|
|
||||||||

* Department of Pathology and
Division of Infectious Disease, Case Western Reserve University, Cleveland, OH 44106
| Abstract |
|---|
|
|
|---|
-activated macrophages. Inhibition was dependent on TLR-2 for MTB 19-kDa lipoprotein (but not whole MTB or the other PAMPs); inhibition was dependent on myeloid differentiation factor 88 for MTB and all of the individual PAMPs. Inhibition of MHC-II and alternate MHC-I processing was delayed, appearing after 16 h of PAMP exposure, as would occur in chronically infected macrophages. Despite inhibition of alternate MHC-I Ag processing, there was no inhibition of MHC-I expression, MHC-I-restricted presentation of exogenous peptide or conventional MHC-I processing of cytosolic Ag. MTB 19-kDa lipoprotein and other PAMPs inhibited phagosome maturation and phagosome Ag degradation in a myeloid differentiation factor 88-dependent manner; this may limit availability of peptides to bind MHC-I. By inhibiting both MHC-II and alternate MHC-I Ag processing, pathogens that establish prolonged infection of macrophages (>16 h), e.g., MTB, may immunologically silence macrophages and evade surveillance by both CD4+ and CD8+ T cells, promoting chronic infection. | Introduction |
|---|
|
|
|---|
B pathway to activate innate and acquired immunity (1, 2). TLR signaling can enhance APC function, e.g., by induction of dendritic cell maturation (3, 4). However, prolonged exposure to PAMPs can inhibit macrophage APC function (5, 6). CD4+ T cells play an important role in controlling infections with pathogens such as MTB (7, 8). Presentation of microbe-derived peptides on MHC class II (MHC-II) molecules is required to generate CD4+ T cell responses. Some pathogens, e.g., MTB, can inhibit MHC-II-restricted Ag presentation to evade recognition by CD4+ T cells. Impaired Ag processing by MTB-infected macrophages has been demonstrated to result from reduced MHC-II synthesis (9) or transport (10). MTB 19-kDa lipoprotein was identified as a major inhibitor of macrophage MHC-II expression and Ag processing (6).
Although CD4+ T cells are the dominant T cell subset in MTB immunity, CD8+ T cells also contribute. MTB-specific CD8+ T cells have been isolated from infected humans and mice (11, 12, 13, 14, 15, 16, 17, 18). Susceptibility to MTB is increased in mice with deficits in CD8+ T cell function or class I MHC (MHC-I) Ag presentation, e.g. mice genetically deficient in
2-microglobulin, transporter for Ag processing (TAP), or MHC class Ia molecules (7, 19, 20, 21). Mice with
2-microglobulin deficiency are more susceptible to MTB than mice that are deficient in MHC class Ia molecules, perhaps due to derangement of systems other than MHC-I that depend on
2-microglobulin (19), but MHC-I still appears to contribute to CD8+ T cell responses to MTB (7, 19, 20, 21). CD8+ T cells may contribute to MTB immune responses either by lysis of infected cells or by secretion of IFN-
(13, 17, 22).
Mechanisms whereby MTB and other pathogens are processed for presentation by MHC-I molecules remain poorly understood. One possibility is that bacterial Ags cross vacuolar membranes to reach the macrophage cytosol, thereby achieving access to proteasome-dependent processing and TAP-dependent entry into the endoplasmic reticulum to bind MHC-I molecules. This pathway has been demonstrated in some systems and may contribute to cross-priming of CD8+ T cells by dendritic cells (e.g., via processing of apoptotic cells). However, other MHC-I processing mechanisms may occur, especially in macrophages, which are infected by some pathogens, e.g., MTB, and present MTB Ags to effector CD8+ T cells (22, 23). In macrophages, alternate MHC-I Ag processing of MTB (22, 23) and other bacteria (24) proceeds in the presence of inhibitors of cytosolic conventional MHC-I processing, indicating that vacuolar alternate MHC-I processing mechanisms contribute. Vacuolar alternate MHC-I processing involves phagosomal degradation of Ag and binding of peptides to MHC-I in phagosomes (or possibly also on the cell surface after peptide recycling and release, i.e., "regurgitation") (24, 25, 26).
Although cellular immune responses help contain infection and prevent overt disease in most cases, viable MTB persists in macrophages for long periods, evading immune mechanisms. Although earlier studies revealed mechanisms for evasion of CD4+ T cell responses by MTB (by inhibiting MHC-II expression and Ag processing) (6), little is known about potential mechanisms by which MTB or other pathogens that infect macrophages may evade CD8+ T cell responses. This study reveals that alternate MHC-I Ag processing by macrophages is inhibited by prolonged exposure to PAMPs, e.g., MTB 19-kDa lipoprotein, CpG DNA, or LPS, or infection with MTB. In contrast to the inhibition of MHC-II expression by PAMPs, MHC-I expression was not inhibited, but PAMPs were found to decrease phagosome maturation and phagosome Ag degradation, with a resulting decrease in peptide regurgitation. Thus, microbial PAMPs provide a mechanism whereby MTB or other pathogens may decrease both MHC-I and MHC-II Ag processing and escape immune surveillance by both CD8+ and CD4+ T cells.
| Materials and Methods |
|---|
|
|
|---|
Unless specified, incubations were at 37°C and 5% CO2 in standard medium containing DMEM, 10% heat-inactivated FCS (HyClone Laboratories, Logan, UT), 50 µM 2-ME, 2 mM L-glutamine, 1 mM sodium pyruvate, 10 mM HEPES buffer, nonessential amino acids, and antibiotics. B6D2F1/J, C57BL/6, and CBA/J female mice were from The Jackson Laboratory (Bar Harbor, ME). TLR-2-/- mice (27) and myeloid differentiation factor 88 (MyD88)-/- mice (28) were generously provided by O. Takeuchi and S. Akira (Osaka University, Osaka, Japan) and bred onto a C57BL/6 background. Macrophages were derived from femur marrow cells cultured in bacterial grade dishes for 710 days in 20% LADMAC cell-conditioned medium (containing MCSF; Ref. 29). Peptide:MHC complexes were detected by T hybridomas CD8 OVA (24), specific for OVA257264:Kb, and DOBW (30), specific for OVA323339:I-Ab complexes.
Abs and reagents
Abs included biotin-28-8-6 (anti Kb/Db; BD PharMingen, San Diego, CA), CTKb (anti Kb; Caltag Laboratories, Burlingame, CA), biotin-34-5-3S (anti I-Ab/Ad; American Type Culture Collection, Manassas, VA), 1D4B (rat IgG2a anti-murine lysosome-associated membrane protein-1 (LAMP-1); Developmental Studies Hybridoma Bank, Johns Hopkins University, Baltimore, MD), and 34-1-2s (mouse IgG2a anti Kb/Kd; American Type Culture Collection). Controls were biotin-mouse-IgG2a (BD PharMingen), normal mouse serum (The Jackson Laboratory), mouse IgG2a (Caltag Laboratories), and rat IgG2a (Caltag Laboratories). Latex-OVA beads were made by noncovalent conjugation of OVA (Sigma A5503; Sigma-Aldrich, St. Louis, MO) to 2-µm latex beads (Polysciences, Warrington, PA) or covalent carbodiimide coupling to 2-µm carboxylated microparticles (Polysciences). Fluorescent beads (Polysciences) were used to make fluorescent latex-OVA. OVA antiserum was generated by immunization of C57BL/6 mice with OVA in CFA. LPS from Escherichia coli O127:B8 was from Difco (Detroit, MI). CpG oligodeoxynucleotide (ODN) 1826 (TCCATGACGTTCCTGACGTT) and non-CpG ODN 1982 (TCCAGGACTTCTCTCAGGTT) (both phosphorothioate modified to resist nuclease degradation) were provided by Coley Pharmaceutical Group (Wellesley, MA) and dissolved in 10 mM Tris, 1 mM EDTA. LPS content of ODN was <1 ng of LPS/mg DNA by Limulus amebocyte assay (QCL1000; BioWhittaker, Walkersville, MD). Maximum concentration of ODN in cultures was 1 µg/ml, resulting in maximum possible LPS contamination of <1 pg/ml.
Culture and biochemical fractionation of MTB
MTB lysate and MTB 19-kDa lipoprotein were isolated as described (6, 31) with modifications. MTB H37Ra (American Type Culture Collection) was grown to log phase in Middlebrook 7H9 medium with albumin, dextrose, and catalase enrichments (Difco), harvested, and frozen at -70°C (32). Bacterial titer was determined by CFU on 7H10 medium (Difco). To prepare lysate, MTB was suspended in deionized water containing 7.5 mM EDTA, 0.7 µg/ml leupeptin, 0.2 mM PMSF, 0.7 µg/ml pepstatin A, 10 U/ml DNase (Sigma-Aldrich), and 25 U/ml RNase A (Boehringer-Mannheim, Indianapolis, IN), passed through a French press two to three times, and centrifuged for 12 h at 100,000 x g to separate supernatant (lysate) and pellet (MTB cell wall). MTB 19-kDa lipoprotein was purified from MTB lysate or MTB cell wall. MTB lysate was rotated overnight at 4°C in 2% Triton X-114 in 50 mM Tris-HCl, 150 mM NaCl, pH 7.5. The MTB cell wall was rotated overnight in 17% Triton X-114 in the same buffer and centrifuged for 2 h at 100,000 x g to obtain the supernatant. Either resulting Triton X-114 solution was warmed to 37°C for 15 min and centrifuged at 37°C for 1015 min at 2,400 x g to separate aqueous and detergent layers. The Triton X-114 layer was combined with cold 50 mM Tris-Cl, 150 mM NaCl, incubated on ice until the phases merged, and then warmed and centrifuged as above. After three to five such aqueous washes, the detergent extract was precipitated by overnight incubation at -20°C with 10 volumes acetone and centrifuged at 2,400 x g, 4°C, for 2030 min. The pellet was washed with -20°C acetone, pelleted, air-dried at room temperature and solubilized in reducing SDS-PAGE sample buffer (62.5 mM Tris (pH 6.8), 2% SDS, 10% glycerol, 0.7 M 2-ME, and 0.01 µg/ml bromophenol blue), boiled for 10 min, loaded onto a 12% SDS polyacrylamide preparative gel, and electroeluted using a Model 491 Prep Cell (Bio-Rad, Cambridge, MA) as an 0.8-ml fraction in 25 mM Tris, 192 mM glycine, pH 8.3. Fractions were analyzed by silver stain (Bio-Rad Silverstain Plus Kit) and Western blot with IT-19 (mAb against MTB 19-kDa lipoprotein) and HRP-labeled secondary Ab (developed with Super signal West Pico chemiluminescence kit (Pierce, Rockford, IL)). Fractions with MTB 19-kDa lipoprotein and lacking other species were pooled, extracted with Triton X-114 as above, and resuspended in 5 mM HEPES buffer, pH 7.0, or 90% DMSO. Protein content was determined by detergent-compatible protein assay (Bio-Rad). MTB 19-kDa lipoprotein stock preparations (30100 mg/ml) had no detectable (<25 ng/ml) LPS contamination revealed by Limulus amebocyte lysate assay (E-Toxate kit; Sigma-Aldrich), indicating the maximum possible LPS level under experimental conditions of <0.25 ng/ml.
Ag processing and presentation assays
Macrophages were detached with trypsin-versene (BioWhittaker), plated in 96-well flat-bottom plates at 105 cells/well, and incubated for 24 h with 10 ng/ml rIFN-
(Genzyme, Cambridge, MA) plus 48 h with MTB or PAMPs in the continued presence of IFN-
. Cells were incubated with latex-OVA or OVA peptide for 2 h, fixed with 1% paraformaldehyde, washed, and incubated for 24 h with T hybridoma cells (105/well). Supernatants (100 µl) were frozen, thawed, and assessed for IL-2 using a colorimetric CTLL-2 bioassay (4, 33). CTLL-2 cells (5 x 103/well) were incubated with supernatants for 24 h at 37°C, Alamar blue (Accumed, Chicago, IL) was added (15 µl/well) for 24 h, and Alamar blue reduction was determined by difference in OD at 550 and 595 nm using a Bio-Rad model 550 microplate spectrophotometer. To assess conventional MHC-I processing, macrophages were suspended at 2 x 106/ml in 0.5 ml of DMEM in 4-mm-gap electroporation cuvettes (Life Technologies, Grand Island, NY) and electroporated at 4°C with a Cell-Porator (Life Technologies) at 200 V, 800 µF, and low resistance settings (26, 30, 34). Macrophages were washed, plated (105/well) for 2 h and fixed for T cell assays. To assess peptide regurgitation, CBA/J macrophages were treated with IFN-
and PAMPs, plated (105/well) onto previously fixed B6D2 macrophages (105/well), and incubated for 24 h with latex-OVA and CD8OVA1.3 cells.
Flow cytometry
Macrophages (4.5 x 105 cells/well in 24-well plates) were incubated with 10 ng/ml IFN-
for 24 h and then PAMPs plus IFN-
for 2472 h. Macrophages were detached with trypsin-EDTA and incubated in V-bottom plates (2 x 105 cells/well) at 4°C for 60 min with 10% normal mouse serum (The Jackson Laboratory) and 1% FCS (HyClone Laboratories) in PBS. Cells were stained with biotinylated specific Ab or murine IgG2a-biotin isotype control Ab at 5 µg/ml, incubated with streptavidin-CyChrome (2 µg/ml; BD PharMingen), fixed with 1% paraformaldehyde, and analyzed with a FACScan flow cytometer (BD Immunocytometry Systems, San Jose, CA). Specific mean fluorescence value (MFV) was obtained by subtracting MFV with isotype control Ab from MFV with specific Ab.
RNA purification, cDNA synthesis, and real-time quantitative PCR
Cells were lysed with a QiaShredder (Qiagen, Valencia, CA). RNA was purified using an RNeasy kit (Qiagen) and depleted of residual genomic DNA with RNase-free DNase (Qiagen). RNA (1 µg) was converted to cDNA using the SuperScript preamplification system (Life Technologies) for first-strand cDNA synthesis, and 10% of the product was used per reaction for real-time quantitative PCR using a high-speed thermal cycler (LightCycler; Roche Diagnostics, Indianapolis, IN). PCR product was detected with FastStart Master SYBR Green I (Roche Diagnostics). Amplification cycle was 95°C for 15 s, 50°C for 5 s (57°C for GAPDH primers), and 72°C for 10 s. Sequences for primers were as follows: GAPDH: sense 5'-3' AACGACCCCTTCATTGAC and antisense 5'-3' TCCACGACATACTCAGCAC (predicted size = 191 bp) (35). MHC-I (H-2Kb): sense 5'-3' TACCAGCAGTACGCCTACGAC and antisense 5'-3'GCGTTCCCGTTCTTCAGGTAT (predicted size = 194 bp) (designed using OLIGO version 6.4; Molecular Biology Insights, Cascade, CO). ODNs were purchased from Life Technologies. Specific cDNA was quantified relative to amplified cDNA product from an agarose gel using a QiaQuick gel extraction kit (Qiagen). Melting curve analysis confirmed that only one product was amplified. Electrophoresis of products through 1.5% agarose and ethidium bromide staining confirmed that each primer set produced only a single species of predicted size.
Analysis of isolated phagosomes by flow organellometry
Macrophages were plated in 6-well plates (2.5 x 107 cells/well) and incubated with IFN-
for 24 h and then with IFN-
plus PAMPs for 48 h. Covalently conjugated OVA was added for a 5-min pulse plus various chase incubations. Cells were detached by scraping, resuspended in homogenization buffer (0.25 M sucrose and 10 mM HEPES pH 7.2, 1 mM PMSF, 2 µg/ml pepstatin A, and 2 µg/ml leupeptin) and homogenized in a Dounce homogenizer (Kontes, Vineland, NJ) to obtain 8085% lysis (36, 37). Intact cells and nuclei were removed by centrifugation (900 x g, 5 min). Crude phagosomes were pelleted by centrifugation at 3000 x g for 10 min, fixed with paraformaldehyde, washed, resuspended in PBS to 107 phagosomes/ml and immunolabeled in the presence of saponin (36, 37).
| Results |
|---|
|
|
|---|
To determine the effects of MTB on Ag processing, IFN-
-activated macrophages were infected by incubation with MTB H37Ra for 2 h, washed, and incubated for 48 h. To assess Ag processing activity, macrophages were incubated with latex-OVA Ag for 2 h, fixed, and incubated with CD8OVA1.3 cells to detect OVA257264:Kb complexes or DOBW cells to detect OVA323339:I-Ab complexes. Alternate MHC-I Ag processing of latex-OVA for presentation to CD8OVA T cells was inhibited by infection of macrophages with MTB H37Ra at a multiplicity of infection (MOI) of 3:1 or greater (Fig. 1A). However, MHC-I presentation of exogenous OVA257264 peptide to CD8OVA1.3 was not inhibited, suggesting that expression of peptide-receptive MHC-I was not reduced (Fig. 1B). MHC-II Ag processing of latex-OVA was inhibited by MTB H37Ra at a MOI of 3:1 or greater (Fig. 1C), as predicted by previous studies (6, 9). In addition, MHC-II presentation of OVA323339 peptide was also inhibited by MTB H37Ra (Fig. 1D). Thus, MTB H37Ra inhibited both MHC-II and alternate MHC-I Ag processing, but the availability of peptide-receptive molecules that could bind and present exogenous peptide was decreased only for MHC-II.
|
Previous studies indicated that MHC-II Ag processing by macrophages is inhibited by MTB 19-kDa lipoprotein and other PAMPs (e.g., CpG DNA and LPS) (6). MTB 19-kDa lipoprotein was the primary inhibitory PAMP isolated from MTB (6) and its ability to inhibit MHC-II Ag processing was dependent on signaling via TLR-2. CpG DNA (which signals via TLR-9) is also present in MTB and other bacteria. LPS (which signals via TLR-4) is not present in MTB but is present in other bacteria, and other MTB PAMPs may signal via TLR-4 (38).
To determine the ability of MTB 19-kDa lipoprotein and other PAMPs to inhibit alternate MHC-I Ag processing, IFN-
-activated macrophages were incubated with PAMPs for 24 (data not shown) or 48 h (Fig. 2), and processing of latex-OVA was assessed as described above. Like infection with MTB, exposure to MTB 19-kDa lipoprotein, CpG ODN 1826, or LPS inhibited alternate MHC-I Ag processing of latex-OVA (Fig. 2A), MHC-II Ag processing of latex-OVA (Fig. 2C), and MHC-II presentation of the OVA323339 peptide (Fig. 2D). MHC-I presentation of OVA257264 peptide was not inhibited (or was even slightly enhanced) (Fig. 2B). Results were similar when macrophages were incubated with PAMPs for 24 or 48 h (data not shown), but substantial inhibition of alternate MHC-I or MHC-II Ag processing occurred only after a delay of 16 h from the addition of MTB 19-kDa lipoprotein (Fig. 3, B and C). Taken together, these data indicate that alternate MHC-I processing is inhibited by MTB, MTB 19-kDa lipoprotein, and other PAMPs despite continued expression of cell surface peptide-receptive MHC-I molecules.
|
|
B-dependent gene transcription and cytokine secretion (39, 40). MTB 19-kDa lipoprotein requires TLR-2 to inhibit MHC-II Ag processing and MHC-II expression (6). To investigate whether TLR-2 and MyD88 are required for MTB 19-kDa lipoprotein to inhibit alternate MHC-I Ag processing, macrophages were prepared from TLR-2-/- mice, MyD88-/- mice, and wild-type C57BL/6 mice. IFN-
-activated macrophages were incubated with PAMPs for 48 h, and processing of latex-OVA was assessed as described above. TLR-2 was required for inhibition of alternate MHC-I Ag processing by MTB 19-kDa lipoprotein (Fig. 3A) but not by CpG ODN 1826 or LPS (data not shown). Other mycobacterial PAMPs besides MTB 19-kDa lipoprotein are also able to inhibit Ag processing, because alternate MHC-I and MHC-II Ag processing of latex-OVA was inhibited by both Mycobacterium bovis bacillus Calmette-Guérin (BCG) and a 19-kDa lipoprotein knockout BCG strain (41) (data not shown), and inhibition by MTB occurred even in TLR-2 knockout macrophages (data not shown). However, MyD88 was required for CpG ODN, LPS, 19-kDa lipoprotein, or MTB to establish inhibition (Fig. 3A and data not shown), suggesting that the inhibitory effects of all of the PAMPs were dependent on TLRs that signal through MyD88. MTB, MTB 19-kDa lipoprotein, CpG DNA, and LPS do not inhibit conventional MHC-I MHC Ag processing
Additional experiments examined the effect of MTB 19-kDa lipoprotein and other PAMPs on conventional MHC-I processing of cytosolic Ag. B6D2 macrophages were activated with IFN-
and then incubated for 48 h with or without MTB 19-kDa lipoprotein (30 nM, Fig. 4A), control fraction (electroelution fractions from the 19-kDa purification procedure that did not contain MTB 19-kDa lipoprotein, Fig. 4A), MTB lysate (30 µg/ml, Fig. 4B), LPS (100 ng/ml, Fig. 4C), non-CpG 1982 ODN (1 µg/ml, Fig. 4D), or CpG ODN 1826 (1 µg/ml, Fig. 4D). To deliver Ag to the appropriate subcellular compartment for conventional MHC-I Ag processing, OVA protein was introduced into the cytosol of macrophages by electroporation (30). Conventional MHC-I processing was not altered by MTB lysate, MTB 19-kDa lipoprotein, or any other PAMP. Thus, MTB and PAMPs inhibit the alternate MHC-I Ag processing pathway but do not affect the conventional MHC-I Ag processing pathway.
|
Flow cytometry was used to assess cell surface expression of MHC-I and MHC-II after exposure to MTB 19-kDa lipoprotein and other PAMPs. B6D2 macrophages were incubated for 24 h with IFN-
and then for 48 h with PAMPs in the continued presence of IFN-
. Cell surface expression of MHC-II (I-Ab) was reduced to 42% of the control level by MTB lysate (Fig. 5A), to 26% of control by MTB 19-kDa lipoprotein (Fig. 5C), to 24% of control by LPS (Fig. 5E), and to 75% of control with CpG ODN (Fig. 5G). Dose-response experiments indicated that I-Ab expression was strongly inhibited with 30 nM MTB 19-kDa lipoprotein (Fig. 6A). Inhibition was observed with as little as 3 nM MTB 19-kDa lipoprotein (Fig. 6A). Kinetic studies showed that I-Ab levels were inhibited at 2472 h after the addition of MTB 19-kDa lipoprotein (data not shown). Thus, MTB 19-kDa lipoprotein and other PAMPs inhibited expression of MHC-II by macrophages, as demonstrated in earlier studies (5, 6, 9).
|
|
In addition to studies of cell surface expression of Kb, real-time quantitative PCR was used to assess Kb mRNA expression after incubation with or without PAMPs. Macrophages were treated for 24 h with IFN-
and for an additional 48 h with IFN-
plus PAMPs. The cells were then lysed, and RNA was purified for quantitative RT-PCR. MTB 19-kDa lipoprotein, LPS, and CpG ODN all produced no significant change in Kb mRNA expression (Fig. 6B). Thus, inhibition of alternate MHC-I Ag processing cannot be explained by decreased MHC-I synthesis or expression.
MTB 19-Da lipoprotein and other PAMPs do not inhibit phagocytosis or targeting of MHC-I to phagosomes
Because PAMPs did not inhibit synthesis or expression of MHC-I molecules, we investigated whether alteration in phagocytosis or phagosome composition could explain the inhibition of alternate MHC-I Ag processing. To assess whether MTB 19-kDa and other PAMPs inhibit phagocytosis, B6D2 macrophages were treated with IFN-
and PAMPs as in previous experiments and then were incubated with fluorescent latex-OVA (OVA conjugated to fluorescent beads). Analysis of cells by flow cytometry revealed the number of fluorescent beads internalized by phagocytosis under different conditions. Treatment with PAMPs did not change the number of beads phagocytosed per cell over 2 h (Fig. 7A). With phagocytosis periods of <30 min, the phagocytic rate was actually observed to increase with exposure to MTB 19-kDa lipoprotein (data not shown). Thus inhibition of alternate MHC-I Ag processing was not attributable to inhibition of phagocytosis.
|
and PAMPs as above, exposed to latex-OVA, homogenized, and used to produce phagosomes for flow organellometry (36, 37). Phagosomes were stained with Abs to MHC-I in the presence of saponin (to reveal lumenal epitopes). MTB 19-kDa lipoprotein and other PAMPs produced no consistent change in expression of MHC-I in phagosomes (Fig. 7B). Thus, inhibition of processing is not due to decreased availability of MHC-I, suggesting the possibility of changes in handling of Ag molecules and the production of antigenic peptides that bind MHC-I. Exposure of macrophages to MTB 19-kDa lipoprotein and other PAMPs results in decreased regurgitation of antigenic peptides
In the course of vacuolar alternate MHC-I Ag processing, some peptide:MHC-I complexes can be formed on the cell surface by binding of recycled or regurgitated peptides to cell surface peptide-receptive MHC-I molecules. However, it is still unclear whether the majority of complexes are formed by this mechanism or by binding of peptides to intracellular MHC-I molecules (e.g., in phagosomes). We investigated the potential impact of MTB and PAMPs on peptide regurgitation. B6D2 macrophages (H-2bxd) were plated, fixed with paraformaldehyde, and thereby rendered incapable of Ag processing but still capable of presenting exogenous peptide or peptide regurgitated by other cells. These fixed cells were incubated for 24 h with live CBA/J cells (H-2k, previously treated with IFN-
and PAMPs as above), latex-OVA and CD8OVA1.3 T hybridoma cells. Because CD8OVA1.3 cells only recognize OVA257264 when presented by Kb, which is not expressed by CBA/J macrophages, peptide recognition could only result when peptide was regurgitated from live CBA/J cells and bound to Kb on fixed B6D2 cells. Peptide regurgitation was detected (Fig. 8), although "trans" presentation by regurgitation onto fixed cells by viable cells was much less efficient than direct "cis" presentation, as reported previously (25). Macrophages that were treated with PAMPs had significantly reduced peptide regurgitation (Fig. 8), indicating that a step required for Ag proteolysis or peptide recycling is inhibited by MTB 19-kDa lipoprotein and other PAMPs. Thus, to the extent that peptide regurgitation contributes, this inhibitory mechanism may decrease alternate MHC-I Ag processing. More important, because regurgitation may be insignificant for physiological production of peptide:MHC-I complexes, these results suggested the possibility that phagosome Ag catabolism was inhibited, potentially decreasing formation of peptide:MHC-I complexes within phagosomes.
|
We investigated whether inhibition of alternate MHC-I Ag processing by MTB and PAMPs was due to decreased phagosome Ag catabolism, which could result from inhibition of phagosome maturation. Phagosomes undergo a process of maturation, which involves fusion with lysosomes and acquisition of lysosomal markers and proteases. MTB is known to inhibit phagosome maturation (42, 43, 44, 45, 46, 47, 48), but the mechanism for this inhibition is unknown. To assess modulation of phagosome maturation and Ag catabolism, macrophages were incubated with IFN-
and MTB 19-kDa lipoprotein, exposed to latex-OVA, and homogenized; phagosomes were prepared and analyzed by flow organellometry (36, 37). Phagosomes were stained with Abs to LAMP-1 (a lysosomal marker that can be used as a measure of phagosome maturation) in the presence of saponin (to reveal lumenal epitopes). LAMP-1 expression in phagosomes increased with time after phagocytosis (Fig. 9A), consistent with phagosome maturation. However, treatment of macrophages with MTB 19-kDa lipoprotein inhibited acquisition of LAMP-1 by phagosomes. The decrease in LAMP-1 acquisition was due primarily to a decrease in the proportion of phagosomes that acquired significant labeling for LAMP-1 (some phagosomes continued to acquire LAMP-1 even after treatment with MTB 19-kDa lipoprotein). In control cells, 89.1% of phagosomes acquired LAMP-1 by 35 min with an overall specific MFV of 217, but in cells treated with MTB 19-kDa lipoprotein, only 69.3% of phagosomes acquired LAMP-1 with an overall specific MFV of 156 at this time point. Although LAMP-1 was eventually acquired by most phagosomes, this process was delayed by 2030 min (Fig. 9A). Similar inhibition of phagosome maturation was seen with CpG ODN 1826 and LPS (data not shown). Furthermore, inhibition of phagosome maturation by MTB 19-kDa lipoprotein was abrogated in macrophages from TLR-2-/- mice (Fig. 9B). However, MTB contains other PAMPs that allowed it to inhibit phagosome maturation in TLR-2-/- macrophages (Fig. 9B). We conclude that MTB 19-kDa lipoprotein and other PAMPs can kinetically inhibit phagosome maturation via TLR-2, diminishing the degree of phagosome maturation at early time points and delaying the time needed for full maturation of phagosomes. Because phagosome maturation is necessary for full acquisition of the proteases used for Ag proteolysis, this observation suggests that PAMPs inhibit alternate MHC-I Ag processing by inhibiting Ag handling or proteolysis.
|
| Discussion |
|---|
|
|
|---|
As measured by flow cytometry and by the ability to present exogenous antigenic peptide, cell surface expression of MHC-I was maintained at normal levels after exposure to MTB, MTB lysate, purified MTB 19-kDa lipoprotein, and other PAMPs (CpG ODN and LPS) for up to 72 h. The steady state level of MHC-I mRNA in macrophages was also unaffected by such treatments. Lack of PAMP-mediated inhibition of MHC-I synthesis and expression is consistent with the finding that conventional MHC-I processing of protein Ag was unaffected by MTB 19-kDa lipoprotein or other PAMPs. In contrast, treatment with PAMPs inhibited MHC-II synthesis and expression, as well as the ability of macrophages to present exogenous peptides or process Ag for presentation to MHC-II-restricted T hybridoma cells. Despite the fact that PAMPs did not inhibit MHC-I expression, they did dramatically inhibit processing of latex-OVA for presentation by MHC-I. Thus, MTB-associated PAMPs and other PAMPs inhibit both MHC-II and alternate MHC-I Ag processing, but by different mechanisms.
Models of alternate MHC-I processing of exogenous particulate Ag include processing entirely within vacuolar compartments or initial processing in vacuolar compartments followed by escape of Ag or Ag fragments into the cytosol to merge with the conventional MHC-I processing pathway. Studies of alternate MHC-I processing of exogenous particulate Ag in macrophages point to vacuolar processing as a major mechanism (24, 26, 50). Two recent studies showed such vacuolar processing of MTB itself (22, 23). In vacuolar Ag processing, Ag is phagocytosed and degraded within phagosomes to produce antigenic peptides that may bind MHC-I inside phagosomes or on the cell surface (following peptide recycling and regurgitation) (24). Although peptide regurgitation was detected in these and other studies, the proportion of peptide:MHC-I complexes that is actually generated by this mechanism remains unclear, and intracellular formation of peptide:MHC-I complexes may predominate.
There are multiple potential mechanisms that could explain inhibition of vacuolar alternate MHC-I Ag processing by MTB 19-kDa lipoprotein and other PAMPs: decreased MHC-I synthesis/expression, decreased trafficking of MHC-I to the site of peptide binding (e.g., phagosomes), decreased Ag uptake, decreased Ag catabolism (perhaps related to decreased phagosome maturation), and decreased Ag regurgitation for binding to cell surface MHC-I. Several of these possible mechanisms are excluded by our observations. Phagocytic uptake of Ag, MHC-I surface expression, MHC-I synthesis as examined by mRNA expression, and MHC-I levels inside phagosomes were all unchanged or were even slightly enhanced by MTB 19-kDa lipoprotein. However, phagosome maturation (assessed by acquisition of LAMP-1) and Ag catabolism were inhibited. Diminished Ag catabolism likely results from decreased phagosome maturation and decreased delivery of lysosomal proteases. Peptide regurgitation was also inhibited, presumably consequent to decreased phagosome Ag catabolism. The extent to which peptide regurgitation contributes to alternate MHC-I Ag processing is not clear, but this finding provides additional evidence for decreased catabolic processing of Ag in phagosomes. In summary, we propose that inhibition of alternate MHC-I Ag processing by MTB and PAMPs stems from decreased phagosome Ag catabolism due to inhibition of phagosome maturation and decreased delivery of lysosomal proteases to phagosomes. This inhibition may result from inhibition of IFN-
signaling, as observed in other studies with MTB (51, 58), especially since PAMP-induced inhibition appears to affect the IFN-
-induced enhancement of alternate MHC-I Ag processing as opposed to the lesser IFN-
-independent baseline processing activity (A. A. R. Tobian, unpublished observations). Furthermore, inhibition of IFN-
signaling may allow MTB to inhibit phagosome maturation even when macrophages are exposed to IFN-
, which normally mitigates inhibition of phagosome maturation.
In our previous studies, MTB 19-kDa lipoprotein was identified as a major PAMP expressed by MTB (and BCG) in terms of activity for inhibition of MHC-II Ag processing. Nonetheless, mycobacterial PAMPs other than 19-kDa lipoprotein can inhibit MHC-II Ag processing, because 19-kDa-lipoprotein knockout BCG inhibited both alternate MHC-I and MHC-II Ag processing (data not shown). Moreover, MTB PAMPs can signal through TLR-2 and other TLRs (Figs. 3 and 9, and data not shown). Thus, a variety of PAMPs and TLRs can contribute to inhibition of Ag processing. Because TLRs can localize to phagosomes and lysosomes (52, 53, 54), the presence of PAMPs in phagosomes containing MTB or other bacteria would allow chronic stimulation of TLRs to induce the inhibition.
We observed that PAMPs inhibited phagosomal Ag processing after a delay of 16 h of exposure, yet phagosome maturation was inhibited from 5125 min after initiation of phagocytosis. The difference in timing of these events suggests that the initial contact of a macrophage with a bacterium is unlikely to inhibit phagosomal processing of that bacterium. (This timing issue may explain why inhibition was not seen in the studies of Mazzaccaro et al. (55), whose studies differed in the use of soluble instead of particulate Ag and the activation state of the macrophages as well as timing of addition of MTB vs Ag). Nonetheless, it is possible that earlier exposure to bacterial PAMPs inhibits subsequent ability to process phagocytosed bacteria. This could occur at a site of infection where macrophages encounter more than one bacterium; phagocytosis of one bacterium could initiate inhibitory mechanisms to decrease processing of a second bacterium. Another scenario involves prior exposure of macrophages to bacterial PAMPs released from extracellular bacteria or shed from other infected cells, establishing inhibition before bacterial phagocytosis. MTB 19-kDa lipoprotein is shed from MTB in culture, and we have observed that MTB PAMPs are shed from MTB-infected cells and can inhibit neighboring uninfected macrophages (R. K. Pai, unpublished observations). In chronic tuberculosis, PAMPs shed from infected macrophages may establish inhibition in adjacent uninfected macrophages that may subsequently become infected. Thus, inhibition of phagosome maturation could promote persistence of MTB in chronic tuberculosis, but further investigation is necessary to test the application of these models to in vivo infections.
Our model does not predict overall inhibition of immune responses to pathogens such as MTB. Continuing recruitment of new, uninfected, and uninhibited monocytes/macrophages to the site of infection and the contributions of other APCs (e.g., dendritic cells and B cells) that respond differently to PAMPs will continue to induce T cell responses. Thus, strong T cell responses will still be mounted against MTB (as observed in infected individuals), and these may activate microbicidal effector mechanisms to help contain infection. In addition, the acute effects of PAMPs may include induction of direct microbicidal mechanisms (56). We have also observed that MTB 19-kDa lipoprotein enhances macrophage phagocytosis within 2 h (A. A. R. Tobian, unpublished observations). However, chronic exposure to PAMPs inhibits alternate MHC-I and MHC-I Ag processing. Thus, although many APC may not be inhibited, the niches provided by chronically infected macrophages will allow some MTB bacilli to evade immune responses and persist in the host.
One puzzle is why these inhibitory mechanisms exist at all. Were the mechanism unique to MTB, it might represent an MTB-specific derangement of immune function, evolved by MTB to modulate host responses to its benefit. However, the same response is also seen in response to PAMPs from other organisms and seems to reflect a phase of the general pattern of response to PAMPs evolved by the host. The mechanisms whereby PAMPs inhibit macrophage Ag processing and presentation may be host-beneficial in some pathophysiologic situations. We propose that PAMPs activate immune responses at early time points but produce counterregulatory (or inhibitory) responses at late time points. The latter may benefit the host during infection by some bacteria (e.g., extracellular pathogens) by limiting excessive inflammation and deleterious overamplification of immune responses.
CD8+ T cell function has been shown to contribute to anti-MTB immune responses by cytokine secretion and lysis of infected cells. Inhibition of these functions may be particularly important in the setting of chronic infection with MTB (57) or possibly other intracellular pathogens. Inhibition of both alternate MHC-I and MHC-II processing provides a mechanism whereby such intracellular pathogens may persist in host macrophages, chronically inhibiting APC function and evading immune responses.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 A.A.R.T. and N.S.P. contributed equally to this work. ![]()
3 C.V.H. and W.H.B. shared senior authorship. ![]()
4 Address correspondence and reprint requests to Dr. Clifford V. Harding, Department of Pathology, BRB 925, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106-4943. E-mail address: cvh3{at}po.cwru.edu ![]()
5 Abbreviations used in this paper: PAMP, pathogen-associated molecular pattern; TLR, Toll-like receptor; MTB, Mycobacterium tuberculosis; MHC-I, class I MHC; MHC-II, class II MHC; MyD88, myeloid differentiation factor 88; LAMP-1, lysosome-associated membrane protein-1; ODN, oligodeoxynucleotide; MFV, mean fluorescence value; MOI, multiplicity of infection; BCG, bacillus Calmette-Guérin. ![]()
Received for publication November 22, 2002. Accepted for publication May 13, 2003.
| References |
|---|
|
|
|---|
interferon-secreting CD8+, as well as CD4+, T cells in lungs following aerosol infection with Mycobacterium tuberculosis. Infect. Immun. 67:3242.
2-microglobulin-dependent resistance to Mycobacterium tuberculosis. Eur. J. Immunol. 31:1944.[Medline]

TCR+ cells by Mycobacterium tuberculosis via an alternate class I MHC antigen-processing pathway. J. Immunol. 162:372.
2-microglobulin in the processing of bacterial or particulate antigens via an alternate class I MHC processing pathway. J. Immunol. 156:4182.[Abstract]
transcriptional responses without inhibiting activation of STAT1. J. Immunol. 163:3898.