The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cariappa, A.
Right arrow Articles by Pillai, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cariappa, A.
Right arrow Articles by Pillai, S.
The Journal of Immunology, 2003, 171: 1875-1880.
Copyright © 2003 by The American Association of Immunologists

A Catalytically Inactive Form of Protein Kinase C-Associated Kinase/Receptor Interacting Protein 4, a Protein Kinase C{beta}-Associated Kinase That Mediates NF-{kappa}B Activation, Interferes with Early B Cell Development1

Annaiah Cariappa2, Luojing Chen2,3, Khaleda Haider, Mei Tang, Eugene Nebelitskiy, Stewart T. Moran and Shiv Pillai4

Massachusetts General Hospital Cancer Center, Harvard Medical School, Boston, MA 02129


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Protein kinase C-associated kinase (PKK)/receptor interacting protein 4 (RIP4) is a protein kinase C (PKC) {beta}-associated kinase that links PKC to NF-{kappa}B activation. The kinase domain of PKK is similar to that of RIP, RIP2, and RIP3. We show in this study that PKK is expressed early during lymphocyte development and can be detected in common lymphoid progenitor cells. Targeting of a catalytically inactive version of PKK to lymphoid cells resulted in a marked impairment in pro-B cell generation in the bone marrow. Although peripheral B cell numbers were markedly reduced, differentiation into follicular and marginal zone B cells was not defective in these mice. B-1a and B-1b B cells could not be detected in these mice, but this might be a reflection of the overall defect in B cell production observed in these animals. In keeping with a possible link to PKC{beta}, peripheral B cells in these mice exhibit a defect in anti-IgM-mediated proliferation. These studies suggest that PKK may be required early in B cell development and for BCR-mediated B cell proliferation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Engagement of the B cell receptor by multivalent Ags results in the activation initially of Src family kinases and subsequently of Syk and Btk. The study of B lymphocyte development in mice that harbor mutations in genes that lie upstream and downstream of Btk has revealed a pathway in which every player is required for B cell receptor (BCR5)-mediated follicular B cell proliferation, and for B-1 cell generation (1, 2, 3, 4, 5, 6, 7, 8, 9, 10). All participants upstream of and including phospholipase C (PLC) {gamma}2 also contribute to the maintenance or differentiation of mature follicular (IgDhigh IgMlow) B cells. This signaling cascade involves the activation of phosphatidylinositol 3-kinase and Src family kinases, the consequent activation of Btk, and the subsequent activation of PLC{gamma}2 (6, 7, 8, 9). Other critical participants in this pathway include CD45, B cell adaptor for phosphoinositide 3-kinase, CD19, and B cell linker protein (reviewed in Refs. 5 and 10). In addition, Aiolos may be a negative regulator of this pathway (11). PLC{gamma}2, by facilitating the generation of 1,2-diacylglycerol and inositol 1,4,5-triphosphate from phosphatidylinositol 4,5-bis-phosphate, contributes to the activation of a number of protein kinase C (PKC) isoforms, including PKC{beta}. This PKC isoform is required for B cell proliferation and for the generation of B-1 cells (12), but, based on published flow cytometric evidence, is apparently not required as critically as Btk for the maintenance of IgDhigh IgMlow follicular B cells. This assumption is based on the apparent abundance of mature follicular IgDhigh IgMlow B cells at steady state in PKC{beta} null mice, but other evidence exists to suggest that PKC{beta} may be required for B cell survival during BCR-triggered proliferation (13, 14).

Btk and PLC{gamma} may contribute to the activation of NF-{kappa}B and consequently the induction of Bcl-xL (15, 16, 17, 18). The activation of PKC{beta} appears to be critical for NF-{kappa}B activation (13, 14). Constitutive phosphorylation of I{kappa}B kinase (IKK){alpha}, which is observed in wild-type B cells, is not seen in PKC{beta}-deficient B cells, and the BCR-induced phosphorylation of IKK{beta} and the subsequent degradation of I{kappa}B{alpha} are defective in PKC{beta} null B cells (13). PKC{beta} therefore appears to be the final known extranuclear component of a multistep pathway that is required for Ag receptor-driven B cell proliferation and the generation of B-1 cells. PKC{beta} does not directly phosphorylate IKK{alpha} or IKK{beta} (13), and while it may be required for the recruitment of IKK to lipid rafts (14), the mechanism by which it contributes to the activation of NF-{kappa}B is not known.

We have described an ankyrin repeat-containing kinase, PKC-associated kinase (PKK), that was cloned on the basis of its association with PKC{beta} in a two-hybrid screen (19). PKC{beta} can associate with PKK in vivo and phosphorylate it, but the significance of this phosphorylation event is not known. PKK can also associate with PKC{delta} (20). PKK participates in the activation of NF-{kappa}B downstream of phorbol ester and PKC{beta}, and may therefore be one of the missing links between PKC{beta} and NF-{kappa}B activation (21, 22).

The kinase domain of PKK is highly homologous to the catalytic domains of members of the receptor interacting protein (RIP) family of protein kinases, which include RIP, RIP2, and RIP3 (21, 22) (Fig. 1a). RIP is a death domain-containing kinase that associates with TNFRI and Fas (23, 24, 25). RIP2 is a caspase-associated recruitment domain-containing kinase that associates with TNFR1, and the TNFR-associated factor (TRAF) 1, TRAF5, and TRAF6 adaptors (26, 27, 28). The C terminus of RIP3 has no homology to any known functional domain (29). RIP kinases share the ability to activate NF-{kappa}B though a kinase-independent mechanism. Following TNFR stimulation, both RIP and RIP2 have been shown to recruit IKK-{gamma}, and to consequently contribute to the activation of the IKK complex, suggesting that these RIP family members function as scaffold-like molecules, rather than as protein kinases, when they activate NF-{kappa}B (24, 25, 26, 30). As with other RIP kinases, PKK can activate NF-{kappa}B when overexpressed in cell lines, but in contrast to the other RIP kinases, the catalytic activity of PKK is considered to be required for NF-{kappa}B activation (21, 22). In addition, PKK can activate NF-{kappa}B in IKK-{gamma}-deficient cell lines (21), further suggesting that it induces the activation of NF-{kappa}B by a distinct mechanism from that used by other RIP kinases.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 1. PKK is an ankyrin repeat-containing kinase whose catalytic domain resembles that of RIP kinases. a, A schematic comparison of PKK and the RIP kinases. b, A schematic view of the K51R-PKK cloned into the p1026x expression vector that was used to generate transgenic mice.

 
PKK has no orthologs in Drosophila or Caenorhabditis elegans. Given the unique nature of PKK, and the fact that catalytically inactive forms of PKK can functionally inactivate the wild-type kinase in nonlymphoid cells, we proceeded to generate dead kinase PKK transgenic mice in which mutant PKK was targeted to the B and T lineages. Our studies reveal that PKK is expressed in common lymphoid progenitor cells. A kinase-dead PKK transgene is expressed very early in B cell development and results in a marked impairment of pro-B cell generation. As a result, in the periphery, dead kinase PKK transgenic mice display a marked reduction in peripheral B cells. Peripheral B cells in these mice do not proliferate efficiently in response to BCR triggering. Potential roles of PKK, possibly in parallel with one or more RIP kinases, during early B cell development and in the periphery are discussed.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of K51R PKK transgenic lines

The K51R form of PKK (19) was cloned into the p1026x vector (31) (Fig. 1b) kindly provided by B. Iritani and R. Perlmutter (University of Washington, Seattle, WA). Transgenic lines were generated by the Massachusetts General Hospital transgenic facility. Transgene-specific founders were identified by Southern blot analysis of tail DNA using a probe for human growth hormone (hGH) and were bred with C57BL/6 mice. One founder line derived from the first injection presented with a marked reduction in bone marrow and splenic B cells. This line was designated L1. Screening of founders from a second injection revealed a second line, L2, which also presented with a marked reduction of B cells in the spleen and bone marrow. Sixteen other founder lines did not reveal any detectable alteration in splenic B or T cell populations. Transgene expression was also not detected in the spleens of these lines, which were not studied further.

Flow cytometric analysis

Flow cytometry was performed essentially as described earlier (32). For flow sorting, cells were stained with a cocktail of lineage-specific, PE-conjugated Abs against the following Ags: CD3{epsilon} (clone 145-2C11), CD4 (clone GK1.5), CD8{alpha} (clone 53-6.7), CD19 (clone 1D3), CD45R (clone RA3-6B2), pan-NK (clone DX5), Gr-1 (clone RB6-8C5), CD11b (clone M1/70), and TER-119 (clone TER-119), along with anti-CD117 APC clone 2B8, and anti-CD127 biotin clone B12-1. Flow sorting was performed on an Epics Altra hypersort system (Beckman Coulter, Fullerton, CA). Purity of sorted samples was always >96%.

RT-PCR

Standard methods were used to prepare total cellular RNA and first strand cDNA from flow-purified cells. The following primers (5'-3', forward followed by reverse) were used in the PCR: Ikaros, CACTACCTCTGGAGCACAGC and TCTGAGGCATAGAGCTCTTAC; PU1, GAGTTTGAGAACTTCCCTGAG and TCTGAGGCATAGAGCTCTTAC; E2a, CATCCATGTCCTGCGAAGCCA and TTCTTGTCCTCTTCGGCGTC; Pax-5, TCAGGACAGGACATGGAGGAG and GATCCTGTTGATGGAGCTGACG; CD19, GAATGACTGACCCCGCCAGG and GAGTCACGTGGTTCCCCAAGT; Ebf, CCGGGCTCACTTTGAGAAGCAG and CAGGGAGTAGCATGTTCCCAGAT; hypoxanthine guanine phosphoribosyltransferase, CACAGGACTAGAACACCTGC and GCTGGTGAAAAGGACCTCT; PKK, TAGGGCTCATGCAACGGTG and AGACAGTGACAGCGATCCTC. Transgene expression was monitored by PCR for hGH, using 5'-AAGAAGCCTATATCCCAAAGG-3' and 5'-GGATTTCTGTTGTGTTTCCTC-3' as forward and reverse primers, respectively.

CFSE assay

Single cell suspensions were prepared from whole spleens following RBC lysis. A total of 1 x 107 splenocytes was resuspended in PBS, and CFSE (Molecular Probes, Eugene, OR) was added to a final concentration of 2 µM. After 10 min in the dark at room temperature, and 5 min in a 37° water bath, the cells were washed once with RPMI 1640 medium containing 10% FCS. A total of 5 x 106 cells in 1 ml of medium was cultured in duplicate in flat-bottom 24-well plates with medium alone or with medium + goat anti-mouse IgM (F(ab')2 (µ-chain specific) (10 µg/ml; Jackson ImmunoResearch Laboratories, West Grove, PA) for 48 h. The cells were then harvested and stained with CD23 PE, and two-color flow cytometric analysis of B cell division was performed by gating on CD23+ cells.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inhibition of bone marow pro-B cell generation in K51R PKK transgenic mice

To examine whether PKK participates in signaling downstream of PKC{beta} during B cell development, we introduced a cDNA for a kinase-dead form of PKK (PKK K51R) (19) into a transgenic vector, p1026X, that is expressed early in B and T cell development (31) (Fig. 1b). This vector contains the Lck-proximal promoter, the Ig H chain intronic enhancer, and a nontranslatable version of the human growth hormone gene. Transgene-positive lines, as determined by PCR and Southern blot, were maintained by breeding with C57BL/6 mice. Two independent transgene-positive lines (PKK K51R line 1 and PKK K51R line 2) with markedly decreased numbers of bone marrow and peripheral B cells were identified. As seen in Fig. 2, there is a marked reduction in peripheral B cells both in the spleen (Fig. 2a) and in the mesenteric lymph nodes (Fig. 2b) in lines 1 and 2, the reduction being more evident in line 1. The possibility that the defect was one in B cell production in the bone marrow was explored. As seen in Fig. 3a, CD43 and CD45 staining of the bone marrow revealed a striking reduction in bone marrow pro-B, pre-B, and B cells in line 1, and a slightly more circumscribed defect in line 2. Line 1 also presented with a marked defect at the double-negative to double-positive T cell stage, but T cell development was not discernibly influenced in line 2 (data not shown). Probing a genomic Southern blot revealed that line 1 contains multiple copies of a PKK transgene, whereas line 2 has a low copy number insert (Fig. 3b). These results are consistent with nonquantitative RT-PCR approaches, indicating that the transgene can be more readily detected in common lymphoid progenitor cells of line 1 (see Fig. 4b below, and data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 2. Transgenic expression of a catalytically inactive form of PKK results in a major reduction in peripheral B cells. a, Proportions of splenic CD45R+ B cells in wild-type and K51R-PKK transgenic mice. b, Proportions of mesenteric lymph node CD45R+ B cells in wild-type and K51R-PKK transgenic mice.

 


View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 3. Transgenic expression in early lymphoid cells of a catalytically inactive form of PKK results in a major reduction in bone marrow pro-B, pre-B, and B cells. a, CD45R and CD43 staining of bone marrow of two transgenic mouse lines expressing PKK K51R revealed a reduction in CD45R+CD43+ pro-B and pre-B cells as well as a reduction in CD45R+CD43- pre-B and B cells. b, A Southern blot was performed using 10 µg of liver DNA from lines 1 and 2 and a transgene-specific hGH probe. The most prominent band in both lines is indicated by an arrowhead.

 


View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 4. PKK is expressed in common lymphoid progenitor cells. a, PKK is expressed in Lin- IL-7R+ c-Kit+ bone marrow cells. RT-PCR was performed on RNA obtained from flow-sorted cells. RT-PCR was also performed in unsorted cells as a control. b, The PKK/hGH transgene is expressed in Lin- IL-7R+c-Kit+ common lymphoid progenitor cells in the bone marrow. RT-PCR was performed on flow-sorted cells from wild-type and line 1 mice.

 
PKK is expressed in common lymphoid progenitors

The marked reduction in pro-B cell numbers suggested that PKK might be required during B cell development, perhaps even for commitment to the B lineage. Such an inference presupposes that both endogenous PKK and the PKK transgene must be expressed very early in development. To establish whether PKK is expressed in early B cell progenitors/common lymphoid progenitors, we purified Lin- IL-7R+ c-Kit+ bone marrow cells from C57BL/6 mice. The studies of Kincade and coworkers (33) suggest that the cell population that contains the earliest definable B cell progenitors shares many features with a common lymphoid progenitor population, as defined by Weissman’s laboratory (34). As seen in the left panel of Fig. 4a, Ikaros, PU.1, and E2a are expressed in these Lin- IL-7R+ c-Kit+ cells, while Ebf, Pax-5, and CD19 are not detected in this population (but can be detected in total bone marrow; right panel, Fig. 4a). However, PKK is expressed in these progenitors, which is consistent with a possible role for this kinase early in B cell development. The absolute numbers of Lin- IL-7R+ c-Kit+ cells were comparable in wild-type, L1, and L2 mice, suggesting that these cells are not eliminated by expression of the transgene (data not shown). It has not been established as to how early in development genes driven by the p1026X vector are expressed. The absence of early B cells in mice expressing an N17Ras transgene cloned in p1026x suggests that p1026x may be capable of inducing gene expression in early B cell progenitors (31). RT-PCR for hGH sequences and PKK on RNA from Lin- IL-7R+ c-Kit+ cells from wild-type and line 1 mice revealed that the transgene is expressed as early as the common lymphoid progenitor/early B cell progenitor stage (Fig. 4b).

Peripheral B cell development in K51R PKK transgenic mice

Although the number of peripheral B cells is markedly reduced in line 1 mice, this reduction is less striking in line 2 mice (Fig. 2), and there is a ~12-fold reduction in the absolute numbers of splenic B cells even in this latter line. In contrast to the relative absence of IgDhighIgMlow follicular B cells first described in the Xid mouse (35), follicular B cells are clearly discernible in the spleen in both line 1 and line 2, albeit in the context of an overall reduction in peripheral B cell numbers (Fig. 5, upper panel). Marginal zone B cells are also spared in relative terms in both line 1 and line 2, but more so in line 1 (Fig. 5, lower panel), suggesting that once B lineage cells are generated (albeit, in an inefficient manner) in mice expressing a dominant-negative PKK transgene, differentiation into follicular and marginal zone B lineages is not defective (Table I). However, B-1 cell generation or maintenance is strikingly compromised. In both lines, there is an almost total absence of peritoneal B-1a and B-1b cells (Fig. 6). It is, however, quite possible that this absence of B-1 B cells does not represent a specific differentiation defect, but reflects the overall absence of B cell generation not just from stem cells of bone marrow origin, but from fetal liver-derived stem cells as well.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 5. PKK K51R transgenic B cells are qualitatively capable of differentiating into mature follicular and marginal zone B cells, although absolute numbers of peripheral B cells are markedly diminished. Upper panel, Splenic B cells from both transgenic lines and from wild-type mice were stained with Abs to IgM and IgD. Lower panel, CD21high marginal zone B cells were identified in the IgMhighIgDlow (fraction III) gate.

 

View this table:
[in this window]
[in a new window]
 
Table I. Absolute numbers of various splenic fractions

 


View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 6. B-1a and B-1b peritoneal B cells are markedly reduced in PKK K51R transgenic mice. Peritoneal B cells stained with Abs to IgM, CD5 (upper panel), and CD11b (lower panel) were compared in wild-type and transgenic mice.

 
A defect in BCR-dependent proliferation in K51R PKK transgenic mice

Although a loss of B-1 cells in K51R PKK transgenic mice would be consistent with a defect in a PKC{beta}-dependent event, we realize that this virtual absence of B-1 cells could well reflect a more global defect in early B cell development. Although biochemical studies are relatively difficult in these mice, given the reduction in peripheral B cell numbers, we performed in vitro proliferation assays using CFSE-labeled B cells that were triggered with anti-IgM. These studies suggest a defect in BCR-triggered proliferation in B cells from lines 1 and 2 (Fig. 7), generally similar to what might be expected in the absence of PKC{beta}.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 7. Anti-IgM-induced B cell proliferation is impaired in PKK K51R transgenic B cells. Splenocytes were labeled with CFSE and cross-linked with F(ab')2 anti-IgM, and CD23+ cells were gated on after 48 h.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PKC{beta} null mice present with defects in peripheral B cell development, in particular the absence of B-1 cells, but there is no block in early B cell development (12). Unlike CD45 null, B cell adaptor for phosphoinositide 3-kinase null, Btk null, or PLC{gamma}2 null mice (reviewed in Ref. 5), there appears not to be a defect in the survival of IgDhighIgMlow follicular B cells, as evidenced by flow cytometry of splenocytes for IgM and IgD. However, there is documented evidence for an overall reduction in survival of peripheral B cells in the absence of PKC{beta} (13). The examination of the phenotypes of a number of mutant mice involving genes in the Btk pathway has contributed to the consideration of a signal strength model for the development of the three different categories of naive B cells (5). It appears that PKK, a kinase that associates with PKC{beta}, and that contributes to the PKC-dependent activation of NF-{kappa}B, may be required for the PKC{beta}-mediated proliferation of peripheral B cells and also for the generation or survival of B-1 B cells. However, it is possible that the defect in B-1 cell generation seen in K51R PKK transgenic mice reflects a more global defect in B cell generation. It is unclear whether PKC{beta} and PKK are functionally linked in vivo, although the defective B cell proliferation seen in K51R PKK transgenic mice is consistent with such a notion. However, Bcl-10, caspase-associated recruitment domain 11, and mucosa-associated lymphoid tissue lymphoma translocation gene 1 are believed to contribute to PKC-dependent NF-{kappa}B activation downstream of the BCR and the TCR (36, 37), and it is possible that both PKK and Bcl-10 contribute separately to BCR-mediated NF-{kappa}B activation.

When one observes a phenotype in a single transgenic line, the possibility exists that this might be due to an insertional mutation. However, the likelihood of generating a phenotypically similar insertional mutation in a second independent transgenic line is considered to be extremely low; finding two independent founders with a similar phenotype is generally considered to represent strong evidence against insertional mutagenesis. A block in B cell development was seen in both males and females, and in a heterozygous state, in lines 1 and 2. Given the existence of two independent founders with a shared phenotype, it is extremely unlikely that the early B cell developmental block seen resulted from either an activating or inactivating insertional mutation.

In order for a kinase-dead molecule to function in a dominant interfering manner, it must be expressed at relatively high levels (in order for it to compete effectively with its endogenous counterpart or counterparts). In general, high level expression of any transgene is obtained in only a small proportion of founders, and this depends in part on the integration of the transgene into a favorable chromatin context. We therefore conclude that the early B cell developmental block seen independently in lines 1 and 2, but not in other founders, reflects the relatively high expression of kinase-dead PKK in these two transgenic lines.

Recent studies on pkk null mice (38), which die late in fetal life, have revealed that PKK is required for epithelial cell differentiation and/or survival. Preliminary studies on radiation chimeras revealed no obvious defect in B cell generation, but actual numbers of B cells generated have not been determined, B-1 B cells were not examined, and no studies on B cell proliferation have been performed. The relationship between the phenotypes observed in this study and those of pkk null mice will require a more complete examination of pkk null radiation chimeras, and this is now in progress. It remains possible that a kinase-dead form of PKK may functionally inactivate PKK as well as other members of the RIP family in vivo and thus contribute not only to a PKC{beta}-like peripheral B cell phenotype, but also impact upon early B cell development. Inactivation of RIP results in lymphopenia and embryonic lethality (25), but B cell development has been shown to be normal in reconstituted mice (39). RIP2 is required for innate and adaptive immunity in part because of its importance in Toll-like receptor signaling (27, 28). The phenotype of RIP3 null mice remains to be determined. It is possible that K51R PKK transgenic mice target not only PKK/RIP4, but also one or more members of the RIP family, thereby possibly revealing a cryptic role for more than one RIP kinase in early B cell development.


    Acknowledgments
 
We thank John Daley, Suzan Lazo-Kallanian, and Michelle Connole for their contributions. We thank Ramnik Xavier for helpful advice.


    Footnotes
 
1 This work was supported by grants from the National Institutes of Health (AI33507 and DK43351), the Arthritis Foundation, and the Avon Foundation. Back

2 A.C. and L.C. contributed equally to this study. Back

3 Current address: University of Rochester, School of Medicine and Dentistry, Rochester, NY 14642. Back

4 Address correspondence and reprint requests to Dr. Shiv Pillai, MGH Cancer Center, Building 149, 13th Street, Charlestown, MA 02129. E-mail address: pillai{at}helix.mgh.harvard.edu Back

5 Abbreviations used in this paper: BCR, B cell receptor; IKK, I{kappa}B kinase; PKC, protein kinase C; PKK, PKC-associated kinase; PLC, phospholipase C; RIP, receptor interacting protein; TRAF, TNFR-associated factor; hGH, human growth hormone. Back

Received for publication February 20, 2003. Accepted for publication June 3, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kurosaki, T.. 1999. Genetic analysis of B cell antigen receptor signaling. Annu. Rev. Immunol. 17:555.[Medline]
  2. Aoki, Y., K. Isselbacher, S. Pillai. 1994. Bruton’s tyrosine kinase is tyrosine phosphorylated and activated in pre-B lymphocytes and receptor ligated B cells. Proc. Natl. Acad. Sci. USA 91:10606.[Abstract/Free Full Text]
  3. De Weers, M., G. S. Brouns, S. Hinshelwood, C. Kinnon, R. K. Schuurman, R. W. Hendriks, J. Borst. 1994. B-cell antigen receptor stimulation activates the human Bruton’s tyrosine kinase, which is deficient in X-linked agammaglobulinemia. J. Biol. Chem. 269:23857.[Abstract/Free Full Text]
  4. Saouaf, S. J., S. Mahajan, R. B. Rowley, S. A. Kut, J. Fargnoli, A. L. Burkhardt, S. Tsukada, O. N. Witte, J. B. Bolen. 1994. Temporal differences in the activation of three classes of non-transmembrane protein tyrosine kinases following B-cell antigen receptor surface engagement. Proc. Natl. Acad. Sci. USA 91:9524.[Abstract/Free Full Text]
  5. Cariappa, A., S. Pillai. 2002. Antigen dependent B lymphocyte development. Curr. Opin. Immunol. 14:241.[Medline]
  6. Rawlings, D. J., A. M. Scharenberg, H. Park, M. I. Wahl, S. Lin, R. M. Kato, A. C. Fluckiger, O. N. Witte, J. P. Kinet. 1996. Activation of BTK by a phosphorylation mechanism initiated by SRC family kinases. Science 271:822.[Abstract]
  7. Fruman, D. A., S. B. Snapper, C. M. Yballe, L. Davidson, J. Y. Yu, F. W. Alt, L. C. Cantley. 1999. Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85{alpha}. Science 283:393.[Abstract/Free Full Text]
  8. Wang, D., J. Feng, R. Wen, J. C. Marine, M. Y. Sangster, E. Parganas, A. Hoffmeyer, C. W. Jackson, J. L. Cleveland, P. J. Murray, J. N. Ihle. 2000. Phospholipase C{gamma}2 is essential in the functions of B cell and several Fc receptors. Immunity 13:25.[Medline]
  9. Takata, M., T. Kurosaki. 1996. A role for Bruton’s tyrosine kinase in B cell antigen receptor-mediated activation of phospholipase C-{gamma}2. J. Exp. Med. 184:31.[Abstract/Free Full Text]
  10. Pillai, S., S. T. Moran. 2002. Tec kinase pathways in lymphocyte development and transformation. Biochim. Biophys. Acta 1602:162.[Medline]
  11. Cariappa, A., M. Tang, C. Parng, E. Nebelitskiy, M. Carroll, K. Georgopoulos, S. Pillai. 2001. The follicular versus marginal zone B lymphocyte cell fate decision is regulated by Aiolos, Btk, and CD21. Immunity 14:603.[Medline]
  12. Leitges, M., C. Schmedt, R. Guinamard, J. Davoust, S. Schaal, S. Stabel, A. Tarakhovsky. 1996. Immunodeficiency in protein kinase C{beta} deficient mice. Science 273:988.
  13. Saijo, K., I. Mecklenbrauker, A. Santana, M. Leitger, C. Schmedt, A. Tarakhovsky. 2002. Protein kinase C{beta} controls nuclear factor {kappa}B activation in B cells through selective regulation of the I{kappa}B kinase {alpha}. J. Exp. Med. 195:1647.[Abstract/Free Full Text]
  14. Su, T. T., B. Guo, Y. Kawakami, K. Sommer, K. Chae, L. A. Humphries, R. M. Kato, S. Kang, L. Patrone, R. Wall, et al 2002. PKC-{beta} controls I{kappa}B kinase lipid raft recruitment and activation in response to BCR signaling. Nat. Immun. 3:780.[Medline]
  15. Bajpai, U. D., K. Zhang, M. Teutsch, R. Sen, H. J. Wortis. 2000. Bruton’s tyrosine kinase links the B cell receptor to nuclear factor {kappa}B activation. J. Exp. Med. 191:1735.[Abstract/Free Full Text]
  16. Petro, J. B., S. M. Jamshedur Rahman, D. W. Ballard, W. N. Khan. 2000. Bruton’s tyrosine kinase is required for activation of I{kappa}B kinase and nuclear factor {kappa}B in response to B cell receptor engagement. J. Exp. Med. 191:1745.[Abstract/Free Full Text]
  17. Petro, J. B., W. N. Khan. 2001. Phospholipase C-{gamma}2 couples Bruton’s tyrosine kinase to the NF-{kappa}B signaling pathway in B lymphocytes. J. Biol. Chem. 276:1715.[Abstract/Free Full Text]
  18. Anderson, J. S., M. Teutsch, Z. Dong, H. H. Wortis. 1996. An essential role for Bruton’s tyrosine kinase in the regulation of B-cell apoptosis. Proc. Natl. Acad. Sci. USA 93:10966.[Abstract/Free Full Text]
  19. Chen, L., K. Haider, M. Ponda, A. Cariappa, D. Rowitch, S. Pillai. 2001. Protein kinase C-associated kinase (PKK), a novel membrane-associated, ankyrin repeat-containing protein kinase. J. Biol. Chem. 276:21737.[Abstract/Free Full Text]
  20. Bahr, C., A. Rohwer, L. Stempka, G. Rincke, F. Marks, M. Gschwendt. 2000. DIK, a novel protein kinase that interacts with protein kinase C{delta}: cloning, characterization, and gene analysis. J. Biol. Chem. 275:36350.[Abstract/Free Full Text]
  21. Muto, A., J. Ruland, L. M. McAllister-Lucas, P. C. Lucas, S. Yamaoka, F. F. Chen, A. Lin, T. W. Mak, G. Nunez, N. Inohara. 2002. Protein kinase C-associated kinase (PKK) mediates Bcl10-independent NF-{kappa}B activation induced by phorbol ester. J. Biol. Chem. 277:31871.[Abstract/Free Full Text]
  22. Meylan, E., F. Martinon, M. Thome, M. Gschwendt, J. Tschopp. 2002. RIP4 (DIK/PKK), a novel member of the RIP kinase family, activates NF-{kappa}B and is processed during apoptosis. EMBO Rep. 3:1201.[Medline]
  23. Stanger, B. Z., P. Leder, T. H. Lee, E. Kim, B. Seed. 1995. RIP: a novel protein containing a death domain that interacts with fas/APO-1 (CD95) in yeast and causes cell death. Cell 81:512.
  24. Hsu, H., J. Huang, H. B. Shu, V. Baichwal, D. V. Goeddel. 1996. TNF dependent recruitment of the protein kinase RIP to the TNFRI signaling complex. Immunity 4:387.[Medline]
  25. Kelliher, M. A., S. Grimm, Y. Ishida, F. Kuo, B. Z. Stanger, P. Leder. 1998. The death domain kinase RIP mediates the TNF-induced NF-{kappa}B signal. Immunity 8:297.[Medline]
  26. McCarthy, J. V., J. Ni, V. M. Dixit. 1998. RIP2 is a novel NF-{kappa}B-activating and cell death-inducing kinase. J. Biol. Chem. 273:16968.[Abstract/Free Full Text]
  27. Kobayashi, K., N. Inohara, L. E. Hernandez, J. E. Galan, G. Nunez, C. A. Janeway, R. Medzhitov, R. A. Flavell. 2002. RICK/Rip2/CARDIAK mediates signalling for receptors of the innate and adaptive immune systems. Nature 416:194.[Medline]
  28. Chin, A. I., P. W. Dempsey, K. Bruhn, J. F. Miller, Y. Xu, G. Cheng. 2002. Involvement of receptor interacting protein 2 in innate and adaptive immune responses. Nature 416:190.[Medline]
  29. Sun, X., J. Yin, M. A. Starovasnik, W. J. Fairbrother, V. M. Dixit. 2002. Identification of a novel homotypic interaction motif required for the phosphorylation of receptor-interacting protein (RIP) byRIP3. J. Biol. Chem. 277:9505.[Abstract/Free Full Text]
  30. Kasof, G. M., J. C. Prosser, D. Liu, M. V. Lorenzi, B. C. Gomes. 2000. The RIP-like kinase, RIP3, induces apoptosis and NF-{kappa}B nuclear translocation and localizes to mitochondria. FEBS Lett. 473:285.[Medline]
  31. Iritani, B. M., K. A. Forbush, M. A. Farrar, R. M. Perlmutter. 1997. Control of B cell development by Ras-mediated activation of Raf. EMBO J. 16:7019.[Medline]
  32. Cariappa, A., T. J. Kim, S. Pillai. 1999. Accelerated emigration of B lymphocytes in the Xid mouse. J. Immunol. 162:4417.[Abstract/Free Full Text]
  33. Tudor, K. S., K. J. Payne, Y. Yamashita, P. W. Kincade. 2000. Functional assessment of precursors from murine bone marrow suggests a sequence of early B lineage differentiation events. Immunity 12:335.[Medline]
  34. Kondo, M., I. L. Weissman, K. Akashi. 1997. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell 91:661.[Medline]
  35. Hardy, R. R., K. Hayakawa, D. R. Parks, L. A. Herzenberg. 1983. Demonstration of B cell maturation in X-linked immunodeficient mice by simultaneous three color immunofluorescence. Nature 306:270.[Medline]
  36. Ruland, J., G. S. Duncan, A. Elia, I. del Barco Barrantes, L. Nguyen, S. Plyte, D. G. Millar, D. Bouchard, A. Wakeham, P. S. Ohashi, T. W. Mak. 2001. Bcl10 is a positive regulator of antigen receptor-induced activation of NF-{kappa}B and neural tube closure. Cell 104:33.[Medline]
  37. Pomerantz, J. L., E. M. Denny, D. Baltimore. 2002. CARD11 mediates factor-specific activation of NF-{kappa}B by the T cell receptor complex. EMBO J. 21:5184.[Medline]
  38. Holland, P., C. Willis, S. Kanaly, M. Glaccum, A. Warren, K. Charrier, J. Murison, J. Derry, G. Virca, T. Bird, J. Peschon. 2002. RIP4 is an ankyrin repeat-containing kinase essential for keratinocyte differentiation. Curr. Biol. 12:1424.[Medline]
  39. Cusson, N., S. Oikemus, E. D. Kilpatrick, M. Kelliher. 2002. The death domain kinase RIP protects thymocytes from tumor necrosis factor receptor type 2-induced cell death. J. Exp. Med. 196:15.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. T. Moran, A. Cariappa, H. Liu, B. Muir, D. Sgroi, C. Boboila, and S. Pillai
Synergism between NF-{kappa}B1/p50 and Notch2 during the Development of Marginal Zone B Lymphocytes
J. Immunol., July 1, 2007; 179(1): 195 - 200.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. S. Vivarelli, D. McDonald, M. Miller, N. Cusson, M. Kelliher, and R. S. Geha
RIP Links TLR4 to Akt and Is Essential for Cell Survival in Response to LPS Stimulation
J. Exp. Med., August 2, 2004; 200(3): 399 - 404.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cariappa, A.
Right arrow Articles by Pillai, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cariappa, A.
Right arrow Articles by Pillai, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS