|
|
||||||||
Without Inhibiting STAT1 Function1

* Biomedical Sciences Graduate Program and Division of Infectious Diseases, University of California, San Francisco, CA 94143; and
Departments of Medicine and Microbiology, New York University School of Medicine, New York, NY 10016
| Abstract |
|---|
|
|
|---|
, a potent activator of the microbicidal activities of macrophages, is essential for control of M. tuberculosis infection, but is unable to stimulate macrophages to kill M. tuberculosis. We have found that infection of the human monocytic cell line, THP-1, resulted in reduced cellular responses to IFN-
, manifested as impaired induction of CD64 surface expression and transcription. This defect in transcription occurred despite normal activation of STAT1 in infected macrophages: there was no decrease in STAT1 tyrosine or serine phosphorylation, nuclear translocation, or binding of a minimal IFN-
response sequence. Assays of STAT1 function in M. tuberculosis-treated cells also revealed no defect in activation of a minimal
-activated sequence construct or STAT1 recruitment to and binding at the endogenous CD64 promoter. In addition, M. tuberculosis did not affect histone acetylation at the CD64 promoter. The inhibition of transcription was gene selective: while transcription of CD64 and class II transactivator were decreased, certain other IFN-
-responsive genes either were unaffected or were increased by M. tuberculosis. These results indicate that M. tuberculosis inhibits the response to IFN-
by a mechanism distinct from either suppressor of cytokine signaling-1 inhibition of STAT1 phosphorylation or protein inhibitor of activated STAT interference with DNA binding, and indicate that other mechanisms of inhibition of IFN-
responses remain to be discovered. | Introduction |
|---|
|
|
|---|
10% of infected people are unable to contain the infection and progress to active disease despite an apparently effective immune response. A major challenge in the study of the host-pathogen interaction in tuberculosis is to define the mechanisms used by M. tuberculosis to avoid eradication by the immune response. One potential mechanism is inhibition, by M. tuberculosis, of effector mechanisms of the cellular immune response.
Of several immune effectors involved in control of M. tuberculosis infection, IFN-
is the most thoroughly understood. Several lines of evidence support an essential role for IFN-
in control of M. tuberculosis infection. IFN-
knockout mice challenged with M. tuberculosis succumb rapidly, due to a failure to limit bacterial growth (1, 2). In humans, individuals with certain mutations in IFN-
receptor 1 (IFNGR1)3 show a predisposition to infection with poorly virulent mycobacterial strains as well as to severe and recurrent tuberculosis (3). More generally, there is a correlation between the functional severity of mutations that disrupt IFN-
-mediated immunity and the extent of susceptibility to mycobacterial infection (4).
Despite the vital role of IFN-
-mediated immunity in control of M. tuberculosis, the immune response is rarely, if ever, effective in clearing the infection. M. tuberculosis growth is controlled, but latent infection can reactivate in the future, followed by disease progression. M. tuberculosis infection persists in the face of significant amounts of IFN-
present in infected individuals at sites of infection (5, 6, 7), including in the granuloma itself (8, 9). The observation that IFN-
is present at sites of M. tuberculosis infection suggests that the inability of the immune response to eradicate M. tuberculosis is a consequence of a limited response to, rather than defective production of, IFN-
.
IFN-
acts primarily through regulation of gene expression (10), and induces macrophages to kill intracellular pathogens, including Toxoplasma, Leishmania, Legionella, and Chlamydia in vitro (11, 12). IFN-
, however, cannot induce either monocyte-derived macrophages (MDMØ) or alveolar macrophages to kill M. tuberculosis (13, 14). This suggests that M. tuberculosis is either resistant to the IFN-
-responsive microbicidal mechanisms of macrophages, or alternatively, may block macrophage responses to IFN-
.
IFN-
signaling is initiated when the cytokine binds as homodimers to its receptor composed of two subunits, IFNGR1 and IFNGR2, resulting in receptor dimerization. Dimerized receptors initiate activation of receptor-associated Janus kinase 1 (JAK1) and JAK2 by transphosphorylation. These kinases phosphorylate the IFNGR, allowing the recruitment of STAT1; JAK1/JAK2 are also responsible for phosphorylation of STAT1 on tyrosine 701. Tyrosine-phosphorylated STAT1 homodimerizes, and these homodimers translocate to the nucleus and regulate (induce or repress) gene expression (15). In addition, IFN-
activates other signaling pathways, such as specific mitogen-activated protein kinases (10, 16), that may augment or attenuate responses to IFN-
in a cell-specific manner.
We have previously reported that M. tuberculosis inhibited responses to IFN-
in human MDMØ (17). This effect was exerted at the level of mRNA expression of IFN-
-responsive genes, despite normal activation of STAT1; we found no defect in proximal steps in the JAK-STAT pathway. We also reported that infection of human MDMØ with M. tuberculosis was associated with a decrease in IFN-
-induced association of the transcriptional coactivator(s) CBP/p300 with STAT1 in an assay wherein CBP/p300 was detected after oligonucleotide affinity precipitation of STAT1. In an initial attempt to extend those findings, we performed the complementary experiment; that is, we immunoprecipitated CBP/p300 and assayed associated STAT1. With this approach, we could not find evidence of a defect in STAT1 binding to CBP/p300. Because the amount of STAT1 binding to CBP/p300 was more likely to correlate with the function of a transcriptional complex at STAT1-dependent genes, we investigated the function of STAT1 in more detail.
To further understand the mechanism(s) whereby M. tuberculosis inhibits cellular responses to IFN-
, we have used the cell line THP-1. We found that the effect of M. tuberculosis on IFN-
-responsive gene expression that we had found in primary human MDMØ also occurred in THP-1 cells. We also report in this work that the effect of M. tuberculosis is limited to a subset of IFN-
-responsive genes, that inhibition of transcription of specific genes occurs despite recruitment of STAT1 to endogenous promoters, and does not affect histone acetylation at the promoters of IFN-
-responsive genes.
| Materials and Methods |
|---|
|
|
|---|
THP-1 cells were grown in RPMI 1640 medium supplemented with 10% heat-inactivated FCS and 2 mM L-glutamine (Invitrogen, San Diego, CA). For each experiment, cells were seeded at 1.5 x 105 cells/well of a six-well plate and treated with 10 nM PMA (Sigma-Aldrich, St. Louis, MO) in RPMI 1640/10% FCS overnight.
Live M. tuberculosis was cultured, prepared, and quantitated, as previously described (17). A 50 mg/ml (dry weight) stock suspension of
-irradiated M. tuberculosis H37Rv (Colorado State University, Fort Collins, CO; National Institutes of Health, National Institute of Allergy and Infectious Diseases Contract N01 AI-75320) was prepared by syringe shearing to disrupt clumps of bacteria. Briefly, the material was suspended at 250 mg/ml in Dulbeccos PBS (D-PBS) and passed 10 times each through 18-, 21-, 25-, and 27-gauge needles. The stock was further diluted to 50 mg/ml, aliquotted, and stored at -80°C. Each aliquot was thawed and passed 10 times through a 27-gauge needle immediately before use.
Before addition of M. tuberculosis, PMA-containing medium was removed from the adherent THP-1 cells, and was replaced with 1.5 ml of RPMI 1640/2.5% FCS containing M. tuberculosis at a multiplicity of infection of 12.5 live bacteria or 500 µg/ml
-irradiated bacteria. After 4 h at 37°C, extracellular bacteria were removed by washing three times with RPMI 1640, and fresh RPMI 1640/2.5% FCS medium containing 10 nM PMA was added.
Forty-eight hours after addition of live or irradiated bacteria, the THP-1 cells were treated with IFN-
for 1624 h before cells were scraped, washed, and stained for flow cytometry. For experiments with live M. tuberculosis, cells were stained with PE-conjugated anti-CD64 (Ancell, Bayport, MN) or isotype control before washing and fixation with 4% paraformaldehyde for 1 h. After treatment with paraformaldehyde, cells were analyzed by flow cytometry (10,000 total events per sample). For experiments with irradiated M. tuberculosis, cells were stained with FITC-conjugated anti-CD64 (Ancell), counterstained with propidium iodide (1 µg/ml; Sigma-Aldrich), and analyzed by flow cytometry (10,000 live cells per condition).
Unless otherwise indicated, 20 ng/ml (3 x 107 U/ml) human rIFN-
(Genentech, South San Francisco, CA) was used in all experiments. This concentration is
5-fold above the concentration that elicited maximal CD64 surface expression after 16-h treatment of PMA-differentiated THP-1 cells.
Western blotting
To analyze phosphorylation of STAT1, after 2 days of M. tuberculosis treatment, the cell culture medium was changed, and 2 h later, cells were treated with IFN-
or medium alone. After 15 or 30 min, cells were lysed on ice in radioimmunoprecipitation buffer with the addition of Complete-Mini protease inhibitor cocktail (Roche, Basel, Switzerland) and phosphatase inhibitor cocktails I and II (Sigma-Aldrich). Immunoblotting was performed, as previously described (17). Abs used were: NEB (Beverly, MA) monoclonal anti-phosphotyrosine (Y701) STAT1 at 1:1000; Upstate Biotechnology (Lake Placid, NY) polyclonal anti-phosphoserine (S727) STAT1 at 1 µg/ml; and Zymed (San Francisco, CA) monoclonal anti-STAT1
at 1 µg/ml. Annexin I (detected with rabbit polyclonal anti-annexin I at 1:50,000) was used as a loading control. Zymed HRP-conjugated goat anti-mouse or goat anti-rabbit was used as a secondary Ab, and bound Abs were detected with Amersham (Arlington Heights, IL) ECL-Plus reagent. Chemiluminescence was detected by exposure of x-ray film.
EMSA
After 2 days of M. tuberculosis infection, the cell culture medium was changed, and 2 h later, cells were treated with IFN-
(20 ng/ml) or medium alone. After 15 or 30 min, cells were lysed on ice in nondenaturing whole cell lysis buffer (18). Briefly, cells were lysed in high salt buffer containing 400 mM KCl, then diluted to a final KCl concentration of 100 mM (final buffer composition: 0.1% Triton X-100, 10 mM HEPES, pH 7.3, 2 mM EDTA, 1 mM EGTA, 10% glycerol, 1 mM NaF, 100 mM KCl, 1 mM orthovanadate, 1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 2 µg/ml pepstatin A). Whole cell lysates were preincubated with specific or nonspecific competitor oligonucleotide, Ab, isotype control, or buffer alone for 10 min at room temperature, before the addition of 3.5 pmol 32P end-labeled double-stranded
-activated sequence (GAS)-containing oligonucleotide and 20-min incubation at room temperature. Probes were end labeled with Redivue adenosine 5'-(
-32P)-triphosphate (Amersham Pharmacia Biotech, Piscataway, NJ) using T4 polynucleotide kinase (NEB). The sequence of the GAS oligonucleotide is derived from the CD64 promoter (19) (GTATTTCCCAGAAAAGGAAC); the nonspecific competitor is a scrambled version of the CD64 promoter (TCTAAATTTAGTCCAGTAACTGCA). For supershift analysis, 1 µg specific Ab (monoclonal anti-STAT1 N-term; Transduction Laboratories, Lexington, KY) or IgG1 control (BD PharMingen, San Diego, CA) was used. The EMSA incubation buffer consisted of the nondenaturing whole cell lysis buffer listed above with the addition of 1 mM DTT and 50 µg/ml poly(dI-dC). Samples were run in a 4% acrylamide, 2.5% glycerol, 0.5x Tris-borate-EDTA gel for 34 h. The gel was then dried and exposed to film overnight.
Decreased CD64 expression was confirmed by ELISA for each EMSA experiment. The cells were lysed in ELISA lysis buffer (0.3% Nonidet P-40, 2 mM EGTA, 4 mM EDTA, 150 mM NaCl, 50 mM Tris, pH 7.4, 1 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 2 µg/ml pepstatin). Lysates were incubated in 96-well plates coated with 200 ng/well human IgG1 (Sigma-Aldrich), and bound CD64 was detected using HRP-conjugated anti-CD64 mAb (clone 32.2) and 3,3',5,5'-tetramethylbenzidine substrate (Sigma-Aldrich).
mRNA quantitation and actinomycin D treatment
After 2 days of infection, cells were treated with IFN-
(20 ng/ml) for up to 12 h before total RNA was harvested using Qiagen (Valencia, CA) RNeasy columns. A total of 1 µg of each sample was reverse transcribed using the Reverse Transcription System (Promega, Madison, WI). The cDNA equivalent of 10 ng of total RNA (100 ng for class II transactivator (CIITA)) of each sample was analyzed by quantitative PCR using SYBR Green 2x Mastermix (Applied Biosystems, Foster City, CA) on an ABI PRISM 7700 Sequence Detection System. Relative values were determined by comparing the threshold cycle of each sample with a standard curve consisting of serial dilutions of a positive control cDNA sample. The oligonucleotide primers used were: CD64 488845 (ATGGCACCTACCATTGCTCAGG, CCAAGCACTTGAAGCTCCAACTC), CIITA 32223713 (TGACCTGGGTGCCTACAAACTC, GCAAGATGTGGTTCATTCCGC), GAPDH 536899 (TTGGTATCGTGGAAGGACTCATG, TCGCTGTTGAAGTCAGAGGAGAC), guanylate-binding protein-1 (GBP-1) 716-1225 (TGAAACTTTTAACCTGCCCAGACT, GCCGCTAACTCCTTTTGAAATAGA), IFN consensus sequence-binding protein (ICSBP) 82278 (AGTGGCTGATCGAGCAGATT, AGTGGCTGGTTCAGCTTTGT), indoleamine-2,3-dioxygenase (IDO) 916-1118 (GGCAAAGGTCATGGAGATGT, CTGCAGTCTCCATCACGAAA), IFN regulatory factor 1 (IRF-1) 727-1175 (GGCCCTGACTCCAGCACTGTC, GCTACGGTGCACAGGGAATGG), monokine induced by
(MIG) 711910 (CCACATCCCACTCACAACAG, AGGCCTGTAGGCTGATTCAA).
For analysis of mRNA decay rates, after 2 days of infection, cells were treated for 12 h with 20 ng/ml IFN-
, followed by addition of fresh medium containing 5 µg/ml actinomycin D (Sigma-Aldrich). Total RNA was harvested up to 8 h later using Qiagen RNeasy columns. Samples were analyzed by slot blot. Briefly, samples were denatured in 10 mM NaOH, then transferred to a positively charged nylon membrane (Bio-Rad, Hercules, CA) by vacuum using a Bio-Rad Bio-Dot SF. The blot was UV irradiated to cross-link RNA to the membrane, then blocked in ExpressHyb (Clontech, Palo Alto, CA) at 68°C, before addition of 32P-labeled probe and incubation at 68°C for 2 h to overnight. Probes were cloned and radiolabeled, as previously described (17). Blots were washed twice at room temperature in 2x SSC/0.05% SDS and twice at 50°C in 0.1x SSC/0.1% SDS. Radioactive signals on blots were quantitated using a Storm 840 PhosphorImager (Molecular Dynamics, Sunnyvale, CA). Blots were stripped using boiling 0.5% SDS and reblocked before addition of each subsequent probe.
Transfection and plasmids
RAW 264.7 cells were grown in DMEM medium supplemented with 10% heat-inactivated FCS and 2 mM L-glutamine. One day before transfection, cells were seeded at 2 x 106 per 10-cm dish. Cells were transfected with 5 µg pGAS-luciferase reporter plasmid (Stratagene, La Jolla, CA) using TransIT transfection reagent (Mirus, Madison, WI). Eight hours later, cells were split into 12-well plates allowed to readhere overnight. CIITA promoter activity was monitored using stable transfectants. Cells were stably cotransfected with a construct containing -477 to +83 of the CIITA promoter IV-driving luciferase (20) and pCDNA 3.1 neo (Invitrogen). Cells were selected and maintained in 400 µg/ml Geneticin (Invitrogen). Cells were treated with 632 µl 500 µg/ml
-irradiated M. tuberculosis or left untreated. Twenty-four hours after addition of bacteria, fresh medium with or without 20 ng/ml (transient transfectants) or 2 ng/ml (stable transfectants) murine rIFN-
(BD PharMingen) was added. After overnight treatment with IFN-
, cells were washed with D-PBS and lysed using Passive Lysis Buffer (Promega). Luciferase activity was measured using Promega Luciferase Assay reagent in a TD-20/20 Luminometer (Turner Designs, Palo Alto, CA). Luciferase values were normalized to protein concentration using the BCA Protein Assay (Pierce, Rockford, IL). For analysis of surface expression of MHC class II, untransfected RAW 264.7 cells were treated with M. tuberculosis and IFN-
, as described for the transient transfectants. These cells were then scraped, washed, and stained for flow cytometry. Cells were stained with PE-conjugated anti-mouse I-A/I-E (BD PharMingen), counterstained with propidium iodide (1 µg/ml; Sigma-Aldrich), and analyzed by flow cytometry (10,000 live cells per condition).
Chromatin immunoprecipitation
THP-1 cells were seeded at 2.25 x 107 cells per 15-cm dish and treated with 10 nM PMA. Cells were treated with 22.5 ml per dish of
-irradiated M. tuberculosis at 500 µg/ml, as described above. After 2 days, 2 ng/ml human IFN-
was added. Chromatin immunoprecipitations were performed using reagents from Upstate Biotechnology (Lake Placid, NY) chromatin immunoprecipitation (ChIP) kit. After 4 h of IFN-
treatment, formaldehyde was added to a final concentration of 1%, and cells were incubated at room temperature with gentle agitation for 10 min. Glycine was then added to a final concentration of 250 mM, and cells were incubated 5 min at room temperature. Cells were washed with D-PBS and lysed in SDS lysis buffer with the addition of Complete-Mini protease inhibitor cocktail (Roche), 10 mM sodium butyrate, and phosphotase inhibitor cocktails I and II (Sigma-Aldrich). The lysate was sonicated in a Branson 250 Sonicator with a one-eighth-inch tapered micro tip, using 14 pulses of 10 s each at 25% power output. The resulting chromatin solution was diluted (1/10 for anti-acetylated histone immunoprecipitations, 1/50 for anti-STAT1 IPs) and precleared, as described in the Upstate Biotechnology protocol. Precleared lysates were incubated overnight at 4°C with 5 µg of either anti-acetylated histone H3 or anti-acetylated histone H4 polyclonal Abs or 8 µg anti-STAT1 (C-terminal) polyclonal Ab (all from Upstate Biotechnology). Complexes were bound to protein A agarose and washed, and DNA was eluted and purified, all as described in the Upstate Biotechnology ChIP kit protocol. Five percent of the resulting DNA was used in each PCR. Quantitative PCR was performed in triplicate on an ABI PRISM 7700 Sequence Detection System using SYBR Green 2x Mastermix (Applied Biosystems). Oligonucleotides used were: CD64 promoter, -110 to + 46 (GGGAGAGATGGGCTAACAGGTATG, TTGAAGAGGTTCTGCTGGTGGC); GAPDH promoter, -172 to +17 (AAAAGCGGGGAGAAAGTAGGGC, AACAGGAGGAGCAGAGAGCGAAGC).
| Results |
|---|
|
|
|---|
in THP-1 cells
We have previously shown that live and
-irradiated M. tuberculosis inhibited responses to IFN-
in human MDMØ (17). Because of the experimental limitations of human MDMØ, we characterized the human monocytic leukemia cell line THP-1 as an alternative to primary cells. We found that PMA-differentiated THP-1 cells up-regulated surface expression of Fc
RI (CD64) in response to IFN-
, and we found that infection of these cells with live M. tuberculosis resulted in inhibition of the response to IFN-
comparable to that seen in MDMØ (Fig. 1). In addition, we found that
-irradiated M. tuberculosis also inhibited IFN-
induction of CD64 in THP-1 cells (data not shown).
|
without affecting proximal events in IFN signaling
As an initial step in characterizing the mechanism of M. tuberculosis inhibition of responses to IFN-
in THP-1 cells, we examined STAT1 content and IFN-
-stimulated tyrosine phosphorylation of STAT-1. There was no decrease in STAT1
protein content in THP-1 cells treated with
-irradiated M. tuberculosis (Fig. 2A), in contrast to the decrease that has been reported for the transcription factors upstream stimulatory factor 1 and regulatory factor X 5 in cells infected with Chlamydia trachomatis (21). In fact, the abundance of STAT1 was increased in THP-1 cells exposed to M. tuberculosis, as we previously observed in primary MDMØ. Before addition of IFN-
, there was low background STAT1 tyrosine phosphorylation in both untreated and
-irradiated M. tuberculosis-treated THP-1 cells (Fig. 2B). Within 15 min of IFN-
treatment, there was robust phosphorylation of STAT1
and STAT1
on tyrosine 701 in both M. tuberculosis-treated and control cells. There was no decrease or delay in STAT1 tyrosine phosphorylation in response to IFN-
in the M. tuberculosis-treated cells compared with that of control cells (Fig. 2B). Similar results were seen in PMA-differentiated THP-1 cells infected with live M. tuberculosis: there was no difference in the rate or extent of STAT1 tyrosine phosphorylation in response to IFN-
(data not shown). Because the transcriptional activity of STAT1 is confined to STAT1
, and STAT1
is transcriptionally inactive (22, 23), we examined THP-1 cells to determine whether M. tuberculosis altered the relative amounts of STAT1
and STAT1
in THP-1 cells. We found no change in the relative abundance of STAT1
compared with STAT1
after treatment with M. tuberculosis (data not shown).
|
at serine 727 is required for full transcriptional activity (24). Unlike human MDMØ, we found a significant level of serine-phosphorylated STAT1 in PMA-treated THP-1 cells in the absence of IFN-
stimulation. Serine 727 phosphorylation of STAT1
was further increased following addition of IFN-
treatment, and this was not diminished by prior exposure to M. tuberculosis (Fig. 2C).
Because we found that IFN-
-induced STAT1 serine and tyrosine phosphorylation were not decreased in M. tuberculosis-exposed cells, we conclude that defects in STAT1 phosphorylation do not account for the defects in responsiveness to IFN-
that we observed. This also implies that steps proximal to STAT1 activation, including expression and function of IFNGR1, IFNGR2, JAK1, and JAK2, are unaffected by M. tuberculosis under the conditions of our experiments.
M. tuberculosis does not affect STAT1 dimerization or DNA binding
Tyrosine phosphorylation is required for formation of STAT1 homodimers; these dimers are then competent to bind DNA containing a consensus
-activated sequence (GAS). To determine whether M. tuberculosis interferes with dimerization and GAS binding of the STAT1 in response to IFN-
, we used an EMSA utilizing a 20-bp oligonucleotide probe containing the GAS and flanking sequences from the human CD64 promoter (19). Lysates from THP-1 cells that had not been treated with IFN-
showed no detectable GAS-binding activity. Lysates from uninfected cells that had been treated with IFN-
for 15 or 30 min showed significant GAS binding, and there was no decrease in GAS binding in lysates from M. tuberculosis-infected cells at either time point. This GAS oligonucleotide binding was specific, as indicated by inhibition in the presence of a 50-fold excess of unlabeled CD64 GAS oligonucleotide, but not by a 50-fold excess of unlabeled control oligonucleotide. All shifted complexes in lysates from infected cells contained STAT1, as evidenced by a complete supershift of this band with an anti-STAT1 Ab (Fig. 3).
|
-induced increases in CD64 mRNA in infected THP-1 cells
Despite normal STAT1 activation in M. tuberculosis-infected cells, there was a significant defect in CD64 surface expression. Because this decrease in surface expression could reflect a defect in mRNA transcription, RNA degradation, protein synthesis, or protein trafficking, we examined the steady state level of CD64 mRNA in live M. tuberculosis-infected and control cells in response to IFN-
. We found that, comparable to MDMØ, PMA-treated THP-1 cells expressed a low basal level of CD64 mRNA in the absence of IFN-
. After 4 and 8 h of IFN-
treatment, control cells exhibited an almost 9-fold increase in CD64 mRNA. M. tuberculosis-infected cells expressed 34 and 41% less CD64 mRNA than uninfected cells at 4 and 8 h, respectively (Fig. 4A). Similar results were found in THP-1 cells treated with
-irradiated M. tuberculosis (Fig. 4B). Because this decrease in mRNA level was of a magnitude comparable to the decrease in CD64 surface expression, we concluded that the defect imposed by M. tuberculosis is exerted at the level of mRNA expression.
|
The decrease in CD64 mRNA levels in M. tuberculosis-infected THP-1 cells could be the result of either decreased transcription or increased degradation. To distinguish between these two possibilities, we assayed the degradation rate of CD64 mRNA. We treated M. tuberculosis-infected THP-1 cells with IFN-
for 12 h before changing to fresh medium containing 5 µg/ml actinomycin D. RNA harvested before the addition of actinomycin D indicated that CD64 mRNA steady state level was decreased in infected compared with uninfected cells after 12 h of IFN-
treatment (data not shown). After addition of actinomycin D, however, the rate of decay of CD64 message in uninfected and infected cells was indistinguishable (Fig. 5). These results indicate that the decrease in CD64 (or CIITA; data not shown) message is not due to increased degradation, and therefore is likely to be due to decreased transcription.
|
-responsive CIITA IV promoter
To examine the effect of M. tuberculosis on transcription from an IFN-
-responsive promoter, we used a promoter construct containing -477 to +83 of the murine CIITA promoter IV-driving luciferase (20). Because our efforts to achieve adequate transfection efficiencies to analyze responses in M. tuberculosis- and IFN-
-treated THP-1 cells met with limited success, we used the murine macrophage-like cell line RAW 264.7 for these experiments, because M. tuberculosis inhibits responses to IFN-
in these cells by a mechanism that is indistinguishable from that in THP-1 cells (V. Nagabhushanam and J. Ernst, unpublished observation). In RAW 264.7 cells stably transfected with the CIITA promoter IV-driving luciferase construct, luciferase expression increased
4-fold after overnight treatment with IFN-
. In M. tuberculosis-treated cells, however, there was a marked defect in the response to IFN-
(Fig. 6). The observation that M. tuberculosis inhibited transcriptional activation of a reporter gene driven by a promoter fragment provides further evidence that the effect of M. tuberculosis is exerted at the level of transcriptional activation of IFN-
-responsive genes.
|
To further examine IFN-
signaling and STAT1 function in M. tuberculosis-treated cells, we used a minimal 4x GAS promoter-driving luciferase. In the absence of IFN-
, there was very low luciferase expression in RAW264.7 cells transfected with the GAS promoter-driving luciferase construct. After overnight treatment with IFN-
, luciferase expression increased
200-fold in control cells. In M. tuberculosis-treated cells, luciferase expression was induced to a slightly higher level in response to IFN-
(Fig. 7A). The amount of M. tuberculosis and the duration of treatment used in these experiments were able to inhibit IFN-
signaling in RAW cells; untransfected cells treated in parallel showed a marked defect in IFN-
induction of MHC class II surface expression (Fig. 7B). The observation that M. tuberculosis did not inhibit transcriptional activation from a synthetic GAS element indicates that STAT1 is functionally activated to a normal extent, and suggests that additional or alternative elements are required for M. tuberculosis inhibition of transcription.
|
Although STAT1 is competent to bind to and drive transcription from minimal GAS sequences in M. tuberculosis-treated cells, neither EMSA nor transient transfection of reporter constructs necessarily reflects the STAT1-binding activity at endogenous promoters. Standard EMSA conditions may overestimate the stability of STAT1 binding (25), and transient transfections may not reflect the chromatin structure and accessibility of the native promoter. We therefore used chromatin immunoprecipitation to determine whether M. tuberculosis inhibits transcriptional responses to IFN-
by altering recruitment or binding of STAT1, and/or decreasing histone acetylation at the endogenous CD64 promoter in intact THP-1 cells.
Using modified experimental conditions, which revealed a 5060% inhibition of mRNA expression in M. tuberculosis-treated cells (Fig. 8A), we performed ChIP analysis using an anti-STAT1 Ab, to determine whether M. tuberculosis inhibits CD64 expression by decreasing STAT1 recruitment to or binding at the endogenous CD64 promoter. We used a saturating amount of anti-STAT1 Ab, as determined in pilot experiments. In the absence of IFN-
treatment, association between STAT1 and the endogenous CD64 promoter was not significantly different from the mock-immunoprecipitation control (data not shown). In contrast, the amount of CD64 promoter DNA coprecipitated with STAT1 increased
5-fold after 30 min of IFN-
treatment, indicating a rapid recruitment of STAT1 to the CD64 promoter (Fig. 8B). However, there was no significant difference in the amount of STAT1-associated CD64 promoter in M. tuberculosis-treated cells compared with control cells. By mixing lysates of unstimulated and IFN-
-stimulated cells in varying ratios, we confirmed that the immunoprecipitation method used in these assays was sufficiently sensitive to detect a 25% decrease in STAT1 binding to the CD64 promoter (data not shown). The finding that there was no decrease in CD64 promoter coprecipitated with STAT1 indicates that there was no detectable defect in STAT1 recruitment to or stabilization at the native CD64 promoter in response to M. tuberculosis, despite a
50% decrease in CD64 mRNA in the same experiment (Fig. 8A).
|
-dependent gene transcription by decreasing the acetylation of histones, we examined the extent of acetylation of histones H3 and H4 at the CD64 promoter. We found that the amount of CD64 promoter DNA coprecipitated with acetylated histone H3 increased
3-fold after 30 min of IFN-
treatment, and that a similar amount of coprecipitated CD64 promoter was detected in M. tuberculosis-treated cells compared with untreated cells (Fig. 8C). Likewise, there was no detectable difference in acetylated histone H4 at the CD64 promoter in M. tuberculosis-treated THP-1 cells (Fig. 8D).
The inhibitory effect of M. tuberculosis is restricted to a subset of IFN-
-responsive genes
To determine whether M. tuberculosis inhibits transcription of all IFN-
-responsive genes, we extended our analysis of RNA expression to include additional genes, using real-time RT-PCR. As previously noted, CD64 mRNA levels were decreased in M. tuberculosis-infected cells after 4 and 8 h of IFN-
treatment. CIITA, the transcriptional coactivator required for MHC class II expression, was induced
100-fold after 4 and 8 h of IFN-
treatment. This induction was
40% less in M. tuberculosis-infected cells (Fig. 9A).
|
-responsive genes were slightly or substantially increased in the same experiment. In infected cells, there was a slight increase in the IFN-
induction of GBP-1 (Fig. 9B), an IFN-
-responsive GTPase. IRF-1 (Fig. 9C), a transcription factor required for the transcription of a subset of IFN-
-responsive genes, also showed a slight increase in its IFN-
induction. In contrast, M. tuberculosis infection caused a 3- to 5-fold increase in IFN-
induction of RNA encoding indoleamine-2,3-dioxygenase (IDO, Fig. 9D).
In a longer time course in M. tuberculosis-treated cells, RNA expression of the transcription factor ICSBP (Fig. 9E) and the chemoattractant MIG (Fig. 9F) was not decreased in M. tuberculosis-treated cells at any time point, despite a decrease in CD64 mRNA at all time points in the same experiment (Fig. 4B). These results show that the effect of M. tuberculosis does not extend to all IFN-
-responsive genes, and also confirm that the inhibition of IFN-
responses is not the result of a global depression of transcription in these cells.
| Discussion |
|---|
|
|
|---|
signaling, we found that PMA-treated THP-1 cells exhibited a comparable effect by M. tuberculosis, and provided greater experimental flexibility and reproducibility. This indicates that the mediators of M. tuberculosis-induced inhibition of responses to IFN-
are not restricted to primary human macrophages. In addition, in every assay in which live infection and treatment with
-irradiated M. tuberculosis were compared, the results were consistent between the two systems.
Several distinct mechanisms of inhibition of IFN-
signaling have been described. Mycobacterium avium (27) and Leishmania donovani (28) have both been shown to inhibit IFN-
signaling by down-regulating IFNGR expression at the cell surface. In contrast, our finding of normal phosphorylation of STAT1 in M. tuberculosis-infected cells indicates that proximal signaling steps are not inhibited. Normal phosphorylation of STAT1 in response to IFN-
also indicates that suppressor of cytokine signaling-1, which regulates IFN-
signaling by blocking JAK1/2 phosphorylation of STAT1, is not responsible for the defect.
Another physiological inhibitor of IFN-
signaling, protein inhibitor of activated STAT 1, acts by blocking DNA binding by activated STAT1 (29). Because our EMSA, supershift, and ChIP experiments indicated that GAS binding was normal in M. tuberculosis-infected THP-1 cells, inhibition of DNA binding of STAT1 is not likely to be involved in M. tuberculosis inhibition of IFN-
signaling.
Decreased expression of certain IFN-
-responsive genes is not the result of a general transcription block, because expression of luciferase under the control of a minimal GAS promoter was unaffected by M. tuberculosis treatment of macrophages, and IFN-
-responsive genes such as IRF-1, GBP-1, and IDO were expressed to a normal or increased extent. Our observation that CIITA, which is required for MHC class II expression, is among the genes whose induction was markedly inhibited by M. tuberculosis, is consistent with the finding that M. tuberculosis is capable of inhibiting MHC class II mRNA expression in IFN-
-treated murine macrophages (30). This also emphasizes a specific means whereby M. tuberculosis inhibition of IFN-
responses could limit the recognition of infected macrophages, because IFN-
may be unique in its ability to induce MHC class II on macrophages.
The finding that actinomycin D treatment did not reveal any change in the degradation rate of CD64 or CIITA mRNA in M. tuberculosis-infected cells, together with the defect in luciferase expression driven by a portion of the CIITA IV promoter in M. tuberculosis-treated cells, supports the conclusion that M. tuberculosis exerts its effect at the level of transcription. This transcriptional defect, however, was not the result of decreased STAT1 access or binding to the CD64 promoter, because chromatin immunoprecipitation experiments showed no decrease in STAT1 bound to the endogenous CD64 promoter in M. tuberculosis-treated THP-1 cells. Consistent with STAT1 binding to the promoter, histone acetylation, a marker for remodelled chromatin and transcriptionally accessible promoters, was normal in M. tuberculosis-treated cells. Despite a defect in certain IFN-
-responsive genes in M. tuberculosis-infected cells, we have found no defect in STAT1 function at any step from protein level and phosphorylation to binding of the native CD64 promoter and recruitment and/or activation of histone acetyltransferases. Because a subset of IFN-
-responsive genes was inhibited by M. tuberculosis, we expect that specific elements and regulatory mechanisms distinguish genes that are sensitive to inhibition from those that are resistant to inhibition. Our observations, together with those of others (17, 30, 31, 32, 33, 34, 35, 36, 37, 38), that virulent mycobacteria and mycobacterial components can inhibit cellular responses to IFN-
suggest that this is one general mechanism whereby the bacteria can survive in humans and experimental animals that develop a cellular immune response to Ags produced by the bacteria. In addition, these observations may help to explain recent findings that IFN-
responses do not correlate with assays of mycobacterial growth inhibition after bacillus Calmette-Guérin (BCG) vaccination in humans (39). In addition, a study comparing BCG vaccination of rhesus and cynomolgus monkeys, two highly related macaque species, found that there was no correlation between purified protein derivative-induced production of IFN-
by PBMCs and protection conferred by BCG vaccination (40). Together, these observations suggest that efforts to develop new vaccines for tuberculosis should not solely rely on T lymphocyte production of IFN-
as the in vitro correlate of potential efficacy of candidate vaccines. Moreover, further understanding of the underlying mechanisms whereby M. tuberculosis inhibits cellular responses to IFN-
may allow means for circumventing these mechanisms, and achieve more effective containment or eradication of the bacteria by a cellular immune response.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Joel D. Ernst, New York University School of Medicine, 550 First Avenue, NB 16S8, New York, NY 10016. E-mail address: joel.ernst{at}med.nyu.edu ![]()
3 Abbreviations used in this paper: IFNGR, IFN-
receptor; BCG, bacillus Calmette-Guérin; ChIP, chromatin immunoprecipitation; CIITA, class II transactivator; D-PBS, Dulbeccos PBS; GAS,
-activated sequence; GBP-1, guanylate-binding protein-1; ICSBP, IFN consensus sequence-binding protein; IDO, indoleamine-2,3-dioxygenase; IRF-1, IFN regulatory factor 1; JAK, Janus kinase; MDMØ, monocyte-derived macrophage; MIG, monokine induced by
. ![]()
Received for publication March 3, 2003. Accepted for publication June 18, 2003.
| References |
|---|
|
|
|---|
in resistance to Mycobacterium tuberculosis infection. J. Exp. Med. 178:2249.
gene-disrupted mice. J. Exp. Med. 178:2243.
-mediated immunity is a genetically controlled continuous trait that determines the outcome of mycobacterial invasion. Immunol. Rev. 178:129.[Medline]
in tuberculous pleuritis. J. Immunol. 145:149.[Abstract]
gene activation in pulmonary tuberculosis. Am. J. Respir. Crit. Care Med. 149:989.[Abstract]
, IL-4 and TNF-
protein and CD8 T cells producing IL-12p40 mRNA in human lung tuberculous granulomas. Immunology 105:325.[Medline]
-dependent signaling. Trends Immunol. 23:96.[Medline]
-activated human monocytes down-regulate transferrin receptors and inhibit the intracellular multiplication of Legionella pneumophila by limiting the availability of iron. J. Clin. Invest. 83:1457.
Interferon activates human macrophages and Toxoplasma gondii, Chlamydia psittaci and Leishmania donovani: antimicrobial role of limiting intracellular iron. Infect. Immun. 59:4684.
Interferon activates human macrophage to become tumoricidal and leishmanicidal but enhances replication of macrophage-associated mycobacteria. Infect. Immun. 50:1.
-interferon on human monocytes and murine peritoneal macrophages. Immunology 59:333.[Medline]
transcriptional responses without inhibiting activation of STAT1. J. Immunol. 163:3898.
attenuates the class II transactivator and reveals an accessory pathway of IFN-
action. J. Immunol. 158:1095.[Abstract]
activation sequence mediates the transcriptional regulation of the IgG Fc receptor type IC gene by interferon-
. Mol. Immunol. 32:841.[Medline]
regulation of class II transactivator promoter IV in macrophages and microglia: involvement of the suppressors of cytokine signaling-1 protein. J. Immunol. 166:2260.
. Science 261:1744.
and -
signal transduction pathways. EMBO J. 12:4221.[Medline]
Janus kinase-STAT signaling and gene induction by down-regulation of the IFN-
receptor. J. Immunol. 163:2041.
signaling by Leishmania donovani. J. Infect. Dis. 181:1121.[Medline]
and Mycobacterium tuberculosis: signaling roles of nitric oxide synthase-2 and phagocyte oxidase. J. Exp. Med. 194:1123.
-mediated activation in mouse macrophages treated with lipoarabinomannan. Clin. Exp. Immunol. 80:141.[Medline]
interferon-mediated activation of macrophages. Infect. Immun. 56:1232.
interferon. Infect. Immun. 55:446.
interferon in macrophages infected with Mycobacterium leprae. Infect. Immun. 56:1912.This article has been cited by other articles:
![]() |
A. J. Wolf, L. Desvignes, B. Linas, N. Banaiee, T. Tamura, K. Takatsu, and J. D. Ernst Initiation of the adaptive immune response to Mycobacterium tuberculosis depends on antigen production in the local lymph node, not the lungs J. Exp. Med., January 21, 2008; 205(1): 105 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Pennini, Y. Liu, J. Yang, C. M. Croniger, W. H. Boom, and C. V. Harding CCAAT/Enhancer-Binding Protein beta and {delta} Binding to CIITA Promoters Is Associated with the Inhibition of CIITA Expression in Response to Mycobacterium tuberculosis 19-kDa Lipoprotein J. Immunol., November 15, 2007; 179(10): 6910 - 6918. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Z. Kincaid, A. J. Wolf, L. Desvignes, S. Mahapatra, D. C. Crick, P. J. Brennan, M. S. Pavelka Jr., and J. D. Ernst Codominance of TLR2-Dependent and TLR2-Independent Modulation of MHC Class II in Mycobacterium tuberculosis Infection In Vivo J. Immunol., September 1, 2007; 179(5): 3187 - 3195. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Singhal, A. Jaiswal, V. K. Arora, and H. K. Prasad Modulation of Gamma Interferon Receptor 1 by Mycobacterium tuberculosis: a Potential Immune Response Evasive Mechanism Infect. Immun., May 1, 2007; 75(5): 2500 - 2510. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. H. Boekhoudt, M. R. Frazier-Jessen, and G. M. Feldman Immune complexes suppress IFN-{gamma} signaling by activation of the Fc{gamma}RI pathway J. Leukoc. Biol., April 1, 2007; 81(4): 1086 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Cooke, S. J. Campbell, J. Sillah, P. Gustafson, B. Bah, G. Sirugo, S. Bennett, K. P. W. J. McAdam, O. Sow, C. Lienhardt, et al. Polymorphism within the Interferon-{gamma}/Receptor Complex Is Associated with Pulmonary Tuberculosis Am. J. Respir. Crit. Care Med., August 1, 2006; 174(3): 339 - 343. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. D. Pecora, A. J. Gehring, D. H. Canaday, W. H. Boom, and C. V. Harding Mycobacterium tuberculosis LprA Is a Lipoprotein Agonist of TLR2 That Regulates Innate Immunity and APC Function J. Immunol., July 1, 2006; 177(1): 422 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Pennini, R. K. Pai, D. C. Schultz, W. H. Boom, and C. V. Harding Mycobacterium tuberculosis 19-kDa Lipoprotein Inhibits IFN-{gamma}-Induced Chromatin Remodeling of MHC2TA by TLR2 and MAPK Signaling J. Immunol., April 1, 2006; 176(7): 4323 - 4330. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Jandu, P. J. M. Ceponis, S. Kato, J. D. Riff, D. M. McKay, and P. M. Sherman Conditioned Medium from Enterohemorrhagic Escherichia coli-Infected T84 Cells Inhibits Signal Transducer and Activator of Transcription 1 Activation by Gamma Interferon Infect. Immun., March 1, 2006; 74(3): 1809 - 1818. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Banaiee, E. Z. Kincaid, U. Buchwald, W. R. Jacobs Jr., and J. D. Ernst Potent Inhibition of Macrophage Responses to IFN-{gamma} by Live Virulent Mycobacterium tuberculosis Is Independent of Mature Mycobacterial Lipoproteins but Dependent on TLR2. J. Immunol., March 1, 2006; 176(5): 3019 - 3027. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, H. M. Curry, B. S. Zwilling, and W. P. Lafuse Mycobacteria Inhibition of IFN-{gamma} Induced HLA-DR Gene Expression by Up-Regulating Histone Deacetylation at the Promoter Region in Human THP-1 Monocytic Cells J. Immunol., May 1, 2005; 174(9): 5687 - 5694. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Chang, J. J. Linderman, and D. E. Kirschner Multiple mechanisms allow Mycobacterium tuberculosis to continuously inhibit MHC class II-mediated antigen presentation by macrophages PNAS, March 22, 2005; 102(12): 4530 - 4535. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Prabhakar, Y. Qiao, A. Canova, D. B. Tse, and R. Pine IFN-{alpha}{beta} Secreted during Infection Is Necessary but Not Sufficient for Negative Feedback Regulation of IFN-{alpha}{beta} Signaling by Mycobacterium tuberculosis J. Immunol., January 15, 2005; 174(2): 1003 - 1012. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Pai, M. E. Pennini, A. A. R. Tobian, D. H. Canaday, W. H. Boom, and C. V. Harding Prolonged Toll-Like Receptor Signaling by Mycobacterium tuberculosis and Its 19-Kilodalton Lipoprotein Inhibits Gamma Interferon-Induced Regulation of Selected Genes in Macrophages Infect. Immun., November 1, 2004; 72(11): 6603 - 6614. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Qing and G. R. Stark Alternative Activation of STAT1 and STAT3 in Response to Interferon-{gamma} J. Biol. Chem., October 1, 2004; 279(40): 41679 - 41685. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Gehring, K. M. Dobos, J. T. Belisle, C. V. Harding, and W. H. Boom Mycobacterium tuberculosis LprG (Rv1411c): A Novel TLR-2 Ligand That Inhibits Human Macrophage Class II MHC Antigen Processing J. Immunol., August 15, 2004; 173(4): 2660 - 2668. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Hagge, N. A. Ray, J. L. Krahenbuhl, and L. B. Adams An In Vitro Model for the Lepromatous Leprosy Granuloma: Fate of Mycobacterium leprae from Target Macrophages after Interaction with Normal and Activated Effector Macrophages J. Immunol., June 15, 2004; 172(12): 7771 - 7779. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Fortune, A. Solache, A. Jaeger, P. J. Hill, J. T. Belisle, B. R. Bloom, E. J. Rubin, and J. D. Ernst Mycobacterium tuberculosis Inhibits Macrophage Responses to IFN-{gamma} through Myeloid Differentiation Factor 88-Dependent and -Independent Mechanisms J. Immunol., May 15, 2004; 172(10): 6272 - 6280. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Fulton, S. M. Reba, R. K. Pai, M. Pennini, M. Torres, C. V. Harding, and W. H. Boom Inhibition of Major Histocompatibility Complex II Expression and Antigen Processing in Murine Alveolar Macrophages by Mycobacterium bovis BCG and the 19-Kilodalton Mycobacterial Lipoprotein Infect. Immun., April 1, 2004; 72(4): 2101 - 2110. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Qiao, S. Prabhakar, A. Canova, Y. Hoshino, M. Weiden, and R. Pine Posttranscriptional Inhibition of Gene Expression by Mycobacterium tuberculosis Offsets Transcriptional Synergism with IFN-{gamma} and Posttranscriptional Up-Regulation by IFN-{gamma} J. Immunol., March 1, 2004; 172(5): 2935 - 2943. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. MacMicking, G. A. Taylor, and J. D. McKinney Immune Control of Tuberculosis by IFN-{gamma}-Inducible LRG-47 Science, October 24, 2003; 302(5645): 654 - 659. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |