The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tobian, A. A. R.
Right arrow Articles by Harding, C. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tobian, A. A. R.
Right arrow Articles by Harding, C. V.
The Journal of Immunology, 2003, 171: 1413-1422.
Copyright © 2003 by The American Association of Immunologists

Alternate Class I MHC Antigen Processing Is Inhibited by Toll-Like Receptor Signaling Pathogen-Associated Molecular Patterns: Mycobacterium tuberculosis 19-kDa Lipoprotein, CpG DNA, and Lipopolysaccharide1

Aaron A. R. Tobian2,*, Nicholas S. Potter2,*, Lakshmi Ramachandra*, Rish K. Pai*, Marilyn Convery*, W. Henry Boom3,{dagger} and Clifford V. Harding3,4,*

* Department of Pathology and {dagger} Division of Infectious Disease, Case Western Reserve University, Cleveland, OH 44106


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pathogen-associated molecular patterns (PAMPs) signal through Toll-like receptors (TLRs) to activate immune responses, but prolonged exposure to PAMPs from Mycobacterium tuberculosis (MTB) and other pathogens inhibits class II MHC (MHC-II) expression and Ag processing, which may allow MTB to evade CD4+ T cell immunity. Alternate class I MHC (MHC-I) processing allows macrophages to present Ags from MTB and other bacteria to CD8+ T cells, but the effect of PAMPs on this processing pathway is unknown. In our studies, MTB and TLR-signaling PAMPs, MTB 19-kDa lipoprotein, CpG DNA, and LPS, inhibited alternate MHC-I processing of latex-conjugated Ag by IFN-{gamma}-activated macrophages. Inhibition was dependent on TLR-2 for MTB 19-kDa lipoprotein (but not whole MTB or the other PAMPs); inhibition was dependent on myeloid differentiation factor 88 for MTB and all of the individual PAMPs. Inhibition of MHC-II and alternate MHC-I processing was delayed, appearing after 16 h of PAMP exposure, as would occur in chronically infected macrophages. Despite inhibition of alternate MHC-I Ag processing, there was no inhibition of MHC-I expression, MHC-I-restricted presentation of exogenous peptide or conventional MHC-I processing of cytosolic Ag. MTB 19-kDa lipoprotein and other PAMPs inhibited phagosome maturation and phagosome Ag degradation in a myeloid differentiation factor 88-dependent manner; this may limit availability of peptides to bind MHC-I. By inhibiting both MHC-II and alternate MHC-I Ag processing, pathogens that establish prolonged infection of macrophages (>16 h), e.g., MTB, may immunologically silence macrophages and evade surveillance by both CD4+ and CD8+ T cells, promoting chronic infection.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Pathogen-associated molecular patterns (PAMPs)5 are conserved molecular patterns from microbes, many of which signal through Toll-like receptors (TLRs). PAMPs include CpG DNA (which signals via TLR-9), LPS (which signals via TLR-4), and Mycobacterium tuberculosis (MTB) 19-kDa lipoprotein (which signals via TLR-2). TLRs signal through the NF-{kappa}B pathway to activate innate and acquired immunity (1, 2). TLR signaling can enhance APC function, e.g., by induction of dendritic cell maturation (3, 4). However, prolonged exposure to PAMPs can inhibit macrophage APC function (5, 6).

CD4+ T cells play an important role in controlling infections with pathogens such as MTB (7, 8). Presentation of microbe-derived peptides on MHC class II (MHC-II) molecules is required to generate CD4+ T cell responses. Some pathogens, e.g., MTB, can inhibit MHC-II-restricted Ag presentation to evade recognition by CD4+ T cells. Impaired Ag processing by MTB-infected macrophages has been demonstrated to result from reduced MHC-II synthesis (9) or transport (10). MTB 19-kDa lipoprotein was identified as a major inhibitor of macrophage MHC-II expression and Ag processing (6).

Although CD4+ T cells are the dominant T cell subset in MTB immunity, CD8+ T cells also contribute. MTB-specific CD8+ T cells have been isolated from infected humans and mice (11, 12, 13, 14, 15, 16, 17, 18). Susceptibility to MTB is increased in mice with deficits in CD8+ T cell function or class I MHC (MHC-I) Ag presentation, e.g. mice genetically deficient in {beta}2-microglobulin, transporter for Ag processing (TAP), or MHC class Ia molecules (7, 19, 20, 21). Mice with {beta}2-microglobulin deficiency are more susceptible to MTB than mice that are deficient in MHC class Ia molecules, perhaps due to derangement of systems other than MHC-I that depend on {beta}2-microglobulin (19), but MHC-I still appears to contribute to CD8+ T cell responses to MTB (7, 19, 20, 21). CD8+ T cells may contribute to MTB immune responses either by lysis of infected cells or by secretion of IFN-{gamma} (13, 17, 22).

Mechanisms whereby MTB and other pathogens are processed for presentation by MHC-I molecules remain poorly understood. One possibility is that bacterial Ags cross vacuolar membranes to reach the macrophage cytosol, thereby achieving access to proteasome-dependent processing and TAP-dependent entry into the endoplasmic reticulum to bind MHC-I molecules. This pathway has been demonstrated in some systems and may contribute to cross-priming of CD8+ T cells by dendritic cells (e.g., via processing of apoptotic cells). However, other MHC-I processing mechanisms may occur, especially in macrophages, which are infected by some pathogens, e.g., MTB, and present MTB Ags to effector CD8+ T cells (22, 23). In macrophages, alternate MHC-I Ag processing of MTB (22, 23) and other bacteria (24) proceeds in the presence of inhibitors of cytosolic conventional MHC-I processing, indicating that vacuolar alternate MHC-I processing mechanisms contribute. Vacuolar alternate MHC-I processing involves phagosomal degradation of Ag and binding of peptides to MHC-I in phagosomes (or possibly also on the cell surface after peptide recycling and release, i.e., "regurgitation") (24, 25, 26).

Although cellular immune responses help contain infection and prevent overt disease in most cases, viable MTB persists in macrophages for long periods, evading immune mechanisms. Although earlier studies revealed mechanisms for evasion of CD4+ T cell responses by MTB (by inhibiting MHC-II expression and Ag processing) (6), little is known about potential mechanisms by which MTB or other pathogens that infect macrophages may evade CD8+ T cell responses. This study reveals that alternate MHC-I Ag processing by macrophages is inhibited by prolonged exposure to PAMPs, e.g., MTB 19-kDa lipoprotein, CpG DNA, or LPS, or infection with MTB. In contrast to the inhibition of MHC-II expression by PAMPs, MHC-I expression was not inhibited, but PAMPs were found to decrease phagosome maturation and phagosome Ag degradation, with a resulting decrease in peptide regurgitation. Thus, microbial PAMPs provide a mechanism whereby MTB or other pathogens may decrease both MHC-I and MHC-II Ag processing and escape immune surveillance by both CD8+ and CD4+ T cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cells and media

Unless specified, incubations were at 37°C and 5% CO2 in standard medium containing DMEM, 10% heat-inactivated FCS (HyClone Laboratories, Logan, UT), 50 µM 2-ME, 2 mM L-glutamine, 1 mM sodium pyruvate, 10 mM HEPES buffer, nonessential amino acids, and antibiotics. B6D2F1/J, C57BL/6, and CBA/J female mice were from The Jackson Laboratory (Bar Harbor, ME). TLR-2-/- mice (27) and myeloid differentiation factor 88 (MyD88)-/- mice (28) were generously provided by O. Takeuchi and S. Akira (Osaka University, Osaka, Japan) and bred onto a C57BL/6 background. Macrophages were derived from femur marrow cells cultured in bacterial grade dishes for 7–10 days in 20% LADMAC cell-conditioned medium (containing MCSF; Ref. 29). Peptide:MHC complexes were detected by T hybridomas CD8 OVA (24), specific for OVA257–264:Kb, and DOBW (30), specific for OVA323–339:I-Ab complexes.

Abs and reagents

Abs included biotin-28-8-6 (anti Kb/Db; BD PharMingen, San Diego, CA), CTKb (anti Kb; Caltag Laboratories, Burlingame, CA), biotin-34-5-3S (anti I-Ab/Ad; American Type Culture Collection, Manassas, VA), 1D4B (rat IgG2a anti-murine lysosome-associated membrane protein-1 (LAMP-1); Developmental Studies Hybridoma Bank, Johns Hopkins University, Baltimore, MD), and 34-1-2s (mouse IgG2a anti Kb/Kd; American Type Culture Collection). Controls were biotin-mouse-IgG2a (BD PharMingen), normal mouse serum (The Jackson Laboratory), mouse IgG2a (Caltag Laboratories), and rat IgG2a (Caltag Laboratories). Latex-OVA beads were made by noncovalent conjugation of OVA (Sigma A5503; Sigma-Aldrich, St. Louis, MO) to 2-µm latex beads (Polysciences, Warrington, PA) or covalent carbodiimide coupling to 2-µm carboxylated microparticles (Polysciences). Fluorescent beads (Polysciences) were used to make fluorescent latex-OVA. OVA antiserum was generated by immunization of C57BL/6 mice with OVA in CFA. LPS from Escherichia coli O127:B8 was from Difco (Detroit, MI). CpG oligodeoxynucleotide (ODN) 1826 (TCCATGACGTTCCTGACGTT) and non-CpG ODN 1982 (TCCAGGACTTCTCTCAGGTT) (both phosphorothioate modified to resist nuclease degradation) were provided by Coley Pharmaceutical Group (Wellesley, MA) and dissolved in 10 mM Tris, 1 mM EDTA. LPS content of ODN was <1 ng of LPS/mg DNA by Limulus amebocyte assay (QCL1000; BioWhittaker, Walkersville, MD). Maximum concentration of ODN in cultures was 1 µg/ml, resulting in maximum possible LPS contamination of <1 pg/ml.

Culture and biochemical fractionation of MTB

MTB lysate and MTB 19-kDa lipoprotein were isolated as described (6, 31) with modifications. MTB H37Ra (American Type Culture Collection) was grown to log phase in Middlebrook 7H9 medium with albumin, dextrose, and catalase enrichments (Difco), harvested, and frozen at -70°C (32). Bacterial titer was determined by CFU on 7H10 medium (Difco). To prepare lysate, MTB was suspended in deionized water containing 7.5 mM EDTA, 0.7 µg/ml leupeptin, 0.2 mM PMSF, 0.7 µg/ml pepstatin A, 10 U/ml DNase (Sigma-Aldrich), and 25 U/ml RNase A (Boehringer-Mannheim, Indianapolis, IN), passed through a French press two to three times, and centrifuged for 1–2 h at 100,000 x g to separate supernatant (lysate) and pellet (MTB cell wall). MTB 19-kDa lipoprotein was purified from MTB lysate or MTB cell wall. MTB lysate was rotated overnight at 4°C in 2% Triton X-114 in 50 mM Tris-HCl, 150 mM NaCl, pH 7.5. The MTB cell wall was rotated overnight in 17% Triton X-114 in the same buffer and centrifuged for 2 h at 100,000 x g to obtain the supernatant. Either resulting Triton X-114 solution was warmed to 37°C for 15 min and centrifuged at 37°C for 10–15 min at 2,400 x g to separate aqueous and detergent layers. The Triton X-114 layer was combined with cold 50 mM Tris-Cl, 150 mM NaCl, incubated on ice until the phases merged, and then warmed and centrifuged as above. After three to five such aqueous washes, the detergent extract was precipitated by overnight incubation at -20°C with 10 volumes acetone and centrifuged at 2,400 x g, 4°C, for 20–30 min. The pellet was washed with -20°C acetone, pelleted, air-dried at room temperature and solubilized in reducing SDS-PAGE sample buffer (62.5 mM Tris (pH 6.8), 2% SDS, 10% glycerol, 0.7 M 2-ME, and 0.01 µg/ml bromophenol blue), boiled for 10 min, loaded onto a 12% SDS polyacrylamide preparative gel, and electroeluted using a Model 491 Prep Cell (Bio-Rad, Cambridge, MA) as an 0.8-ml fraction in 25 mM Tris, 192 mM glycine, pH 8.3. Fractions were analyzed by silver stain (Bio-Rad Silverstain Plus Kit) and Western blot with IT-19 (mAb against MTB 19-kDa lipoprotein) and HRP-labeled secondary Ab (developed with Super signal West Pico chemiluminescence kit (Pierce, Rockford, IL)). Fractions with MTB 19-kDa lipoprotein and lacking other species were pooled, extracted with Triton X-114 as above, and resuspended in 5 mM HEPES buffer, pH 7.0, or 90% DMSO. Protein content was determined by detergent-compatible protein assay (Bio-Rad). MTB 19-kDa lipoprotein stock preparations (30–100 mg/ml) had no detectable (<25 ng/ml) LPS contamination revealed by Limulus amebocyte lysate assay (E-Toxate kit; Sigma-Aldrich), indicating the maximum possible LPS level under experimental conditions of <0.25 ng/ml.

Ag processing and presentation assays

Macrophages were detached with trypsin-versene (BioWhittaker), plated in 96-well flat-bottom plates at 105 cells/well, and incubated for 24 h with 10 ng/ml rIFN-{gamma} (Genzyme, Cambridge, MA) plus 48 h with MTB or PAMPs in the continued presence of IFN-{gamma}. Cells were incubated with latex-OVA or OVA peptide for 2 h, fixed with 1% paraformaldehyde, washed, and incubated for 24 h with T hybridoma cells (105/well). Supernatants (100 µl) were frozen, thawed, and assessed for IL-2 using a colorimetric CTLL-2 bioassay (4, 33). CTLL-2 cells (5 x 103/well) were incubated with supernatants for 24 h at 37°C, Alamar blue (Accumed, Chicago, IL) was added (15 µl/well) for 24 h, and Alamar blue reduction was determined by difference in OD at 550 and 595 nm using a Bio-Rad model 550 microplate spectrophotometer. To assess conventional MHC-I processing, macrophages were suspended at 2 x 106/ml in 0.5 ml of DMEM in 4-mm-gap electroporation cuvettes (Life Technologies, Grand Island, NY) and electroporated at 4°C with a Cell-Porator (Life Technologies) at 200 V, 800 µF, and low resistance settings (26, 30, 34). Macrophages were washed, plated (105/well) for 2 h and fixed for T cell assays. To assess peptide regurgitation, CBA/J macrophages were treated with IFN-{gamma} and PAMPs, plated (105/well) onto previously fixed B6D2 macrophages (105/well), and incubated for 24 h with latex-OVA and CD8OVA1.3 cells.

Flow cytometry

Macrophages (4.5 x 105 cells/well in 24-well plates) were incubated with 10 ng/ml IFN-{gamma} for 24 h and then PAMPs plus IFN-{gamma} for 24–72 h. Macrophages were detached with trypsin-EDTA and incubated in V-bottom plates (2 x 105 cells/well) at 4°C for 60 min with 10% normal mouse serum (The Jackson Laboratory) and 1% FCS (HyClone Laboratories) in PBS. Cells were stained with biotinylated specific Ab or murine IgG2a-biotin isotype control Ab at 5 µg/ml, incubated with streptavidin-CyChrome (2 µg/ml; BD PharMingen), fixed with 1% paraformaldehyde, and analyzed with a FACScan flow cytometer (BD Immunocytometry Systems, San Jose, CA). Specific mean fluorescence value (MFV) was obtained by subtracting MFV with isotype control Ab from MFV with specific Ab.

RNA purification, cDNA synthesis, and real-time quantitative PCR

Cells were lysed with a QiaShredder (Qiagen, Valencia, CA). RNA was purified using an RNeasy kit (Qiagen) and depleted of residual genomic DNA with RNase-free DNase (Qiagen). RNA (1 µg) was converted to cDNA using the SuperScript preamplification system (Life Technologies) for first-strand cDNA synthesis, and 10% of the product was used per reaction for real-time quantitative PCR using a high-speed thermal cycler (LightCycler; Roche Diagnostics, Indianapolis, IN). PCR product was detected with FastStart Master SYBR Green I (Roche Diagnostics). Amplification cycle was 95°C for 15 s, 50°C for 5 s (57°C for GAPDH primers), and 72°C for 10 s. Sequences for primers were as follows: GAPDH: sense 5'-3' AACGACCCCTTCATTGAC and antisense 5'-3' TCCACGACATACTCAGCAC (predicted size = 191 bp) (35). MHC-I (H-2Kb): sense 5'-3' TACCAGCAGTACGCCTACGAC and antisense 5'-3'GCGTTCCCGTTCTTCAGGTAT (predicted size = 194 bp) (designed using OLIGO version 6.4; Molecular Biology Insights, Cascade, CO). ODNs were purchased from Life Technologies. Specific cDNA was quantified relative to amplified cDNA product from an agarose gel using a QiaQuick gel extraction kit (Qiagen). Melting curve analysis confirmed that only one product was amplified. Electrophoresis of products through 1.5% agarose and ethidium bromide staining confirmed that each primer set produced only a single species of predicted size.

Analysis of isolated phagosomes by flow organellometry

Macrophages were plated in 6-well plates (2.5 x 107 cells/well) and incubated with IFN-{gamma} for 24 h and then with IFN-{gamma} plus PAMPs for 48 h. Covalently conjugated OVA was added for a 5-min pulse plus various chase incubations. Cells were detached by scraping, resuspended in homogenization buffer (0.25 M sucrose and 10 mM HEPES pH 7.2, 1 mM PMSF, 2 µg/ml pepstatin A, and 2 µg/ml leupeptin) and homogenized in a Dounce homogenizer (Kontes, Vineland, NJ) to obtain 80–85% lysis (36, 37). Intact cells and nuclei were removed by centrifugation (900 x g, 5 min). Crude phagosomes were pelleted by centrifugation at 3000 x g for 10 min, fixed with paraformaldehyde, washed, resuspended in PBS to 107 phagosomes/ml and immunolabeled in the presence of saponin (36, 37).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Alternate MHC-I Ag processing is inhibited by MTB

To determine the effects of MTB on Ag processing, IFN-{gamma}-activated macrophages were infected by incubation with MTB H37Ra for 2 h, washed, and incubated for 48 h. To assess Ag processing activity, macrophages were incubated with latex-OVA Ag for 2 h, fixed, and incubated with CD8OVA1.3 cells to detect OVA257–264:Kb complexes or DOBW cells to detect OVA323–339:I-Ab complexes. Alternate MHC-I Ag processing of latex-OVA for presentation to CD8OVA T cells was inhibited by infection of macrophages with MTB H37Ra at a multiplicity of infection (MOI) of 3:1 or greater (Fig. 1A). However, MHC-I presentation of exogenous OVA257–264 peptide to CD8OVA1.3 was not inhibited, suggesting that expression of peptide-receptive MHC-I was not reduced (Fig. 1B). MHC-II Ag processing of latex-OVA was inhibited by MTB H37Ra at a MOI of 3:1 or greater (Fig. 1C), as predicted by previous studies (6, 9). In addition, MHC-II presentation of OVA323–339 peptide was also inhibited by MTB H37Ra (Fig. 1D). Thus, MTB H37Ra inhibited both MHC-II and alternate MHC-I Ag processing, but the availability of peptide-receptive molecules that could bind and present exogenous peptide was decreased only for MHC-II.



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 1. MTB inhibits alternate MHC-I Ag processing, MHC-II Ag processing, and MHC-II peptide presentation, but not MHC-I peptide presentation. IFN-{gamma}-stimulated B6D2 bone marrow macrophages were pulsed with MTB H37Ra for 2 h, washed, incubated for 48 h, exposed to latex-OVA or antigenic peptide for 2 h, fixed, and incubated with T hybridoma cells. Supernatants were assessed for IL-2 using a colorimetric CTLL-2 bioassay. A, Macrophage processing of latex-OVA for presentation to MHC-I-restricted CD8OVA1.3 T hybridoma cells. B, MHC-I presentation of OVA257–264 peptide. C, Macrophage processing of latex-OVA for presentation to MHC-II-restricted DOBW T hybridoma cells. D, MHC-II presentation of OVA323–339 peptide. Data points represent means of triplicate samples with SD. These results are representative of three independent experiments.

 
MTB 19-kDa lipoprotein and other PAMPs inhibit alternate MHC-I Ag processing: role of signaling via TLRs and MyD88

Previous studies indicated that MHC-II Ag processing by macrophages is inhibited by MTB 19-kDa lipoprotein and other PAMPs (e.g., CpG DNA and LPS) (6). MTB 19-kDa lipoprotein was the primary inhibitory PAMP isolated from MTB (6) and its ability to inhibit MHC-II Ag processing was dependent on signaling via TLR-2. CpG DNA (which signals via TLR-9) is also present in MTB and other bacteria. LPS (which signals via TLR-4) is not present in MTB but is present in other bacteria, and other MTB PAMPs may signal via TLR-4 (38).

To determine the ability of MTB 19-kDa lipoprotein and other PAMPs to inhibit alternate MHC-I Ag processing, IFN-{gamma}-activated macrophages were incubated with PAMPs for 24 (data not shown) or 48 h (Fig. 2), and processing of latex-OVA was assessed as described above. Like infection with MTB, exposure to MTB 19-kDa lipoprotein, CpG ODN 1826, or LPS inhibited alternate MHC-I Ag processing of latex-OVA (Fig. 2A), MHC-II Ag processing of latex-OVA (Fig. 2C), and MHC-II presentation of the OVA323–339 peptide (Fig. 2D). MHC-I presentation of OVA257–264 peptide was not inhibited (or was even slightly enhanced) (Fig. 2B). Results were similar when macrophages were incubated with PAMPs for 24 or 48 h (data not shown), but substantial inhibition of alternate MHC-I or MHC-II Ag processing occurred only after a delay of 16 h from the addition of MTB 19-kDa lipoprotein (Fig. 3, B and C). Taken together, these data indicate that alternate MHC-I processing is inhibited by MTB, MTB 19-kDa lipoprotein, and other PAMPs despite continued expression of cell surface peptide-receptive MHC-I molecules.



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 2. MTB 19-kDa lipoprotein and other PAMPs inhibit alternate MHC-I Ag processing, MHC-II Ag processing, and MHC-II peptide presentation, but not MHC-I peptide presentation. B6D2 bone marrow macrophages were activated with IFN-{gamma} for 24 h, incubated with PAMPs in the continued presence of IFN-{gamma} for 48 h, exposed to antigenic protein or peptide for 2 h, fixed, and incubated with T hybridoma cells. A, Macrophage processing of latex-OVA for presentation to MHC-I-restricted CD8OVA1.3 T hybridoma cells. B, MHC-I presentation of OVA257–264 peptide. C, Macrophage processing of latex-OVA for presentation to MHC-II-restricted DOBW T hybridoma cells. D, MHC-II presentation of OVA323–339 peptide. Data points represent means of triplicate samples with SD. These results are representative of four independent experiments.

 


View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 3. Inhibition of MHC-II and alternate MHC-I Ag processing by MTB 19-kDa lipoprotein is dependent on TLR-2 and MyD88, and exhibits delayed onset (after 16 h of exposure). Macrophages were incubated with IFN-{gamma} (24 h), exposed to 30 nM MTB 19-kDa lipoprotein in the continued presence of IFN-{gamma}, incubated with latex-OVA for 2 h, fixed, and incubated with T hybridoma cells. A, MTB 19-kDa lipoprotein inhibits alternate MHC-I Ag processing via TLR-2/MyD88 signaling. Macrophages from C57BL/6, TLR-2-/-, and MyD88-/- mice were exposed to MTB 19-kDa lipoprotein for 48 h and incubated with latex-OVA at 300 ng/ml. B, Macrophages were exposed to MTB 19-kDa lipoprotein for the indicated periods and then incubated with 1000 ng/ml OVA. CD8OVA cells were used to determine MHC-I Ag presentation. C, Macrophages were exposed to MTB 19-kDa lipoprotein for the indicated periods and then incubated with 10 ng/ml OVA. DOBW cells were used to determine MHC-II Ag presentation. Data points represent means of triplicate samples ± SD. These results are representative of four independent experiments.

 
Lipoproteins require TLR-2 and MyD88 adaptor protein to induce NF-{kappa}B-dependent gene transcription and cytokine secretion (39, 40). MTB 19-kDa lipoprotein requires TLR-2 to inhibit MHC-II Ag processing and MHC-II expression (6). To investigate whether TLR-2 and MyD88 are required for MTB 19-kDa lipoprotein to inhibit alternate MHC-I Ag processing, macrophages were prepared from TLR-2-/- mice, MyD88-/- mice, and wild-type C57BL/6 mice. IFN-{gamma}-activated macrophages were incubated with PAMPs for 48 h, and processing of latex-OVA was assessed as described above. TLR-2 was required for inhibition of alternate MHC-I Ag processing by MTB 19-kDa lipoprotein (Fig. 3A) but not by CpG ODN 1826 or LPS (data not shown). Other mycobacterial PAMPs besides MTB 19-kDa lipoprotein are also able to inhibit Ag processing, because alternate MHC-I and MHC-II Ag processing of latex-OVA was inhibited by both Mycobacterium bovis bacillus Calmette-Guérin (BCG) and a 19-kDa lipoprotein knockout BCG strain (41) (data not shown), and inhibition by MTB occurred even in TLR-2 knockout macrophages (data not shown). However, MyD88 was required for CpG ODN, LPS, 19-kDa lipoprotein, or MTB to establish inhibition (Fig. 3A and data not shown), suggesting that the inhibitory effects of all of the PAMPs were dependent on TLRs that signal through MyD88.

MTB, MTB 19-kDa lipoprotein, CpG DNA, and LPS do not inhibit conventional MHC-I MHC Ag processing

Additional experiments examined the effect of MTB 19-kDa lipoprotein and other PAMPs on conventional MHC-I processing of cytosolic Ag. B6D2 macrophages were activated with IFN-{gamma} and then incubated for 48 h with or without MTB 19-kDa lipoprotein (30 nM, Fig. 4A), control fraction (electroelution fractions from the 19-kDa purification procedure that did not contain MTB 19-kDa lipoprotein, Fig. 4A), MTB lysate (30 µg/ml, Fig. 4B), LPS (100 ng/ml, Fig. 4C), non-CpG 1982 ODN (1 µg/ml, Fig. 4D), or CpG ODN 1826 (1 µg/ml, Fig. 4D). To deliver Ag to the appropriate subcellular compartment for conventional MHC-I Ag processing, OVA protein was introduced into the cytosol of macrophages by electroporation (30). Conventional MHC-I processing was not altered by MTB lysate, MTB 19-kDa lipoprotein, or any other PAMP. Thus, MTB and PAMPs inhibit the alternate MHC-I Ag processing pathway but do not affect the conventional MHC-I Ag processing pathway.



View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 4. MTB products and other PAMPs do not inhibit conventional MHC-I Ag processing. Macrophages were incubated with IFN-{gamma} and PAMPs as in Fig. 2, and electroporated to introduce OVA into the cytosol. Cells were then washed, plated for 2 h at 37°C, fixed, and incubated with CD8OVA1.3 T hybridoma cells. "None" refers to cells that were not exposed to PAMPs. "No Ag" refers to cells that were electroporated with no Ag present. A, MTB 19-kDa lipoprotein does not inhibit conventional MHC-I Ag processing. Before electroporation, macrophages were incubated with MTB 19-kDa lipoprotein, standard medium with no PAMP (none), or a control electroelution fraction (Ctrl Fraction) from MTB 19-kDa lipoprotein purification procedure that did not contain the lipoprotein. B, MTB lysate does not inhibit conventional MHC-I Ag processing. C, LPS does not inhibit conventional MHC-I Ag processing. D, CpG ODN 1826 (CpG 1826) does not inhibit conventional MHC-I Ag processing. ODN 1982 (Non-CpG), which lacks a CpG sequence, was used as a control. Data points represent means of triplicate samples with SD. The results in each panel are representative of at least three independent experiments.

 
MHC-I expression is not inhibited by MTB lysate, MTB 19-kDa lipoprotein, or other PAMPs that inhibit MHC-II expression

Flow cytometry was used to assess cell surface expression of MHC-I and MHC-II after exposure to MTB 19-kDa lipoprotein and other PAMPs. B6D2 macrophages were incubated for 24 h with IFN-{gamma} and then for 48 h with PAMPs in the continued presence of IFN-{gamma}. Cell surface expression of MHC-II (I-Ab) was reduced to 42% of the control level by MTB lysate (Fig. 5A), to 26% of control by MTB 19-kDa lipoprotein (Fig. 5C), to 24% of control by LPS (Fig. 5E), and to 75% of control with CpG ODN (Fig. 5G). Dose-response experiments indicated that I-Ab expression was strongly inhibited with 30 nM MTB 19-kDa lipoprotein (Fig. 6A). Inhibition was observed with as little as 3 nM MTB 19-kDa lipoprotein (Fig. 6A). Kinetic studies showed that I-Ab levels were inhibited at 24–72 h after the addition of MTB 19-kDa lipoprotein (data not shown). Thus, MTB 19-kDa lipoprotein and other PAMPs inhibited expression of MHC-II by macrophages, as demonstrated in earlier studies (5, 6, 9).



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 5. Cell surface expression of MHC-I is unaltered after treatment with MTB components or other PAMPs that inhibit MHC-II expression. Macrophages were incubated with IFN-{gamma} and PAMPs as in Fig. 2. PAMPs included MTB lysate (MTB Lys; 32 µg/ml; A and B), MTB 19-kDa lipoprotein (30 nM; C and D), LPS (100 ng/ml; E and F), and CpG ODN 1826 (1 µg/ml; G and H). Controls were standard medium or a control fraction from the electrophoretic purification of MTB 19-kDa lipoprotein that did not contain the lipoprotein (Ctrl fxn). Macrophages were stained with biotin-34-5-3S (anti I-Abxd) (A, C, E, and G), biotin-CTKb (anti Kb) (B and D), biotin-28-8-6 (anti Kbxd) (F and H), or biotin-mouse IgG2a isotype control Ab. Each panel is representative of three or more independent experiments.

 


View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 6. MTB 19-kDa lipoprotein and other PAMPs do not inhibit MHC-I expression. Macrophages were incubated with IFN-{gamma} and PAMPs as in Fig. 2. A, Flow cytometry to detect MHC-I with biotin-34-5-3S (anti I-Abxd) or biotin-28-8-6 (anti Kbxd). Specific MFV is the MFV for staining with biotin-anti-MHC-I minus the MFV for staining with biotin-mouse IgG2a isotype control Ab. B, Determination of MHC-I mRNA by quantitative RT-PCR. Data points represent mean with SD for three independent experiments.

 
In contrast, macrophage expression of cell surface MHC-I (Kb) was not inhibited by any of the PAMPs (Figs. 5 and 6). Slight increases in Kb expression were sometimes observed (e.g., for MTB lysate in Fig. 5B and MTB 19-kDa lipoprotein, Fig. 6A), but these increases were small and not always evident. Cell surface Kb levels did not decrease with doses of MTB 19-kDa lipoprotein up to 30 nM (Fig. 6A) or with treatment times of 0–72 h (data not shown). Thus, MHC-I expression was maintained or slightly increased as MHC-II expression was actively inhibited by PAMPs.

In addition to studies of cell surface expression of Kb, real-time quantitative PCR was used to assess Kb mRNA expression after incubation with or without PAMPs. Macrophages were treated for 24 h with IFN-{gamma} and for an additional 48 h with IFN-{gamma} plus PAMPs. The cells were then lysed, and RNA was purified for quantitative RT-PCR. MTB 19-kDa lipoprotein, LPS, and CpG ODN all produced no significant change in Kb mRNA expression (Fig. 6B). Thus, inhibition of alternate MHC-I Ag processing cannot be explained by decreased MHC-I synthesis or expression.

MTB 19-Da lipoprotein and other PAMPs do not inhibit phagocytosis or targeting of MHC-I to phagosomes

Because PAMPs did not inhibit synthesis or expression of MHC-I molecules, we investigated whether alteration in phagocytosis or phagosome composition could explain the inhibition of alternate MHC-I Ag processing. To assess whether MTB 19-kDa and other PAMPs inhibit phagocytosis, B6D2 macrophages were treated with IFN-{gamma} and PAMPs as in previous experiments and then were incubated with fluorescent latex-OVA (OVA conjugated to fluorescent beads). Analysis of cells by flow cytometry revealed the number of fluorescent beads internalized by phagocytosis under different conditions. Treatment with PAMPs did not change the number of beads phagocytosed per cell over 2 h (Fig. 7A). With phagocytosis periods of <30 min, the phagocytic rate was actually observed to increase with exposure to MTB 19-kDa lipoprotein (data not shown). Thus inhibition of alternate MHC-I Ag processing was not attributable to inhibition of phagocytosis.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 7. Phagocytosis and targeting of MHC-I to phagosomes are not inhibited by MTB 19-kDa lipoprotein and other PAMPs. Macrophages were treated with IFN-{gamma} and PAMPs as in Fig. 2. PAMPs included MTB 19-kDa lipoprotein (19 kDa), CpG ODN 1826 (1826), LPS, and a no PAMP control (None). A, Macrophages were pulsed for 2 h with fluorescent latex beads conjugated with OVA (extracellular OVA concentration of 30 or 300 ng/ml) and analyzed for bead phagocytosis by flow cytometry. The percent of cells that phagocytosed latex-OVA Ag for the conditions none, 19-kDa, 1826, and LPS was 67, 81, 72, and 78% at latex-OVA of 30 ng/ml and 96, 96, 94, and 92% at latex-OVA of 300 ng/ml, respectively. B, Macrophages were pulsed with latex-OVA beads for 5 min, washed, and incubated for different chase periods. Phagosomes were prepared and analyzed by flow organellometry with staining for MHC-I with 34-1-2s Ab in the presence of saponin. Phagosome age refers to the pulse plus chase time. MFVs for the samples shown in this panel for the conditions none, 19 kDa, 1826, and LPS were 247, 203, 250 and 218 at 15 min, and 131, 147, 200 and 115 at 35 min, respectively. The percent of cells stained for none, 19 kDa, 1826, and LPS was 42, 48, 56, and 45% at 15 min and 16, 35, 37 and 33% at 30 min, respectively. The results of both panels are representative of three independent experiments.

 
We next determined whether inhibition of alternate MHC-I Ag processing by MTB was due to decreased levels of MHC-I in phagosomes, where peptide binding may occur. Although previous results demonstrated that levels of cell surface MHC-I and mRNA for MHC-I were unaltered, the ability of PAMPs to alter MHC-I trafficking and distribution among subcellular compartments was unexplored. To determine whether phagosome levels of MHC-I were affected by PAMPs, macrophages were incubated with IFN-{gamma} and PAMPs as above, exposed to latex-OVA, homogenized, and used to produce phagosomes for flow organellometry (36, 37). Phagosomes were stained with Abs to MHC-I in the presence of saponin (to reveal lumenal epitopes). MTB 19-kDa lipoprotein and other PAMPs produced no consistent change in expression of MHC-I in phagosomes (Fig. 7B). Thus, inhibition of processing is not due to decreased availability of MHC-I, suggesting the possibility of changes in handling of Ag molecules and the production of antigenic peptides that bind MHC-I.

Exposure of macrophages to MTB 19-kDa lipoprotein and other PAMPs results in decreased regurgitation of antigenic peptides

In the course of vacuolar alternate MHC-I Ag processing, some peptide:MHC-I complexes can be formed on the cell surface by binding of recycled or regurgitated peptides to cell surface peptide-receptive MHC-I molecules. However, it is still unclear whether the majority of complexes are formed by this mechanism or by binding of peptides to intracellular MHC-I molecules (e.g., in phagosomes). We investigated the potential impact of MTB and PAMPs on peptide regurgitation. B6D2 macrophages (H-2bxd) were plated, fixed with paraformaldehyde, and thereby rendered incapable of Ag processing but still capable of presenting exogenous peptide or peptide regurgitated by other cells. These fixed cells were incubated for 24 h with live CBA/J cells (H-2k, previously treated with IFN-{gamma} and PAMPs as above), latex-OVA and CD8OVA1.3 T hybridoma cells. Because CD8OVA1.3 cells only recognize OVA257–264 when presented by Kb, which is not expressed by CBA/J macrophages, peptide recognition could only result when peptide was regurgitated from live CBA/J cells and bound to Kb on fixed B6D2 cells. Peptide regurgitation was detected (Fig. 8), although "trans" presentation by regurgitation onto fixed cells by viable cells was much less efficient than direct "cis" presentation, as reported previously (25). Macrophages that were treated with PAMPs had significantly reduced peptide regurgitation (Fig. 8), indicating that a step required for Ag proteolysis or peptide recycling is inhibited by MTB 19-kDa lipoprotein and other PAMPs. Thus, to the extent that peptide regurgitation contributes, this inhibitory mechanism may decrease alternate MHC-I Ag processing. More important, because regurgitation may be insignificant for physiological production of peptide:MHC-I complexes, these results suggested the possibility that phagosome Ag catabolism was inhibited, potentially decreasing formation of peptide:MHC-I complexes within phagosomes.



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 8. Recycling and regurgitation of antigenic peptide is decreased after treatment of macrophages with MTB 19-kDa lipoprotein. B6D2 bone marrow macrophages (H-2bxd) were plated and fixed (hence they were unable to process Ag but could present exogenous peptide or peptide regurgitated by other cells). These cells were then incubated for 24 h with viable CBA/J macrophages (H-2k) that previously had been treated with PAMPs (as in Fig. 2), latex-OVA, and CD8OVA1.3 T hybridoma cells. Positive control (Pos. Ctrl) wells contained fixed CBA/J macrophages and live B6D2 macrophages. Negative control (Neg. Ctrl) wells contained fixed B6D2 macrophages and no viable macrophages. Data points represent means of triplicate samples with SD. These results are representative of three independent experiments.

 
MTB 19-kDa lipoprotein, CpG DNA, and LPS inhibit phagosome maturation and Ag catabolism

We investigated whether inhibition of alternate MHC-I Ag processing by MTB and PAMPs was due to decreased phagosome Ag catabolism, which could result from inhibition of phagosome maturation. Phagosomes undergo a process of maturation, which involves fusion with lysosomes and acquisition of lysosomal markers and proteases. MTB is known to inhibit phagosome maturation (42, 43, 44, 45, 46, 47, 48), but the mechanism for this inhibition is unknown. To assess modulation of phagosome maturation and Ag catabolism, macrophages were incubated with IFN-{gamma} and MTB 19-kDa lipoprotein, exposed to latex-OVA, and homogenized; phagosomes were prepared and analyzed by flow organellometry (36, 37). Phagosomes were stained with Abs to LAMP-1 (a lysosomal marker that can be used as a measure of phagosome maturation) in the presence of saponin (to reveal lumenal epitopes). LAMP-1 expression in phagosomes increased with time after phagocytosis (Fig. 9A), consistent with phagosome maturation. However, treatment of macrophages with MTB 19-kDa lipoprotein inhibited acquisition of LAMP-1 by phagosomes. The decrease in LAMP-1 acquisition was due primarily to a decrease in the proportion of phagosomes that acquired significant labeling for LAMP-1 (some phagosomes continued to acquire LAMP-1 even after treatment with MTB 19-kDa lipoprotein). In control cells, 89.1% of phagosomes acquired LAMP-1 by 35 min with an overall specific MFV of 217, but in cells treated with MTB 19-kDa lipoprotein, only 69.3% of phagosomes acquired LAMP-1 with an overall specific MFV of 156 at this time point. Although LAMP-1 was eventually acquired by most phagosomes, this process was delayed by 20–30 min (Fig. 9A). Similar inhibition of phagosome maturation was seen with CpG ODN 1826 and LPS (data not shown). Furthermore, inhibition of phagosome maturation by MTB 19-kDa lipoprotein was abrogated in macrophages from TLR-2-/- mice (Fig. 9B). However, MTB contains other PAMPs that allowed it to inhibit phagosome maturation in TLR-2-/- macrophages (Fig. 9B). We conclude that MTB 19-kDa lipoprotein and other PAMPs can kinetically inhibit phagosome maturation via TLR-2, diminishing the degree of phagosome maturation at early time points and delaying the time needed for full maturation of phagosomes. Because phagosome maturation is necessary for full acquisition of the proteases used for Ag proteolysis, this observation suggests that PAMPs inhibit alternate MHC-I Ag processing by inhibiting Ag handling or proteolysis.



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 9. MTB 19-kDa lipoprotein inhibits phagosome maturation and OVA degradation through TLR-2. Macrophages were treated with IFN-{gamma} and PAMPs as in Fig. 2, pulsed with covalently linked latex-OVA beads for 5 min (extracellular OVA concentration of 250 ng/ml), washed, and incubated for different chase periods. Latex bead phagosomes were prepared and analyzed by flow organellometry. Phagosome age refers to the pulse plus chase time. A, Phagosomes of various ages were stained with 1D4B Ab for LAMP-1, a marker for phagosome maturation. MFV for 5, 15, 35, and 125 min was 37, 107, 217, and 220 for macrophages with no inhibitor, and 32, 48, 156, and 213 for macrophages exposed to MTB 19-kDa lipoprotein, respectively. The percent of cells stained for 5, 15, 35, and 125 min was 33, 62, 90, and 95% for macrophages with no inhibitor, and 26, 33, 70, and 91% for macrophages exposed to MTB 19-kDa lipoprotein, respectively. B, Phagosomes were prepared from C57BL/6 or TLR-2-/- mice that were previously exposed to MTB 19-kDa lipoprotein, MTB H37Ra at an MOI of 30:1, or no PAMP. Phagosomes were prepared after uptake of latex-OVA for 15 min and stained with 1D4B Ab for LAMP-1. MFV for the conditions none, MTB 19-kDa lipoprotein, and MTB H37Ra was 82, 45, and 33 in C57BL/6 macrophages and 91, 101, and 30 in TLR-2-/- macrophages, respectively. The percent of cells stained for none, MTB 19-kDa lipoprotein, and MTB 30:1 was 45, 30, 20 in C57BL/6 macrophages, and 48, 46, and 20% in TLR2-/- macrophages, respectively. C, Phagosomes of various ages were stained for OVA to assess Ag degradation. MFV for 5, 15, 35, and 125 min was 252, 164, 90, and 52 for macrophages with no inhibitor and 345, 326, 191, and 58 for macrophages exposed to MTB 19-kDa lipoprotein, respectively. The percent of cells stained for 5, 15, 35, and 125 min was 98, 82, 61, and 27% for macrophages with no inhibitor, and 100, 99, 88, and 30% for macrophages exposed to MTB 19-kDa lipoprotein, respectively. These results are representative of three independent experiments.

 
To assess the impact of MTB 19-kDa lipoprotein and other PAMPs on Ag proteolysis, phagosome catabolism of OVA was assessed by flow organellometry. Macrophages were prepared and exposed to latex-OVA, and phagosomes were prepared as above for flow organellometry. Covalently linked latex-OVA was used to ensure that OVA did not dissociate from the beads without proteolysis. Treatment of macrophages with MTB 19-kDa lipoprotein inhibited Ag proteolysis, as revealed by increased staining of phagosomes for OVA (Fig. 9C). LPS and CpG ODN similarly reduced Ag catabolism (data not shown). Thus, PAMPs inhibited phagosome maturation and Ag proteolysis via TLR-2 signaling, providing a mechanism for inhibition of alternate MHC-I Ag processing.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
T cell responses are important for containment of infection, and T cell effector mechanisms are particularly important for immunity to intracellular pathogens, e.g., MTB. Although CD4+ T cells predominate in responses to MTB, CD8+ T cells also respond to MTB in humans and mice (11, 12, 13, 14, 15, 16, 17, 18, 20, 22, 23, 49) and contribute to protective immunity to MTB in murine models (7, 19, 20). Nonetheless, MTB maintains chronic infection by evading host defense mechanisms, probably by using multiple strategies to resist or evade microbicidal mechanisms and immune surveillance. One strategy appears to be evasion of CD4+ T cell responses by inhibiting macrophage presentation of MTB Ags on MHC-II (6, 9). Despite the existence of CD8+ T cell responses to MTB in human and murine systems, the effect of MTB on MHC-I expression and Ag processing was previously unknown. In this study, we assessed the impact of MTB, MTB 19-kDa lipoprotein, and other PAMPs on MHC-I expression and Ag processing by both conventional and alternate pathways.

As measured by flow cytometry and by the ability to present exogenous antigenic peptide, cell surface expression of MHC-I was maintained at normal levels after exposure to MTB, MTB lysate, purified MTB 19-kDa lipoprotein, and other PAMPs (CpG ODN and LPS) for up to 72 h. The steady state level of MHC-I mRNA in macrophages was also unaffected by such treatments. Lack of PAMP-mediated inhibition of MHC-I synthesis and expression is consistent with the finding that conventional MHC-I processing of protein Ag was unaffected by MTB 19-kDa lipoprotein or other PAMPs. In contrast, treatment with PAMPs inhibited MHC-II synthesis and expression, as well as the ability of macrophages to present exogenous peptides or process Ag for presentation to MHC-II-restricted T hybridoma cells. Despite the fact that PAMPs did not inhibit MHC-I expression, they did dramatically inhibit processing of latex-OVA for presentation by MHC-I. Thus, MTB-associated PAMPs and other PAMPs inhibit both MHC-II and alternate MHC-I Ag processing, but by different mechanisms.

Models of alternate MHC-I processing of exogenous particulate Ag include processing entirely within vacuolar compartments or initial processing in vacuolar compartments followed by escape of Ag or Ag fragments into the cytosol to merge with the conventional MHC-I processing pathway. Studies of alternate MHC-I processing of exogenous particulate Ag in macrophages point to vacuolar processing as a major mechanism (24, 26, 50). Two recent studies showed such vacuolar processing of MTB itself (22, 23). In vacuolar Ag processing, Ag is phagocytosed and degraded within phagosomes to produce antigenic peptides that may bind MHC-I inside phagosomes or on the cell surface (following peptide recycling and regurgitation) (24). Although peptide regurgitation was detected in these and other studies, the proportion of peptide:MHC-I complexes that is actually generated by this mechanism remains unclear, and intracellular formation of peptide:MHC-I complexes may predominate.

There are multiple potential mechanisms that could explain inhibition of vacuolar alternate MHC-I Ag processing by MTB 19-kDa lipoprotein and other PAMPs: decreased MHC-I synthesis/expression, decreased trafficking of MHC-I to the site of peptide binding (e.g., phagosomes), decreased Ag uptake, decreased Ag catabolism (perhaps related to decreased phagosome maturation), and decreased Ag regurgitation for binding to cell surface MHC-I. Several of these possible mechanisms are excluded by our observations. Phagocytic uptake of Ag, MHC-I surface expression, MHC-I synthesis as examined by mRNA expression, and MHC-I levels inside phagosomes were all unchanged or were even slightly enhanced by MTB 19-kDa lipoprotein. However, phagosome maturation (assessed by acquisition of LAMP-1) and Ag catabolism were inhibited. Diminished Ag catabolism likely results from decreased phagosome maturation and decreased delivery of lysosomal proteases. Peptide regurgitation was also inhibited, presumably consequent to decreased phagosome Ag catabolism. The extent to which peptide regurgitation contributes to alternate MHC-I Ag processing is not clear, but this finding provides additional evidence for decreased catabolic processing of Ag in phagosomes. In summary, we propose that inhibition of alternate MHC-I Ag processing by MTB and PAMPs stems from decreased phagosome Ag catabolism due to inhibition of phagosome maturation and decreased delivery of lysosomal proteases to phagosomes. This inhibition may result from inhibition of IFN-{gamma} signaling, as observed in other studies with MTB (51, 58), especially since PAMP-induced inhibition appears to affect the IFN-{gamma}-induced enhancement of alternate MHC-I Ag processing as opposed to the lesser IFN-{gamma}-independent baseline processing activity (A. A. R. Tobian, unpublished observations). Furthermore, inhibition of IFN-{gamma} signaling may allow MTB to inhibit phagosome maturation even when macrophages are exposed to IFN-{gamma}, which normally mitigates inhibition of phagosome maturation.

In our previous studies, MTB 19-kDa lipoprotein was identified as a major PAMP expressed by MTB (and BCG) in terms of activity for inhibition of MHC-II Ag processing. Nonetheless, mycobacterial PAMPs other than 19-kDa lipoprotein can inhibit MHC-II Ag processing, because 19-kDa-lipoprotein knockout BCG inhibited both alternate MHC-I and MHC-II Ag processing (data not shown). Moreover, MTB PAMPs can signal through TLR-2 and other TLRs (Figs. 3 and 9, and data not shown). Thus, a variety of PAMPs and TLRs can contribute to inhibition of Ag processing. Because TLRs can localize to phagosomes and lysosomes (52, 53, 54), the presence of PAMPs in phagosomes containing MTB or other bacteria would allow chronic stimulation of TLRs to induce the inhibition.

We observed that PAMPs inhibited phagosomal Ag processing after a delay of 16 h of exposure, yet phagosome maturation was inhibited from 5–125 min after initiation of phagocytosis. The difference in timing of these events suggests that the initial contact of a macrophage with a bacterium is unlikely to inhibit phagosomal processing of that bacterium. (This timing issue may explain why inhibition was not seen in the studies of Mazzaccaro et al. (55), whose studies differed in the use of soluble instead of particulate Ag and the activation state of the macrophages as well as timing of addition of MTB vs Ag). Nonetheless, it is possible that earlier exposure to bacterial PAMPs inhibits subsequent ability to process phagocytosed bacteria. This could occur at a site of infection where macrophages encounter more than one bacterium; phagocytosis of one bacterium could initiate inhibitory mechanisms to decrease processing of a second bacterium. Another scenario involves prior exposure of macrophages to bacterial PAMPs released from extracellular bacteria or shed from other infected cells, establishing inhibition before bacterial phagocytosis. MTB 19-kDa lipoprotein is shed from MTB in culture, and we have observed that MTB PAMPs are shed from MTB-infected cells and can inhibit neighboring uninfected macrophages (R. K. Pai, unpublished observations). In chronic tuberculosis, PAMPs shed from infected macrophages may establish inhibition in adjacent uninfected macrophages that may subsequently become infected. Thus, inhibition of phagosome maturation could promote persistence of MTB in chronic tuberculosis, but further investigation is necessary to test the application of these models to in vivo infections.

Our model does not predict overall inhibition of immune responses to pathogens such as MTB. Continuing recruitment of new, uninfected, and uninhibited monocytes/macrophages to the site of infection and the contributions of other APCs (e.g., dendritic cells and B cells) that respond differently to PAMPs will continue to induce T cell responses. Thus, strong T cell responses will still be mounted against MTB (as observed in infected individuals), and these may activate microbicidal effector mechanisms to help contain infection. In addition, the acute effects of PAMPs may include induction of direct microbicidal mechanisms (56). We have also observed that MTB 19-kDa lipoprotein enhances macrophage phagocytosis within 2 h (A. A. R. Tobian, unpublished observations). However, chronic exposure to PAMPs inhibits alternate MHC-I and MHC-I Ag processing. Thus, although many APC may not be inhibited, the niches provided by chronically infected macrophages will allow some MTB bacilli to evade immune responses and persist in the host.

One puzzle is why these inhibitory mechanisms exist at all. Were the mechanism unique to MTB, it might represent an MTB-specific derangement of immune function, evolved by MTB to modulate host responses to its benefit. However, the same response is also seen in response to PAMPs from other organisms and seems to reflect a phase of the general pattern of response to PAMPs evolved by the host. The mechanisms whereby PAMPs inhibit macrophage Ag processing and presentation may be host-beneficial in some pathophysiologic situations. We propose that PAMPs activate immune responses at early time points but produce counterregulatory (or inhibitory) responses at late time points. The latter may benefit the host during infection by some bacteria (e.g., extracellular pathogens) by limiting excessive inflammation and deleterious overamplification of immune responses.

CD8+ T cell function has been shown to contribute to anti-MTB immune responses by cytokine secretion and lysis of infected cells. Inhibition of these functions may be particularly important in the setting of chronic infection with MTB (57) or possibly other intracellular pathogens. Inhibition of both alternate MHC-I and MHC-II processing provides a mechanism whereby such intracellular pathogens may persist in host macrophages, chronically inhibiting APC function and evading immune responses.


   Acknowledgments
 
We thank Mike Sramkoski for assistance with flow cytometry and flow organellometry, and Paul Mola for help with quantitative RT-PCR. CpG and control ODN were a generous gift from Coley Pharmaceutical Group.


   Footnotes
 
1 This work was supported by National Institutes of Health Grants AI34343, AI35726, and AI47255 (to C.V.H.), HL55967 and AI27243 (to W.H.B.), and the Tuberculosis Research Unit (AI95383). Back

2 A.A.R.T. and N.S.P. contributed equally to this work. Back

3 C.V.H. and W.H.B. shared senior authorship. Back

4 Address correspondence and reprint requests to Dr. Clifford V. Harding, Department of Pathology, BRB 925, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106-4943. E-mail address: cvh3{at}po.cwru.edu Back

5 Abbreviations used in this paper: PAMP, pathogen-associated molecular pattern; TLR, Toll-like receptor; MTB, Mycobacterium tuberculosis; MHC-I, class I MHC; MHC-II, class II MHC; MyD88, myeloid differentiation factor 88; LAMP-1, lysosome-associated membrane protein-1; ODN, oligodeoxynucleotide; MFV, mean fluorescence value; MOI, multiplicity of infection; BCG, bacillus Calmette-Guérin. Back

Received for publication November 22, 2002. Accepted for publication May 13, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Medzhitov, R., P. Preston-Hurlburt, C. A. Janeway, Jr.. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388:394.[Medline]
  2. Aderem, A., R. J. Ulevitch. 2000. Toll-like receptors in the induction of the innate immune response. Nature 406:782.[Medline]
  3. Cella, M., A. Engering, V. Pinet, J. Pieters, A. Lanzavecchia. 1997. Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 388:782.[Medline]
  4. Askew, D., R. S. Chu, A. M. Krieg, C. V. Harding. 2000. CpG DNA induces maturation of dendritic cells with distinct effects on nascent and recycling MHC-II antigen processing mechanisms. J. Immunol. 165:6889.[Abstract/Free Full Text]
  5. Chu, R. S., D. Askew, E. H. Noss, A. Tobian, A. M. Krieg, C. V. Harding. 1999. CpG oligodeoxynucleotides down-regulate macrophage class II MHC antigen processing. J. Immunol. 163:1188.[Abstract/Free Full Text]
  6. Noss, E. H., R. K. Pai, T. J. Sellati, J. D. Radolf, J. Belisle, D. T. Golenbock, W. H. Boom, C. V. Harding. 2001. Toll-like receptor 2-dependent inhibition of macrophage class II MHC expression and antigen processing by 19 kDa lipoprotein of Mycobacterium tuberculosis. J. Immunol. 167:910.[Abstract/Free Full Text]
  7. Mogues, T., M. E. Goodrich, L. Ryan, R. LaCourse, R. J. North. 2001. The relative importance of T cell subsets in immunity and immunopathology of airborne Mycobacterium tuberculosis infection in mice. J. Exp. Med. 193:271.[Abstract/Free Full Text]
  8. Muller, I., S. P. Cobbold, H. Waldmann, S. H. Kaufmann. 1987. Impaired resistance to Mycobacterium tuberculosis infection after selective in vivo depletion of L3T4+ and Lyt-2+ T cells. Infect. Immun. 55:2037.[Abstract/Free Full Text]
  9. Noss, E. H., C. V. Harding, W. H. Boom. 2000. Mycobacterium tuberculosis inhibits MHC class II antigen processing in murine bone marrow macrophages. Cell. Immunol. 201:63.[Medline]
  10. Hmama, Z., R. Gabathuler, W. A. Jefferies, G. de Jong, N. E. Reiner. 1998. Attenuation of HLA-DR expression by mononuclear phagocytes infected with Mycobacterium tuberculosis is related to intracellular sequestration of immature class II heterodimers. J. Immunol. 161:4882.[Abstract/Free Full Text]
  11. Lewinsohn, D. M., A. L. Briden, S. G. Reed, K. H. Grabstein, M. R. Alderson. 2000. Mycobacterium tuberculosis-reactive CD8+ T lymphocytes: the relative contribution of classical versus nonclassical HLA restriction. J. Immunol. 165:925.[Abstract/Free Full Text]
  12. Silva, C. L., D. B. Lowrie. 2000. Identification and characterization of murine cytotoxic T cells that kill Mycobacterium tuberculosis. Infect. Immun. 68:3269.[Abstract/Free Full Text]
  13. Cho, S., V. Mehra, S. Thoma-Uszynski, S. Stenger, N. Serbina, R. J. Mazzaccaro, J. L. Flynn, P. F. Barnes, S. Southwood, E. Celis, et al 2000. Antimicrobial activity of MHC class I-restricted CD8+ T cells in human tuberculosis. Proc. Natl. Acad. Sci. USA 97:12210.[Abstract/Free Full Text]
  14. Lewinsohn, D. M., L. Zhu, V. J. Madison, D. C. Dillon, S. P. Fling, S. G. Reed, K. H. Grabstein, M. R. Alderson. 2001. Classically restricted human CD8+ T lymphocytes derived from Mycobacterium tuberculosis-infected cells: definition of antigenic specificity. J. Immunol. 166:439.[Abstract/Free Full Text]
  15. Tan, J. S., D. H. Canaday, W. H. Boom, K. N. Balaji, S. K. Schwander, E. A. Rich. 1997. Human alveolar T lymphocyte responses to Mycobacterium tuberculosis antigens: role for CD4+ and CD8+ cytotoxic T cells and relative resistance of alveolar macrophages to lysis. J. Immunol. 159:290.[Abstract]
  16. Feng, C. G., A. G. Bean, H. Hooi, H. Briscoe, W. J. Britton. 1999. Increase in {gamma} interferon-secreting CD8+, as well as CD4+, T cells in lungs following aerosol infection with Mycobacterium tuberculosis. Infect. Immun. 67:3242.[Abstract/Free Full Text]
  17. Serbina, N. V., C. C. Liu, C. A. Scanga, J. L. Flynn. 2000. CD8+ CTL from lungs of mycobacterium tuberculosis-infected mice express perforin in vivo and lyse infected macrophages. J. Immunol. 165:353.[Abstract/Free Full Text]
  18. Serbina, N. V., J. L. Flynn. 2001. CD8+ T cells participate in the memory immune response to Mycobacterium tuberculosis. Infect. Immun. 69:4320.[Abstract/Free Full Text]
  19. Rolph, M. S., B. Raupach, H. H. Kobernick, H. L. Collins, B. Perarnau, F. A. Lemonnier, S. H. Kaufmann. 2001. MHC class Ia-restricted T cells partially account for {beta}2-microglobulin-dependent resistance to Mycobacterium tuberculosis. Eur. J. Immunol. 31:1944.[Medline]
  20. Flynn, J. L., M. M. Goldstein, K. J. Triebold, B. Koller, B. R. Bloom. 1992. Major histocompatibility complex class I-restricted T cells are required for resistance to Mycobacterium tuberculosis infection. Proc. Natl. Acad. Sci. USA 89:12013.[Abstract/Free Full Text]
  21. Sousa, A. O., R. J. Mazzaccaro, R. G. Russell, F. K. Lee, O. C. Turner, S. Hong, L. Van Kaer, B. R. Bloom. 2000. Relative contributions of distinct MHC class I-dependent cell populations in protection to tuberculosis infection in mice. Proc. Natl. Acad. Sci. USA 97:4204.[Abstract/Free Full Text]
  22. Canaday, D. H., C. Ziebold, E. Noss, K. Chervenak, C. V. Harding, W. H. Boom. 1999. Activation of human CD8+ {alpha}{beta} TCR+ cells by Mycobacterium tuberculosis via an alternate class I MHC antigen-processing pathway. J. Immunol. 162:372.[Abstract/Free Full Text]
  23. Lewinsohn, D. M., M. R. Alderson, A. L. Briden, S. R. Riddell, S. G. Reed, K. H. Grabstein. 1998. Characterization of human CD8+ T cells reactive with Mycobacterium tuberculosis-infected antigen-presenting cells. J. Exp. Med. 187:1633.[Abstract/Free Full Text]
  24. Pfeifer, J. D., M. J. Wick, R. L. Roberts, K. F. Findlay, S. J. Normark, C. V. Harding. 1993. Phagocytic processing of bacterial antigens for class I MHC presentation to T cells. Nature 361:359.[Medline]
  25. Harding, C. V., R. Song. 1994. Phagocytic processing of exogenous particulate antigens by macrophages for presentation by class I MHC molecules. J. Immunol. 53:4925.
  26. Song, R., C. V. Harding. 1996. Roles of proteasomes, TAP and {beta}2-microglobulin in the processing of bacterial or particulate antigens via an alternate class I MHC processing pathway. J. Immunol. 156:4182.[Abstract]
  27. Takeuchi, O., K. Hoshino, T. Kawai, H. Sanjo, H. Takada, T. Ogawa, K. Takeda, S. Akira. 1999. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity 11:443.[Medline]
  28. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL- 18-mediated function. Immunity 9:143.[Medline]
  29. Sklar, M. D., A. Tereba, B. D. Chen, W. S. Walker. 1985. Transformation of mouse bone marrow cells by transfection with a human oncogene related to c-myc is associated with the endogenous production of macrophage colony stimulating factor 1. J. Cell. Physiol. 125:403.[Medline]
  30. Harding, C. V.. 1992. Electroporation of exogenous antigen into the cytosol for antigen processing and class I major histocompatibility complex (MHC) presentation: weak base amines and hypothermia (18°C) inhibit the class I MHC processing pathway. Eur. J. Immunol. 22:1865.[Medline]
  31. Neufert, C., R. K. Pai, E. H. Noss, M. Berger, W. H. Boom, C. V. Harding. 2001. Mycobacterium tuberculosis 19 kD lipoprotein promotes neutrophil activation. J. Immunol. 167:1542.[Abstract/Free Full Text]
  32. Havlir, D. V., R. S. Wallis, W. H. Boom, T. M. Daniel, K. Chervenak, J. J. Ellner. 1991. Human immune responses to Mycobacterium tuberculosis antigens. Infect. Immun. 59:665.[Abstract/Free Full Text]
  33. Ahmed, S. A., R. M. Gogal, Jr., J. E. Walsh. 1994. A new rapid, and simple non-radioactive assay to monitor and determine the proliferation of lymphocytes: an alternative to [3H]thymidine incorporation assay. J. Immunol. Methods 170:211.[Medline]
  34. Potter, N. S., C. V. Harding. 2001. Neutrophils process exogenous bacteria via an alternate class I MHC processing pathway for presentation of peptides to T lymphocytes. J. Immunol. 167:2538.[Abstract/Free Full Text]
  35. Simpson, D. A., S. Feeney, C. Boyle, A. W. Stitt. 2000. Retinal VEGF mRNA measured by SYBR green I fluorescence: a versatile approach to quantitative PCR. Mol. Vis. 6:178.[Medline]
  36. Ramachandra, L., R. M. Sramkoski, D. H. Canaday, W. H. Boom, C. V. Harding. 1998. Flow analysis of MHC molecules and other membrane proteins in isolated phagosomes. J. Immunol. Methods 213:53.[Medline]
  37. Ramachandra, L., R. Song, C. V. Harding. 1999. Phagosomes are fully competent antigen processing organelles that mediate the formation of peptide:class II MHC complexes. J. Immunol. 162:3263.[Abstract/Free Full Text]
  38. Means, T. K., S. Wang, E. Lien, A. Yoshimura, D. T. Golenbock, M. J. Fenton. 1999. Human Toll-like receptors mediate cellular activation by Mycobacterium tuberculosis. J. Immunol. 163:3920.[Abstract/Free Full Text]
  39. Aliprantis, A. O., R. B. Yang, M. R. Mark, S. Suggett, B. Devaux, J. D. Radolf, G. R. Klimpel, P. Godowski, A. Zychlinsky. 1999. Cell activation and apoptosis by bacterial lipoproteins through Toll-like receptor-2. Science 285:736.[Abstract/Free Full Text]
  40. Brightbill, H. D., D. H. Libraty, S. R. Krutzik, R. B. Yang, J. T. Belisle, J. R. Bleharski, M. Maitland, M. V. Norgard, S. E. Plevy, S. T. Smale, et al 1999. Host defense mechanisms triggered by microbial lipoproteins through Toll-like receptors. Science 285:732.[Abstract/Free Full Text]
  41. Yeremeev, V. V., G. R. Stewart, O. Neyrolles, K. Skrabal, V. G. Avdienko, A. S. Apt, D. B. Young. 2000. Deletion of the 19 kDa antigen does not alter the protective efficacy of BCG. Tuber. Lung Dis. 80:243.[Medline]
  42. Clemens, D. L., M. A. Horwitz. 1995. Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J. Exp. Med. 181:257.[Abstract/Free Full Text]
  43. Clemens, D. L., M. A. Horwitz. 1996. The Mycobacterium tuberculosis phagosome interacts with early endosomes and is accessible to exogenously administered transferrin. J. Exp. Med. 184:1349.[Abstract/Free Full Text]
  44. Clemens, D. L., B. Y. Lee, M. A. Horwitz. 2000. Deviant expression of Rab5 on phagosomes containing the intracellular pathogens Mycobacterium tuberculosis and Legionella pneumophila is associated with altered phagosomal fate. Infect. Immun. 68:2671.[Abstract/Free Full Text]
  45. Via, L. E., D. Deretic, R. J. Ulmer, N. S. Hibler, L. A. Huber, V. Deretic. 1997. Arrest of mycobacterial phagosome maturation is caused by a block in vesicle fusion between stages controlled by rab5 and rab7. J. Biol. Chem. 272:13326.[Abstract/Free Full Text]
  46. Ullrich, H. J., W. L. Beatty, D. G. Russell. 2000. Interaction of Mycobacterium avium-containing phagosomes with the antigen presentation pathway. J. Immunol. 165:6073.[Abstract/Free Full Text]
  47. Ullrich, H. J., W. L. Beatty, D. G. Russell. 1999. Direct delivery of procathepsin D to phagosomes: implications for phagosome biogenesis and parasitism by Mycobacterium. Eur. J. Cell Biol. 78:739.[Medline]
  48. Malik, Z. A., G. M. Denning, D. J. Kusner. 2000. Inhibition of Ca2+ signaling by Mycobacterium tuberculosis is associated with reduced phagosome-lysosome fusion and increased survival within human macrophages. J. Exp. Med. 191:287.[Abstract/Free Full Text]
  49. Serbina, N. V., V. Lazarevic, J. L. Flynn. 2001. CD4+ T cells are required for the development of cytotoxic CD8+ T cells during Mycobacterium tuberculosis infection. J. Immunol. 167:6991.[Abstract/Free Full Text]
  50. Song, R., A. Porgador, C. V. Harding. 1999. Peptide-receptive class I major histocompatibility complex molecules on TAP-deficient and wild-type cells and their roles in the processing of exogenous antigens. Immunology 97:316.[Medline]
  51. Ting, L. M., A. C. Kim, A. Cattamanchi, J. D. Ernst. 1999. Mycobacterium tuberculosis inhibits IFN-{gamma} transcriptional responses without inhibiting activation of STAT1. J. Immunol. 163:3898.[Abstract/Free Full Text]