explanation for the adult-type rearrangements previously found among nonfunctional V(D)J rearrangements present in Thy-1dull 
thymocytes. | Introduction |
|---|
|
|
|---|

, and 1018 TCR-
(2). Early in ontogeny, the diversity of the newborn T and B cell repertoires is particularly restricted, as a result of the small number of T and B cell clones and the absence of some of the diversification mechanisms that operate later in ontogeny. For example, TdT is not expressed in fetal hemopoietic organs and is first detected in developing thymocytes 35 days after birth (3, 4). Consequently, Ig and TCR chains formed during fetal and early postnatal life lack significant N region addition (5, 6, 7, 8, 9). Furthermore, the appearance of predominant junctional sequences among fetal Ig H chain rearrangements correlates with the presence of short homology repeats near the ends of the coding segments (5, 10). Together with an apparent gene segment usage bias (5, 11, 12), these mechanisms result in the formation of a limited repertoire of Ig and TCRs biased for germline-encoded specificities. The advantage of this restriction may be the selection and maintenance in the germline of protective Ab specificities (13) and of more promiscuous TCR specificities that allow a relatively small number of T cells to protect against a broad range of pathogens (14).
Perhaps the most striking examples of lymphocyte subsets with limited TCR diversity are unique populations of 
T cells present in the epithelia of the skin and reproductive tract of mice (15, 16). 
T cells present in these tissues express an identical
-chain encoded by the V
1-D
2-J
2 gene segments together with almost invariant
-chains encoded by the V
5-J
1 (in the skin) or the V
6-J
1 (in the reproductive tract) gene segments. Common to these three chains is the absence of N nucleotides. Analyses of TCR-
-deficient mice (17) and of mice transgenic for a rearrangement-competent V
5 trangene carrying a frameshift mutation (18) showed that these canonical sequences are generated at high frequency in the absence of cellular selection. Moreover, short homology repeats at the ends of the V
5 and J
1 segments were shown to play a critical role in the generation of the canonical V
5-J
1 chain by directing the site of rearrangement (19). Identical short repeats also occur at the ends of V
6, J
1, V
1, and D
2 segments, whereas a different short repeat generated by P element addition could be present at the ends of D
2, J
1, and J
2 gene segments. The involvement of these short repeats in the formation of the canonical V
6-J
1 and V
1-D
2-J
2 chains has been suggested (17, 19), but not directly addressed experimentally. The V
5+ and V
6+ subsets are produced in distinct, but overlapping waves during fetal thymic development (20, 21). Moreover, skin 
T cells were shown to be produced exclusively during fetal development in a process that requires both fetal precursors and a fetal thymus (22, 23). The potential repertoire of TCRs of these fetal precursors is not only constrained by the absence of TdT and by homology-guided recombination, but also by the restricted expression and ordered rearrangement of V
genes during development (24). The essentially monomorphic nature of their TCRs has been taken to imply a unique and important role of these epithelial cell populations, which could be that of immunological sentinels for infection- or trauma-induced self Ags (25, 26). This concept has gained experimental support by the demonstration that skin 
T cells respond to heat-stressed or damaged keratinocytes (27, 28) and by the preferential in vivo expansion of V
6+ cells during inflammation (reviewed in Ref.29).
We have recently described a population of adult 
thymocytes that also displays a very limited TCR diversity and has the ability to produce Th1- and Th2-type cytokines upon stimulation (30, 31). This 
T cell population differs from conventional 
T cells in its low expression of Thy-1 and is therefore referred to as the Thy-1dull 
T cell population. Characteristic of this population is the restricted use of a
-chain encoded by the V
1-J
4 segments and a
-chain encoded by the V
6-D
2-J
1 segments. In adult B6D2F1 mice, Thy-1dull 
T cells represent
90% of the V
1+V
6.3/6.4+ population. The first Thy-1dull 
T cells are only detected in the thymus after birth, and their numbers greatly increase during the first weeks of life (30), suggesting a postnatal origin of these cells. In contrast, several features of the Thy-1dull TCR-
genes are typical of rearrangements found more often in fetal than adult thymus. These include the absence or minimal presence on N nucleotides at the junctions and the use of a single D element in the rearranged
-chain gene (30, 32, 33). Furthermore, the almost invariable D
2-J
junction found in
-chains expressed by this population, and which imposes a unique reading frame on the D
2 gene segment, could result from rearrangements directed by short homology repeats generated by P element addition at the ends of the coding segments (17), a known feature of rearrangements occurring during fetal life. We have now formally investigated the origin of the Thy-1dull 
T cells present in the young adult thymus and report that a large fraction of them represents the progenies of a restricted number of cells that originated from fetal precursors and expanded most likely in the young thymus.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6JIco (B6), DBA/2JIco (DBA/2), and (C57BL/6JIco x DBA/2JIco)F1 (B6D2F1) mice were obtained from Iffa Credo (LAbresle, France). B6.SJL (B6 Ly-5.1) were obtained from the CDTA (Orleans, France). Ly-5.1-expressing B6D2F1 mice and fetuses were obtained by crossing DBA/2 females with B6.SJL males and were used as donors of bone marrow or fetal liver and fetal thymi, respectively. The commercially available Ly-5.2-expressing B6D2F1 mice were used as recipients.
Radiation chimeras and thymus grafting
Irradiated (1000 rad) B6D2F1 Ly-5.2+ mice were reconstituted either with three to four 106 bone marrow cells isolated from the tibias and femurs of adult Ly-5.1-expressing B6D2F1 or with the same number of fetal liver cells isolated from embryonic day 15 (E15) Ly-5.1-expressing B6D2F1 embryos. Thymus grafting was performed in 5- to 6-wk-old Ly-5.2-expressing B6D2F1 mice. Briefly, mice were anesthetized by i. p. injection of ketamin (140 mg/kg) and xylazine (7 mg/kg) (both from Sigma-Aldrich, St. Louis, MO) in saline. An incision was opened to expose the kidney, and one to three thymic lobes from E13 or E15 Ly-5.1-expressing B6D2F1 embryos were grafted separately under the left kidney capsule. The wound was closed with surgical clips, and the mice were placed in a worm environment until they recovered.
Cell cultures and IL-4-specific ELISA
Sorted V
1+V
6+Thy-1dull cells (5 x 104 cells/ml) from individual mice were cultured in flat-bottom 96-well plates previously coated with 10 µg/ml anti-C
mAb (3A10) in 200 µl of either DMEM or RPMI 1640 with Glutamax-1 (Life Technologies, Gaithersburg, MD) supplemented with sodium pyruvate, 5 x 10-5 M 2-ME, nonessential amino acids and antibiotics (all from Life Technologies-BRL), 10% FCS (Boeringer Mannheim, Meylan, Germany), and 100 U/ml mouse rIL-2. Three-day culture supernatants were tested for the presence of IL-4 by ELISA, as described (30).
Abs, staining, and cell sorting
Anti-CD8 (HO-2.2), anti-C
(3A10), and anti-V
1 (2.11) were prepared and used, as described (30). PE-labeled anti-C
(GL3), PE-labeled anti-V
6.2/6.3 (8F4H7B7), anti-Thy-1, anti-CD45.1 (Ly-5.1), and anti-CD45.2 (Ly-5.2) were purchased from BD PharMingen (San Diego, CA). Anti-C
-Tricolor was purchased from Caltag (San Francisco, CA). Cells (105-106) were incubated in staining buffer (PBS, 3% FCS, 0.1% NaN3) with the indicated labeled mAbs for 30 min on ice and washed twice. When biotin-conjugated Abs were used, the cells were further incubated with PE-labeled streptavidin (Southern Biotechnology, Birmingham, AL), or allophycocyanin-labeled streptavidin (BD PharMingen) for another 15 min on ice. After two washes, cells were analyzed using a FACScan or a FACSCalibur flow cytometer (BD Biosciences, Mountain View, CA). Dead cells were gated out by their forward and side scatter profile and by their staining with propidium iodide. Data were analyzed using the CellQuest program. For FACS sorting, CD8- thymocytes prepared by complement-mediated lysis, as described (30), were incubated with the appropriate mAb, as described above, washed, and sorted in a MoFLOW (Cytomation, Fort Collins, CO). Purity of the sorted populations was >98%.
Single-cell PCR for TCR-
and TCR-
rearrangements, cloning, and sequencing
Single cells were sorted directly into individual wells of a 96-well PCR plate containing 10 µl of PCR buffer and 10 µg of proteinase K (Eurobio, Paris, France). Plates were frozen at -80°C, thawed, and incubated at 56°C for 30 min and at 95°C for 20 min. A total of 5 µl of PCR buffer containing 1 U of AccuPrime Taq DNA polymerase (Invitrogen, San Diego, CA) and 10 pmol of each primer were then added, and a first PCR was run for 35 cycles. One hundredth of each amplification was used as a template in a nested PCR (for TCR-
), seminested PCR (V
1-J
4), or in three independent nested or seminested PCRs for TCR-
(see below) run for 30 cycles. Each PCR cycle consisted of incubations at 94°C for 30 s, followed by 60°C for 30 s and 72°C for 45 s. Before the first cycle, a 5-min 94°C denaturation step was included, and after the last cycle, the extension at 72°C was prolonged for 4 min. PCR was performed using a GeneAmp PCR system 9700 (PerkinElmer/Cetus, Norwalk, CT). PCR products were then directly sequenced, as described (34), except that the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer/Cetus) was used for sequencing following the manufacturers instructions. When two different junctions appeared in the sequence, the amplification product was cloned using the TOPO TA Cloning kit (Invitrogen) following the manufacturers instructions. Plasmid DNA from individual colonies was amplified with the same primers and sequenced, as above.
Oligonucleotide primers
Unrearranged or uncompletely rearranged TCR-
genes were detected in single cells by a two-step nested PCR. In the first PCR, a reversed primer located 3' of J
1 (AACACGACTGGATCACTAGG) was used together with three forward primers located 5' of D
1 (GGTTTTGTTATCTTTGAAGG), 5' of D
2 (CAGACCTTCTAACACTACCC), and 5' of J
1 (TCTCCCTGGAACTAGCCAGC). In the second PCR, four internal primers were used: a reversed J
1 (TTGGTTCCACAGTCACTTGG) and three forward located 5' of D
1 (GGTGTTTTTGTACGGCTGTG), 5' of D
2 (TGCAAAGCTCTGTAGCACCG), and 5' of J
1 (ATGGGAAACAGCTGCTGAGG).
Rearrangements involving V
1, V
2, and V
4 gene segments were detected in single cells by a two-step PCR. In the first PCR, a reversed degenerate primer recognizing the four mouse J
sequences (GRGGAATTACTAYGAGCTT) was used together with a primer recognizing V
1, V
2, and V
3 (CCAACACAGCTATACATTGG) together with a primer specific for V
4 (TGTCCTTGCAACCCCTACCCA). Aliquots of the first PCR were amplified separately in three nested or seminested PCRs with primers specific for V
1 (CCGGCAAAAAGCAAAAAAGTT) and J
4 (GCAAATATCTTGACCCATGA); V
2 (CCGGCAAAAAACAAATCAAC) and J
2; and V
4 together with a primer recognizing J
1, J
2, and J
3 (TWGTTCCTTCTGCAAATACC) and the primer specific for J
4.
Rearrangements involving the V
1 and the V
6 gene segments were also amplified from DNA isolated from individual cells by a two-step PCR, using the same V
1, pan-J
, and 3'-J
1 primers, as above, together with a V
6-specific primer (GTGATTCAGGTCTGGTCAAC) in the first PCR. Aliquots of the amplifications were submitted to two independent seminested PCRs using the same V
1 primer together with a J
4-specific primer and the same V
6 primer with an internal J
1 primer, respectively. Amplification products were sequenced, as above.
| Results |
|---|
|
|
|---|

thymocytes in lethally irradiated mice reconstituted with syngeneic bone marrow or fetal liver cells
Thy-1dull 
thymocytes are rare in newborn animals, and their numbers increase during the first 3 wk of life until they reach normal adult levels and represent
50% of the 
thymocytes in B6D2F1 mice (30) (Fig. 1, top panel). In lethally irradiated mice reconstituted with syngeneic bone marrow cells, Thy-1dull 
thymocytes comprise barely 5% of the 
thymocytes (Fig. 1, middle panel), despite the fact that conventional 
T cells (Fig. 1, middle panel) and 
T cells (data not shown) of donor origin develop normally in these mice. The failure to detect a normal Thy-1dull 
population in the chimeras was not due to differences in its kinetics of reconstitution because similar low numbers of Thy-1dull 
T cells were also observed 1 and 4 mo after reconstitution (data not shown). Nor was the lack of detection due to increased expression of Thy-1 by these cells because cells recognized by an anti-V
6.2/6.3 mAb (which recognizes
95% of the Thy-1dull 
thymocytes and, therefore, >50% of the total 
thymocytes in B6D2F1 mice) accounted for less than 15% of the total 
thymocytes in the chimeras (not shown). Fetal liver cells generated a somewhat better reconstitution of the Thy-1dull 
population, although its representation among 
thymocytes remained 5-fold lower than in normal mice (Fig. 1, bottom panels). These data indicate that an adult irradiated thymus does not support the full development of the Thy-1dull 
population from either adult bone marrow or fetal liver precursors.
|

thymocytes present in young adult animals originate from fetal precursors
There are several potential explanations for the apparent lack of development of the Thy-1dull 
population in the radiation chimeras. In particular, it is possible that Thy-1dull 
T cells originate mainly in a fetal environment from fetal precursors. Because various features of the Thy-1dull TCR chains are consistent with this possibility, we analyzed this issue experimentally.
Transplantation of fetal thymi into normal syngeneic animals allows the normal development of the fetal thymocytes in vivo as well as the reconstitution of the grafted thymi with host stem cells. These processes occur independently of the presence or absence of an endogenous thymus (35, 36). By using host and donor mouse strains that differ in a lymphoid-specific allotypic marker, the origin of the developing cells can be determined unequivocally. We transplanted E13 and E15 thymic lobes from Ly-5.1-expressing B6D2F1 mice under the kidney capsule of Ly-5.2-expressing congenic animals, and the development of donor- and host-derived cells in the grafted thymi was analyzed weekly for a period of 5 wk. No differences were found when E13 or E15 thymi were grafted, and therefore, in the results presented below, the age of the grafted thymus is not considered.
Consistent with previous results (36), the grafted lobes increased in size and cellularity during the first 34 wk after engraftment until they reached
50 million cells per lobe. At each time point examined, all major thymic subpopulations defined by the CD4 and CD8 markers were present in normal proportions (data not shown). Also consistent with previous results (36), the large majority of thymocytes present during the first 2 wk after grafting were of graft origin (Fig. 2). By 3 wk after grafting, a variable degree of chimerism was observed in all grafts, with the most mature cells being of donor origin and the most immature cells of host origin. Beyond 3 wk after engraftment, most cells present in the grafted thymi originated from host-derived stem cells that had reconstituted the grafts.
|

-lineage cells in the grafted lobes, some striking differences were observed. First, 
T cells of host origin were already present in the grafted thymus 1 and 2 wk after engraftment, albeit in very low numbers (Fig. 2). Second, although the number (not shown) and the proportion of 
T cells of host origin increased drastically by 3 wk after grafting and represented >75% of the 
thymocytes at 3 wk, a sizable population of donor-derived fetal 
T cells was always present beyond this point and represented 3050% of the total 
thymocytes at 4 wk after engraftment (Fig. 2).
To further analyze the development of the 
thymocytes and the nature of the graft-derived fetal 
T cells present at later times in the grafts, thymocytes isolated at different time points were stained with anti-Ly-5.1 and anti-
Abs (to distinguish host- and donor-derived 
T cells) and counterstained with anti-Thy-1 and anti-V
6.2/6.3 mAbs. Conventional 
T cells express high levels of Thy-1, and a low proportion of them bear the B6 V
6.3 chain (or the DBA/2 V
6.4 or V
6.6 chains also recognized by this mAb; data not shown) at the cell surface. Conversely, most Thy-1dull 
T cells express low levels of Thy-1 and bear the V
6.3 chain (or the DBA/2 V
6.4 chain) as part of their TCR (30, 37).
Conventional Thy-1bright 
T cells were present in the thymus at all time points, and their numbers increased as the size of the thymus augmented. Thy-1dull 
T cells developed in the grafted thymus with kinetics similar to those previously found in normal animals (30). They were barely detectable 7 days after engraftment, and their numbers increased as the thymus expanded in size. In addition, their relative proportion among total 
thymocytes increased during the first 4 wk after grafting to represent 2550% of all 
thymocytes at 4 wk (Fig. 3, A and B). The majority of 
T cells present in the grafted thymi during the first 2 wk were of graft origin. From the third week on, most conventional 
T cells present in the grafts were of host origin, indicating that graft-derived conventional 
T cells had been exported from the grafted thymi and newly formed 
thymocytes originated from host precursors. This kinetics of reconstitution illustrates the virtual absence of long-term conventional 
resident thymocytes. In contrast, the vast majority of Thy-1dull 
thymocytes present in the thymus grafts were of graft origin at all times analyzed, indicating that the majority of these cells originated from fetal precursors and that a portion of them, or their progeny, remain as long-term resident thymocytes. A small number of Thy-1dull 
T cells of host origin were also evident 4 wk after engraftment, consistent with the notion that adult bone marrow precursors have the potential to differentiate into Thy-1dull 
thymocytes. Our results indicate, however, that either adult progenitors are less efficient than fetal precursors in giving rise to Thy-1dull 
T cells or, alternatively, that Thy-1dull 
T cells originating from adult progenitors do not compete out their fetal counterparts.
|

T cells developing in thymus grafts are bona fide, mature Thy-1dull 
T cells
In addition to their low expression of Thy-1 and predominant expression of a V
6 chain, Thy-1dull 
thymocytes present in the grafted thymi almost exclusively expressed the V
1 chain (not shown) and produce quantitatively similar levels of IL-4 as the endogenous Thy-1dull 
population (Fig. 3C). Furthermore, their V
1-J
4 and V
6-(D)-J
1 junctinal sequences (Fig. 4) are as limited as is typical in normal mice and have the same D
2 reading frame bias, as previously shown (30, 32). Interestingly, the vast majority of the junctions found in Thy-1dull 
T cells of donor origin (which represent
85% of the Thy-1dull 
thymocytes present in the graft 5 wk after engraftment; Fig. 3B) lack the D
1 gene segment, contain the canonical D
2-J
1 junction, and either lack or contain one to two N additions, consistent with their fetal or early postnatal origin. In contrast, the majority of the junctions isolated from Thy-1dull 
T cells of host origin (which represent
15% of the Thy-1dull 
thymocytes present in the graft at the same time point; Fig. 3B) contain the D
1 gene segment, lack the canonical D
2-J
1 junction (although maintain the same reading frame of the D
2 gene segment), and display a large number of N additions, consistent with their adult origin. Taken together, these data indicate that Thy-1dull 
T cells present in the grafts are mature, selected, bona fide Thy-1dull 
T cells. A large fraction of these cells originates from fetal progenitors, whereas a small proportion arises later in life from adult precursors.
|

T cells
In the experiments presented above, it was evident that a small, but significant fraction of the Thy-1dull 
thymocytes present in the grafted thymi 1 wk after engraftment was of host origin. Given their early appearance, it is unlikely that these cells developed in situ from host-derived precursors. Rather, they may represent circulating cells of host origin that homed to the thymus graft. If some Thy-1dull 
T cells do recirculate and home again in the thymus, we would expect to find Thy-1dull 
T cells of graft origin in the endogenous thymus. Staining of endogenous thymocytes with anti-Ly-5.1 and anti-
Abs showed the existence of a minor population of graft-derived 
T cells 4 and 5 wk after engraftment. These cells represented less than 1% of the total thymocytes and 24% of the total 
thymocytes (Fig. 5, left panel). Interestingly, virtually all of these cells expressed low levels of the Thy-1 Ag and bore a receptor composed of the V
1 and V
6.3/6.4 chains (Fig. 5, middle and right panels). Together with the fact that fetal-derived Thy-1dull 
thymocytes persist in the grafted thymi at times when fetal hemopoietic precursors have been replaced by host-derived stem cells, these data indicate that Thy-1dull 
T cells are not only produced in the thymus, but also that a fraction of them (or their progenies) are long-term thymic resident cells, whereas others can recirculate back to the thymus.
|

thymocytes in young adult animals results from the expansion of a limited number of clones
Although Thy-1dull 
thymocytes originate from fetal precursors, their number and relative representation increase during the first 3 wk of life (29) (Fig. 3B). This could be the result of an intrathymic expansion of a limited number of clones, as it may be suggested by the appearance in the grafts of Thy-1dull 
T cells displaying identical TCRs (Fig. 4), although this could also be the result of a strong TCR-mediated selection. Alternatively, a unique precursor giving rise exclusively to Thy-1dull 
thymocytes may persist in the young adult thymus. To directly test the former possibility, we cloned and sequenced the selected V
1-J
4 and the nonselected V
2-J
and V
4-J
rearrangements present in individual Thy-1dull 
thymocytes isolated from two individual B6D2F1 mice. The existence of Thy-1dull 
thymocytes with similar V
1-J
4 chains may result from TCR-mediated selection of independent cells. However, the existence of cells carrying similar, nonselected V
2-J
and V
4-J
rearrangements, which are frequently found in V
1-bearing cells (our unpublished observation), strongly indicates the existence of clonal populations derived from individual incipient Thy-1dull 
thymocytes.
Based on the junctional sequences of the rearrangements involving the V
2 and/or the V
4 gene segments, the 18 and 16 individual Thy-1dull 
thymocytes analyzed from two individual mice are expected to represent 8 and 9 different clones, respectively (Fig. 6). In mouse 1, 2 clones were represented only once, 4 were found twice, 1 three times, and 1 five times, whereas in mouse 2, 4 clones were found once, 3 clones twice, and 2 clones three times. A number of these clones may represent as much as 1020% of the total Thy-1dull 
thymocyte population (i.e., 48 x 104 cells) (31), indicating that the incipient cells divided at least 1517 times. Interestingly, the most represented clones lacked N sequence additions in all of their V
-J
rearrangements, whereas the least represented ones contained N sequence addition in most of their V
-J
rearrangements. These data are also consistent with the possibility that, in normal mice, the larger size clones are derived from precursors that developed during fetal or perinatal life, whereas the smaller size clones originated from cells that developed later in life, as it was already suggested from the TCR-
junctional sequence analyses performed in Thy-1dull 
thymocytes isolated from the grated thymi (Fig. 4).
|

thymocytes analyzed in this experiment contained, besides a functional V
1-J
4 rearrangement, a second functional TCR-
rearrangement involving the V
4 (five clones) or the V
2 (three clones) gene segment. These TCR-
chains are unlikely to be selected for because: 1) they are absent in about one-half of the Thy-1dull 
thymocytes; 2) their junctional sequences are quite different; and 3) the V
4 chain is not expressed at the cell surface at sufficient levels to be detected with a V
4-specific mAb (30). Presence of functional V
4-J
1 and V
2-J
2 rearrangements is a common feature of V
1+ cells and not a particularity of the Thy-1dull 
thymocytes (unpublished observations), and, in this particular situation, most likely reflects the inability of the V
4 (34) or the V
2 (Ref.38 and unpublished observations) chains to pair with a V
6 chain.
Most fetal Thy-1dull 
thymocytes harbor incomplete rearrangements at the nonexpressed TCR-
allele
Previous analysis of nonfunctional V
6(D
)J
sequences present in Thy-1dull 
thymocytes detected no bias toward V
6 family member usage and revealed features of adult, rather than of fetal type junctions (32). These data, which were interpreted as indicative of a strong cellular selection mechanism resulting in the homogeneity of the repertoire of TCRs expressed by the Thy-1dull 
population, are in apparent contradiction with the fetal origin of these cells. Thus, if these cells develop at the time when TdT activity is low and rearrangements guided by short homology repeats at the end of the gene segments are likely to occur, we would have expected to find similar features in the nonfunctional rearrangements harbored by these cells.
This apparent paradox could be resolved if, in general, fetal 
T cells would have a lower chance than adult 
T cells of completing TCR-
rearrangements in both chromosomes. Several indirect lines of evidence are consistent with this possibility. First, in our previous analyses (32), it was noticed that the frequency of nonfunctional rearrangements involving a V
6 gene segment was much lower than expected if most cells would have two completed TCR-
rearrangements. Second, in the analyses of TCR-
rearrangements showed in Fig. 5, cells that have TCR-
junctions containing N additions tend to harbor more TCR-
rearrangements than those that have junctions lacking N additions.
To directly test this possibility, individual Thy-1dull 
thymocytes were sorted directly into PCR tubes, and their DNA was amplified with primers that recognized incomplete TCR-
rearrangements or the TCR-
locus in germline configuration. Similarly sorted Thy-1bright 
thymocytes and splenic B cells were also analyzed for comparison and as a positive control for the efficiency of the amplification reaction, and the results are shown in Table I. A specific amplification band was obtained in 16 of the 18 individually sorted B cells tested, indicating an amplification efficiency of
90%. Similarly, 5 of 18 Thy-1bright 
thymocytes and 12 of 18 Thy-1dull 
thymocytes also showed a specific amplification band. After correction for the amplification efficiency, these results indicate that
30 and 74% of the Thy-1bright and Thy-1dull 
thymocytes, respectively, contained an unrearranged or incompletely rearranged second TCR-
allele. These data are consistent with the possibility that the nonfunctional V
6(D
)J
junctions previously analyzed (32) would come from a limited number of Thy-1dull 
thymocytes that arise during the adult life.
|
| Discussion |
|---|
|
|
|---|

thymocytes present in the thymus of the young adult mouse are progenies of a limited number of cells generated from fetal precursors in the fetal or newborn thymic environment. In this respect, and in the restricted repertoire of TCRs they express, the Thy-1dull 
T cell population is reminiscent of the V
5+ and V
6+ fetal 
T cell subsets, although some important differences exist between them. For example, development of the V
5+ and V
6+ 
T cell subsets expressing the canonical TCR-
sequences strictly requires both fetal hemopoietic precursors and a fetal microenvironment (20, 23). This is most likely due to two distinct mechanisms. The first involves the temporal accessibility of the V
5 and V
6 (and possibly V
1) gene segments that are open for transcription and rearrangement during a defined period of time and then become inaccessible (24). The second is the low expression levels of TdT during the fetal and neonatal period that favors the generation of canonical joints by facilitating homology-based recombinations. The mechanisms that control this developmental clock that regulates the status of TCR-
(and possibly TCR-
) chromosomal regions are unclear, but they certainly operate in fetal precursors (23, 39) and possibly require interactions between these fetal precursors and the fetal thymic microenvironment (40). In contrast, the ontogenically regulated expression of TdT appears to be environmentally induced rather than an intrinsic property of the fetal precursors (41).
In contrast with the rearrangements involving V
5 and V
6 (and possibly V
1) gene segments, which are almost exclusively found in the fetal thymus, those involving the V
6 (42) and the V
1 gene segments (Ref.43 and unpublished observations) are found in fetal and adult thymi. Therefore, it is likely that 
T cells bearing a V
1/V
6 TCR can develop in fetal thymi from fetal precursors and in adult thymi from adult precursors. Thus, the fetal origin of the Thy-1dull 
population, which expresses a V
1/V
6 TCR, most likely reflects an increased probability of precursor cells developing in a fetal microenvironment to produce a TCR that favors the selection of the cell to become a Thy-1dull 
cell. The limiting factor appears to be the production of a selectable V
6 chain that contains an almost invariant D
2-J
1 junction in which both segments are joined without loss of nucleotides and without N sequence additions. This particular junction could result from rearrangements directed by short homology repeats generated by P element addition at the ends of the coding segments (17). Importantly, this junction dictates the reading frame of the D
2 gene segment and, therefore, has a considerable influence on the complementarity-determining region 3 structure of the
-chain. In contrast, no stretches of homology are found between the 3' end of the V
6.3 (or Vd6.4) and the 5' end of the D
2 gene segments. However, lack of TdT expression during fetal life should limit greatly the potential diversity of the V
6-D
2 junctions. In fact, a limited degree of diversity in the TCR-
chain expressed by the Thy-1dull 
thymocytes was observed, and such diversity was brought about by small differences in the V-D
2 junction (30, 32). By the characteristics outlined above, Thy-1dull 
thymocytes are reminiscent of V
9/V
2 cells present in the human fetal liver (44), which predominantly express canonical germline sequences and a memory phenotype. After birth, newly generated V
9/V
2 cells harbor junctions with substantial N diversification and express a naive phenotype.
The possibility that Thy-1dull 
T cells originate from a distinct fetal progenitor cannot be formally ruled out at this point, but it seems unlikely for several reasons. First, Thy-1dull 
thymocytes can develop in irradiated mice reconstituted with adult bone marrow cells, albeit at significantly low numbers. Second, the relative proportion of Thy-1dull 
thymocytes of host origin in fetal thymus-grafted animals increased by 5 wk after engraftment, suggesting that the early fetal cells are slowly replaced by adult-type cells. Both the sequence analyses of TCR-
and TCR-
junctional sequences present in host- and donor-derived Thy-1dull 
thymocytes isolated from the grafts and those of TCR-
junctional sequences present in Thy-1dull 
thymocytes from young adult animals are consistent with this interpretation. Third, Thy-1dull 
T cells contain functional and nonfunctional V
2-J
2 and V
4-J
1 rearrangements, indicating that they originate from precursor cells that have no evident preference for rearranging the V
1 gene segment.
Our results also demonstrate that Thy-1dull 
thymocytes originate from precursor cells that are present in E13 thymi because at that stage no mature T cell has yet developed. Because both the precursor cell and the final mature cell can be found in the thymus, it is likely that development of Thy-1dull 
thymocytes takes place in this organ.
A third important conclusion arising from our experiments is that more than one-half of the Thy-1dull 
thymocytes present in young adult B6D2F1 mice are the progeny of a small number of incipient cells generated in the fetal or perinatal period. The experiment in Fig. 6 demonstrates the existence of a small number of clones, defined by their identical, nonselectable TCR-
rearrangements, each representing 1030% of the Thy-1dull 
thymocyte population. Given that
4 x 105 Thy-1dull 
thymocytes exist in a young adult B6D2F1 thymus (31), a minimum of 15 rounds of division are needed to generate a clone of this size. Although these frequencies may be overestimated due to the limited number of clones analyzed, this result reveals a massive expansion at the mature (TCR-positive) stage, which is unprecedented among mainstream T cell lineages, but parallels that of other lymphocytes of the innate immune system (45).
Lack of full development of Thy-1dull 
thymocytes in radiation chimeras may relate not only to the probability that a precursor cell will produce a selectable receptor, which is favored in the fetal and perinatal microenvironments, but also to the ability of the newly generated Thy-1dull 
thymocytes to expand in situ. The mechanisms governing the exact time and the extent of these expansions are not known, although certain hypotheses can be proposed. For example, it has been shown that certain mutant mouse strains lacking T and NK T cells contain increased numbers of Thy-1dull 
thymocytes (32, 46, 47), indicating that either of these thymocyte populations could influence Thy-1dull 
thymocyte numbers. More recent experiments suggested that it is the absence of NK T cells that is responsible for the increased number of Thy-1dull 
thymocytes in these mutant strains (K. Grigoriadou. and P. Pereira, unpublished observations). Given the similar functional properties of these two cell populations and the fact that they localize in the same tissues, including the thymus where they are long-term resident cells (31, 48, 49), it is conceivable that they may compete for the same niches within the thymus. Because the first NK T cells are evident in the thymus
1 wk after birth (50) and they also expand in the thymus during the first weeks of life (45) it is possible that Thy-1dull 
thymocytes may have a selective advantage during perinatal life. This advantage may be lost in the radiation chimeras because the expected frequency at which NK T cells are produced in the adult thymus is higher than that of Thy-1dull 
thymocytes.
The phenotypic and functional properties of the Thy-1dull 
population as well as their restricted repertoires of TCRs place them as a lymphocyte subset of the innate immune system (51). Cells of these subsets express semi-invariant, germline-encoded Ag receptors, and seem to represent a distinct immune recognition strategy that targets stress-induced self structures rather than variable foreign Ags. Most of these cells are produced in a restricted ontogenic window and are endowed with a capacity for self-renewal that allows them to persist and to maintain their numbers throughout the life of the individual (52). Unveiling the mechanisms of lineage differentiation of these cells, as well as their self specificities and the structural bases for the recognition of stressed or damaged tissues represents the next challenge in the biology of innate cells.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Pablo Pereira, Unité du Développement des Lymphocytes, Centre National de la Recherche Scientifique Unité de Recherche Associée 1961, Institut Pasteur, 25 Rue du Dr. Roux, 75724 Paris Cedex 15, France. E-mail address: ppereira{at}pasteur.fr ![]()
Received for publication April 2, 2003. Accepted for publication July 1, 2003.
| References |
|---|
|
|
|---|

T cells in neonatal life. EMBO J. 10:3647.[Medline]
chains have few N regions. J. Exp. Med. 174:115.
/
antigen receptor genes of Thy-1+ dendritic epidermal cells. Cell 55:837.[Medline]

thymocyte subset with homogeneous T cell receptors to mucosal epithelia. Nature 343:754.[Medline]
gene mutant mice: independent generation of 
T cells and programmed rearrangements of 
TCR genes. Cell 72:337.[Medline]
-gene junctional sequences. Nature 362:158.[Medline]

antigen receptor repertoire in the fetal thymus. Immunity 3:439.[Medline]

genes: implications for 
T cell lineages and for a novel intermediate of V-(D)-J joining. Cell 59:859.[Medline]
locus correlates with transcription of the unrearranged genes. J. Exp. Med. 177:729.
receptors. Immunol. Today 9:73.[Medline]

antigen receptors. Annu. Rev. Immunol. 9:679.[Medline]

antigen receptors. Science 252:1430.
T cells in wound repair. Science 296:747.
-
T cell subsets. Chem. Immunol. 79:1.[Medline]

thymocytes that secretes a distinct pattern of cytokines and expresses a very restricted T cell receptor repertoire. Eur. J. Immunol. 27:544.[Medline]

T cells that express a very restricted TCR repertoire are preferentially localized in the liver and in the spleen. J. Immunol. 163:3076.
repertoire expressed by the Thy-1dull 
T cell population is due to cellular selection. Eur. J. Immunol. 28:3456.[Medline]
gene rearrangements in early thymocytes. Nature 330:722.[Medline]
/
gene segments. Eur. J. Immunol. 30:1988.[Medline]

thymocytes. Eur. J. Immunol. 31:205.[Medline]

cells. Immunol. Rev. 120:5.[Medline]
5 in the adult thymus of irradiated mice after transplantation with fetal liver cells. Eur. J. Immunol. 20:1965.[Medline]
gene rearrangement and selection during fetal thymocyte development. J. Immunol. 159:3338.[Abstract]
1 expressing
/
T lymphocytes in normal mice. J. Exp. Med. 182:1921.
T cells during fetal development. J. Immunol. 157:2873.[Abstract]
/
+ T cells and expansion of NK1.1+ TCR-
/
+ T cell development in CD3
-deficient mice. J. Exp. Med. 182:891.
TCR+NK1.1+ thymocytes specifically produce interleukin-4, are major histocompatibility complex class I independent, and are developmentally related to 
TCR+NK1.1+ thymocytes. Eur. J. Immunol. 26:1424.[Medline]
/
+ cells in the liver of mice. J. Exp. Med. 180:699.
- or IL-12-treated mice: a major role for bone marrow in NKT cell homeostasis. Immunity 9:345.[Medline]This article has been cited by other articles:
![]() |
T. Kreslavsky, A. K. Savage, R. Hobbs, F. Gounari, R. Bronson, P. Pereira, P. P. Pandolfi, A. Bendelac, and H. von Boehmer TCR-inducible PLZF transcription factor required for innate phenotype of a subset of {gamma}{delta} T cells with restricted TCR diversity PNAS, July 28, 2009; 106(30): 12453 - 12458. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Boucontet, N. Sepulveda, J. Carneiro, and P. Pereira Mechanisms Controlling Termination of V-J Recombination at the TCR{gamma} Locus: Implications for Allelic and Isotypic Exclusion of TCR{gamma} Chains J. Immunol., April 1, 2005; 174(7): 3912 - 3919. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Pereira and L. Boucontet Rates of Recombination and Chain Pair Biases Greatly Influence the Primary {gamma}{delta} TCR Repertoire in the Thymus of Adult Mice J. Immunol., September 1, 2004; 173(5): 3261 - 3270. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gerber, L. Boucontet, and P. Pereira Early Expression of a Functional TCR{beta} Chain Inhibits TCR{gamma} Gene Rearrangements without Altering the Frequency of TCR{gamma}{delta} Lineage Cells J. Immunol., August 15, 2004; 173(4): 2516 - 2523. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |