|
|
||||||||



* Emory Vaccine Research Center,
Microchemical Facility, and
Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, GA 30322
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recent studies have demonstrated that HLA-E is the primary, and perhaps exclusive, ligand for heterodimeric CD94/NKG2 receptors expressed on NK cells and a subset of T cells (6, 7, 10). CD94 can pair with several different isoforms of NKG2 to form receptors with the potential to either inhibit (NKG2A) or promote (NKG2C) cellular activation (11, 12, 13). The inhibitory receptor CD94/NKG2A is the dominant isoform expressed on NK cells, and a number of studies have demonstrated that NK cytotoxicity can be inhibited by interaction of this receptor with HLA-E on target cells (6, 7, 10, 14). This inhibitory receptor therefore provides a mechanism for recognition of missing self, in which self in this case is defined by expression of HLA-E (15, 16). Several studies have provided evidence that recognition by CD94/NKG2 is sensitive to the sequence of peptide bound to HLA-E; thus, peptide replacement in HLA-E provides a potential mechanism to sensitize cells for NK killing (10, 14, 17, 18, 19). In addition, it has been demonstrated that human CMV has the potential to use a decoy for CD94/NKG2, by providing an appropriate HLA-E peptide ligand that can be loaded through a TAP-independent pathway (20, 21). The CD94/NKG2-class Ib recognition system appears to have an ancient origin in evolution, because a homologous system is present in rodents. Murine CD94/NKG2 receptors recognize the mouse class Ib molecule Qa-1, which is not a clear ortholog of HLA-E based on overall amino acid sequence comparison (22, 23, 24). Nevertheless, Qa-1 selectively binds class Ia leader sequence-derived peptides with sequences similar to the known HLA-E-binding peptides (25, 26).
In addition to serving as a ligand for CD94/NKG2, there is evidence for TCR-mediated recognition of HLA-E (27, 28, 29, 30, 31, 32). Thus, HLA-E may also function as a restricting element for conventional or regulatory CD8+ T cells. The crystal structure of HLA-E bound to a class Ia leader sequence-derived peptide provided a structural explanation for the restricted peptide-loading specificity of HLA-E (33). It is possible that the intracellular loading pathway and the abundance of class Ia leader peptides also act to limit the diversity of peptides presented by HLA-E under physiological conditions. Very little information is currently available on the extent to which HLA-E is capable of binding and presenting peptides derived from sources other than class Ia leader sequences (14, 34). In the present study, we addressed this issue by analyzing the peptide-binding specificity of HLA-E using an approach based on in vitro folding of HLA-E complexes in the presence of limited peptide libraries selectively randomized at specific anchor positions. In addition, we demonstrate that lysine substitutions at P5 or P8 in HLA-E-bound peptide prevent binding to CD94/NKG2, suggesting that these positions serve as receptor contact residues.
| Materials and Methods |
|---|
|
|
|---|
Peptides used in binding assays and for HLA-E tetramers were synthesized by 9-fluorenylmethyloxycarbonyl (F-moc) chemistry peptide on a Ranin Symphony peptide synthesizer. Biotinylation of Qa-1 determinant modifier (Qdm)3 peptides and assembly of randomized peptide pools were performed, as previously described (26).
Purification of HLA-E and Qa-1b inclusion bodies
To increase HLA-E expression in BL21 DE3 cells, the GC content in the 5' region of HLA-E was reduced without changing the amino acid sequence. Using the following 5' primer, GGAATTCCATATGGGCTCACACTCCTTGAAGTATTTCCACACTTCCGTGTCACGTCCAGGTCGTGGTGAACCACGTTTCATCTCTGTGGGCTAC, the soluble region of HLA-E*0103 was subcloned into a pET23a vector (Novagen, Madison, WI) and fused to a 3' biotinylation signal peptide to form pHLA-E Delux (35). Removal of 5' GC content resulted in a 100-fold increase in protein expression (data not shown). Inclusion bodies were prepared, as previously described (35). Briefly, BL21 DE3 bacteria transformed with pHLA-E Delux were grown in Luria-Bertani medium at 37°C until the cultures reached an OD of 0.6 absorbance units at 600 nm. At this point, isopropyl
-D-thiogalactoside was added to a 1 mM final concentration and the cultures were incubated for additional 4 h at 37°C. Harvested bacteria was lysed using a 550 sonic dismembrator (Fisher, Pittsburgh, PA), and inclusion bodies were prepared by washing bacterial lysates with a Triton X-100 solution. Purified inclusion bodies were solubilized in 8 M urea and stored at -80°C until further use. Qa-1b inclusion bodies were purified similarly.
Folding Qa-1b and HLA-E and the formation of MHC tetramers
HLA-E and Qa-1b were folded in vitro, as previously described (35). Briefly, MHC H chain,
2-microglobulin (
2m), and peptide were injected into L-arginine folding buffer (200 mM L-arginine, 100 mM Tris, pH 8.3, 2 mM EDTA, 5 mM reduced glutathione, and 0.5 mM oxidized glutathione) and incubated at 10°C for 2 days. The concentrated folding reaction was purified by size exclusion chromatography using a S300 column (Pharmacia, Peapack, NJ). Monomers to be used as tetramers were biotinylated overnight using BIR A enzyme. All complexes were further purified by anion exchange using a monoQ column (Pharmacia). Biotinylated MHC monomers were labeled using PE-conjugated streptavidin (Molecular Probes, Portland, OR).
Peptide-binding immunoassay
Peptide-binding assays were performed, as previously described (36). In brief, folded MHC molecules (30 nM) were incubated overnight at room temperature with biotin-Qdm4C (0.2 µM) and dilutions of competitor peptide in pH 5.5 binding buffer (0.01% Nonidet P-40, 10 nM citrate-phosphate buffer, and protease inhibitor cocktail (Roche, Nutley, NJ)). MHC complexes were pH neutralized and captured in anti-
2m mAb (Immunotech, Westbrook, ME)-coated wells. The amount of biotin-Qdm4C bound to MHC was determined by adding europium-labeled streptavidin (Wallac Oy, acquired by PE Life Sciences, Boston, MA) to each sample well, measuring the fluorescence intensity at 615 nm using a 1230 ARCUS time-resolved fluorometer (LKB Wallac, Boston, MA).
Sequencing of peptides eluted from HLA-E
Elution of peptides from folded HLA-E was performed, as previously described (26). Briefly, HLA-E was folded in vitro, as described above, using peptide pools randomized at a single position. Peptides were eluted from purified MHC molecules under acidic conditions (0.1% trifluoroacetic acid, 10% CH3CN), purified from proteins using a 5 Kd Ultrafree-15 centrifugal filter device (Millipore, Bedford, MA), and concentrated using a speed vac (Labconco, Kansas City, MO). Samples were sequenced by Edman degradation using a Procise cLC peptide sequencer (PE Biosystems, Foster City, CA) (37). HPLC purification and mass spectrometry were performed, as previously described (26).
Staining primary cells with HLA-E tetramers
PBMC were isolated from Macaca mulatta and human peripheral blood using lymphocyte separation medium (Cellgro, Herndon, VA). Murine splenocytes were isolated from C57BL/6 mice by RBC lysis purification (Sigma-Aldrich, St. Louis, MO). All staining Abs were purchased from BD PharMingen (San Diego, CA), unless noted. Human and nonhuman primate samples were stained at room temperature with HLA-E tetramers and surface-staining mAbs in PBS containing 1% BSA. Human surface mAbs included anti-CD3 FITC, anti-CD8 PerCP, and anti-CD56 APC. Nonhuman primate surface stains included anti-CD16 FITC, anti-CD8 PerCP, and anti-CD3 APC. Murine samples were stained at 4°C using anti-DX-5 FITC, PE-labeled MHC tetramers, anti-CD8 PerCP, and anti-CD3 APC in PBS containing 1% BSA. All samples were fixed in PBS containing 1% paraformaldehyde and analyzed by flow cytometry using a FACSCalibur cytometer (BD Biosciences, San Jose, CA) and FlowJo data analysis software (Treestar, San Carlos, CA).
| Results |
|---|
|
|
|---|
|
An approach based on in vitro folding of HLA-E with various peptide libraries was used to characterize the peptide-binding motif of this protein. Several attempts were made to fold HLA-E with a fully random nonameric peptide library. Whereas high yields were obtained in folding reactions with the mouse leader peptide Qdm, little or no folded HLA-E was obtained with high concentrations (100 µM) of the fully random peptide library (Fig. 2). The concentration of peptides in the library with an appropriate peptide-binding motif was apparently too low to support efficient refolding. Therefore, to determine the amino acid preferences at each anchor position, we refolded HLA-E H chain and
2m with separate libraries of the Qdm peptide (AMAPRTLLL) randomized selectively at P2, P3, P6, P7, or P9. Randomized peptide libraries displayed an equal representation of each naturally occurring amino acid with the exception of cysteine, which was omitted from the peptide synthesis to prevent cross-linking. Refolded HLA-E-peptide complexes were isolated by size exclusion chromatography (Fig. 2) and further purified by anion exchange chromatography. Peptides from purified HLA-E complexes were eluted under acidic conditions and subjected to mass spectrometry and Edman degradation to determine amino acid preferences and percentages at each anchor position, respectively (Table I).
|
|
The crystal structure of HLA-E complexed with a nonamer peptide (VMAPRTVLL) demonstrates two conformations for the P5 Arg side chain: completely solvent exposed or bound to the negatively charged Glu152 residue on the
2 helix (33). To determine whether interactions between the P5 side chain and the
2 helix confer a preference for specific amino acids at P5, we refolded HLA-E with a Qdm peptide library randomized at P5. Peptides eluted from HLA-E folded with P5-randomized peptides showed a preference for positively charged amino acids Arg (43%) and Lys (19%) (Table I), suggesting that a salt bridge formed between these residues and the negatively charged Glu152 residue of HLA-E confers selectivity for positively charged amino acids at P5 (33). Overall, our findings demonstrate a remarkable preference for the amino acid residues naturally present in MHC class Ia leader peptides (shown in bold in Table I) at the positions analyzed, indicating that these leader peptides have optimal sequences for binding HLA-E and suggesting that peptide-binding specificity is relatively constrained as compared with class Ia molecules. Nevertheless, it is clear that peptides with alternative amino acids at various positions can bind HLA-E.
Because P1, P4, P5, and P8 do not serve as anchor residues, we sought to determine whether these positions function as contact residues for interaction with CD94/NKG2 receptors. HLA-E tetramers were generated with the HLA-A2 leader peptide (VMAPRTLVL) containing lysine substitutions at P1 (A1K), P4 (P4K), P5 (R5K), or P8 (V8K). By means of biochemical analysis, each of these HLA-E tetramers folded equivalently (data not shown). Saturating tetramer-staining conditions were determined by titrating each HLA-E tetramer (data not shown). HLA-E/A1K and HLA-E/P4K tetramers bound a similar percentage of CD56+/CD3- PBMC as compared with the control tetramers, bearing the wild-type peptide (Fig. 3A). Together with data showing that P1 and P4 side chains minimally extend beyond the peptide-binding groove (33), this result implies that the P1 and P4 positions do not serve as contact residues. By contrast, no binding was observed with HLA-E/R5K tetramers and binding was substantially reduced with tetramers containing peptide with substitution at P8 (V8K). Thus, P5 and P8 amino acids serve as major contact residues for CD94/NKG2 receptors. The result with R5K is particularly striking given that this represents a conservative substitution with preservation of positive charge. The Arg at P5 is conserved in human class Ia leader sequences, but there is variation in the P8 residue, which contains hydrophobic amino acids, Leu, Ile, Val, or Phe. We tested whether four different MHC class I leader sequence peptides that differ at P8 amino acids could alter HLA-E binding to CD94/NKG2 receptors. HLA-E tetramers generated with each of the four peptides, VMAPRTLFL (LFL), VMAPRTLIL (LIL), VMAPRTLVL (LVL), and VMAPRTVLL (VLL), were observed to bind to human CD56+/CD3- cells (Fig. 3B). A slight, but consistent variation in binding was observed with the hierarchy LFL > LIL > LVL > VLL, consistent with the results of a previous study in which binding was measured by surface plasmon resonance (18). Thus, there is a strict requirement for Arg at P5, whereas various hydrophobic residues are tolerated at P8, conferring relatively subtle differences in receptor binding.
|
|
|
| Discussion |
|---|
|
|
|---|
Analysis of amino acid preferences at each anchor position (summarized in Fig. 5) demonstrated greatest selectivity for residues at positions 2 and 9, consistent with their assignment as primary anchor positions. The requirement at P9 appears to be particularly stringent, with almost exclusive preference of Leu at this position. Met is strongly preferred at P2, with secondary preference for Leu at this position. Replacement of Met with Leu at P2 reduced affinity only slightly in competition-binding experiments with HLA-E (data not shown), consistent with previous results (5). In some previous studies (10), but not others (6, 38), human class Ia leader sequence-derived peptides with Thr at P2 were observed to stabilize HLA-E. In the present study, there was no detectable selection of Thr in folding reactions with a mixture of peptides randomized selectively at P2. Our results also showed a considerable degree of selectivity for amino acids at P6 and P7, whereas P3 was more promiscuous. Thus, overall there is considerable selectivity at four of the five anchor positions in HLA-E.
Two distinct conformations were observed for the peptide position 5 Arg side chain in the two copies of the HLA-E complex present in the crystal structure by OCallaghan et al. (33). In one molecule, the side chain was fully exposed to solvent, extending directly out of the center of the peptide-binding groove. In the other molecule, this side chain was held down through a salt bridge to negatively charged Glu152 on the top surface of the HLA-E
2
helix. Our results demonstrate that there is a strong preference for positively charged residues at P5, with Arg favored over Lys. Thus, electrostatic interaction with Glu152 appears to promote the initial assembly of HLA-E-peptide complexes. The possibility that there may be significant preference for selected amino acids at other nonanchor positions remains to be fully explored. Stevens et al. (40) observed preference for hydrophobic amino acids at nonanchor positions 4 and 9 on analysis of peptides eluted from HLA-E folded in the presence of a fully random nonamer library. In the latter study, a preference for Leu at the major P9 anchor position was observed, but neither Met nor Leu was enriched at the P2 anchor position, and, in general, the degree of enrichment observed in Edman analysis of the pooled peptide eluate was rather subtle (40). Our own attempts to fold HLA-E with a fully randomized nonamer peptide library were unsuccessful, under the same conditions that were successful for the mouse class Ib molecule, Qa-1 (26). The efficiency of in vitro folding was probably hampered by a low abundance of peptides with sequences compatible with optimal binding to HLA-E.
A striking feature of the HLA-E peptide-binding motif analysis presented in this work is the observed preference for amino acids found in corresponding positions in class Ia leader peptides. The greatest selectivity is observed at the dominant anchor positions, Met at P2 and Leu at P9. These positions are invariant in HLA-E-binding class Ia leader peptides (5, 6, 7, 10, 17). Invariant residues Ala at P3, Arg at P5, and Thr at P6 are strongly selected in in vitro folding experiments. Leu and Val are present at the P7 position in class Ia leader sequences, and these amino acids were preferentially selected in our folding experiments. Thus, it appears that HLA-E has a highly selective peptide-binding motif that is optimized for binding class Ia leader peptides. Nevertheless, it is evident from our results that there is considerable promiscuity at the P3 position and that selected substitutions at other anchor positions are tolerated. The peptide-binding motif reported in this work may be useful in identifying candidate epitopes for HLA-E-restricted T cells. Such epitopes are of interest because they might represent universal T cell epitopes, given the low extent of polymorphism in HLA-E in the human population (2). A number of studies have reported TCR recognition of HLA-E, although peptide specificity has not been defined in most situations (27, 28, 29, 30, 32). Li et al. (31) reported the establishment of HLA-E-restricted CD8+ T cells generated by in vitro priming with peptides derived from TCR V
sequences containing Leu at major anchor positions P2 and P9. In addition, a peptide from human heat shock protein 60 was demonstrated to bind HLA-E (14). These peptides did not contain the preferred residues identified in the present study at the minor anchor positions. Two viral peptides that have sequences quite divergent from class Ia leader peptides have been identified that stabilize HLA-E (19, 34). The EBV-derived peptide BZLF-1 (SQAPLPCVL) contains Gln at the P2 major anchor position. Our results demonstrated preference for Gln, secondary only to Met and Leu, at the P2 position. Cys may be a preferred amino acid at the P7 position; Cys was not included in our peptide libraries to prevent oxidative cross-linking. Therefore, the BZLF-1 sequence diverges from motif identified in the present study only at the nonanchor P5 position and P6, because Pro was not selected at this position in our in vitro folding experiments. The influenza-derived peptide M5967K62 (ILGKVFTLT) diverges considerably from the motif identified in this study. In particular, Thr at P9 seems to violate a requirement for Leu at this position. It is possible that this peptide binds HLA-E with relatively low affinity, because quantitative binding analysis has yet to be performed. One must also consider the possibility that selectivity at a given anchor position may be influenced by the identity of amino acids at other positions, through effects on the conformation of bound peptide or HLA-E. In the present study, selectivity at specific positions was analyzed under conditions in which the sequence framework of the peptide was fixed. The impact of cooperative interactions between anchor residues will require further investigation.
The role of specific amino acid side chains in the HLA-E-bound peptide as contacts for interaction with CD94/NKG2 was also investigated using HLA-E tetramers generated with HLA-A2 leader peptides substituted with Lys at each of the nonanchor positions. Tetramers generated with peptides substituted at P5 or P8 were observed to have substantially reduced binding to human NK cells, whereas little or no effect was observed with substitutions at P1 or P4. Thus, the P5 and P8 side chains appear to be directly involved in the contact interface with CD94/NKG2 receptors. Several previous studies have provided evidence that the peptide bound to HLA-E influences recognition by CD94/NKG2 (10, 14, 17, 18). Llano et al. (17) reported that a leader peptide with Ala instead of the usual Thr at P6 stabilizes HLA-E, but the resulting complexes were poor ligands for the inhibitory receptor. Because the side chain of P6 is accommodated in a shallow pocket, this observation could be explained by direct recognition of Thr at position 6 by CD94/NKG2, or by an indirect effect on the conformation of the HLA-E complex. Borrego et al. (10) reported that the HLA-B27 leader sequence, containing Thr instead of Met at the major P2 anchor position, stabilizes HLA-E without inducing resistance to NK-mediated lysis. However, peptides with Thr at P2 have been reported to have very low affinity for HLA-E (6), and it is evident from the current study that Thr is not a preferred amino acid at this position. Thus, the reduced functional potency of the HLA-B27 leader peptide might be attributable to dissociation of the peptide from HLA-E during the cytotoxicity assay. Vales-Gomez et al. (18) used surface plasmon resonance to measure the binding of recombinant CD94/NKG2A and CD94/NKG2C to HLA-E complexes to various human leader sequence-derived peptides. For both inhibitory and activating isoforms, binding affinity was observed to be dependent on peptide sequence. Affinity was substantially reduced by substitution at the P3 (Glu) or P6 (Ala) minor anchor positions. In addition, lesser differences in affinity were observed to be dependent on polymorphisms in the peptide C-terminal residues, with the hierarchy LFL > LIL > VLL (18). In the present study, differences in staining of human NK cells with tetramerized HLA-E complexes were observed to consistently follow the hierarchy LFL > LIL > LVL > VLL.
A striking result was the observation that a conservative replacement of Arg with Lys at P5 in the leader peptide completely abrogated binding of tetramerized HLA-E complexes to human NK cells. This substitution had little effect on HLA-E-binding affinity; indeed, Lys was demonstrated to be a preferred amino acid at P5 for in vitro assembly of HLA-E complexes. It was recently demonstrated that a Val substitution at P5 abrogates CD94/NKG2-dependent inhibition of NK-killing assays (14). Thus, P5 Arg side chain appears to act as a dominant contact for interaction with CD94/NKG2 receptors. It remains to be determined whether CD94/NKG2 specificity recognized the conformer in which the P5 Arg side chain lies flat across the top surface of HLA-E, interacting with an acidic residue in the
2 helix, as opposed to the alternative conformation in which the side chain fully extends out of the HLA-E-binding groove (33). An appealing possibility is that electrostatic interactions involving P5 Arg and the
2 helix promote initial assembly of the HLA-E-peptide complex, and that subsequent CD94/NKG2 receptor binding is accompanied by a rearrangement in the conformation of the Arg side chain involving transfer of electrostatic interaction from HLA-E to CD94/NKG2.
The HLA-E peptide-binding motif determined in this study is remarkably similar to that previously obtained using a very similar experimental approach with the murine class Ib molecule Qa-1 (see Table I) (26). Qa-1 is the major, and possibly the exclusive, ligand for mouse CD94/NKG2 receptors (22), and thus it is the functional counterpart to HLA-E. The observation that humans and mice share CD94/NKG2 receptors and not other NK cell MHC receptors suggests that this NK recognition system arose before the divergence of primate and mouse ancestors (22, 23). However, Qa-1 and HLA-E are not recognizable orthologs at the level of overall amino acid sequence identity. There is greater sequence identity between HLA-E and other human class Ia molecules (
76%) than between HLA-E and Qa-1 (65%), and vice versa. However, in comparing the
1 and
2 domains, which form the peptide-binding groove, this distinction becomes less clear. The residues that form the F pocket, which accommodates the dominant anchor Leu residue at P9 (33), are nearly identical in HLA-E and Qa-1. However, there are substantial differences in the amino acids that form the other pockets in the peptide binding sites of these two class Ib molecules. Given our results showing substantial overlap in the specificity of HLA-E and Qa-1 at each anchor position, it appears that the general structure and chemical character of each pocket are conserved despite amino acid differences.
Given the high degree of conservation in the peptide-binding specificity of HLA-E and Qa-1, we were interested in determining whether there was similar conservation in the surface that interacts with CD94/NKG2 receptors. Using MHC tetramer staining as a measure of receptor binding, no cross-recognition was observed between human and mouse CD94/NKG2 receptors and species-mismatched MHC class Ib ligands. By contrast, cross-species compatibility was observed between rhesus macaque and humans, such that human HLA-E tetramers efficiently stained rhesus NK cells. Khakoo et al. (41, 42, 43) previously demonstrated that chimpanzee CD94/NKG2 interacts with human HLA-E, noting the high degree of structural conservation in CD94, NKG2, and MHC-E among primates. In contrast to CD94/NKG2 and MHC-E, killer cell Ig-like receptors and their MHC class Ia ligands have diverged considerably among primates (41, 44). It has been proposed that sequence similarity among HLA-E and E-like sequences, including Qa-1, has arisen through convergent evolution driven by strong positive selection (45). It is likely that CD94 and NKG2 family members derive from common ancestral genes that predate the divergence of mouse and human ancestors (23). The genes encoding these proteins are syntenic, clustered within the human NK complex on chromosome 12 and the mouse NK complex on chromosome 6, and the overall genomic organization is very similar (23, 46). Strong selective pressures appear to have been in play to maintain the peptide-binding specificity of HLA-E and E-like molecules to favor selective assembly with MHC class Ia leader sequence-derived peptides. Conversely, despite the rapid evolution and diversification of MHC class Ia sequences, the leader sequence is highly conserved in a subset of class Ia molecules, at least in mammals. The contact surfaces of CD94/NKG2 and E-like proteins have diversified to a greater extent, while maintaining complementarity within a given species. Thus, the maintenance of this ancient MHC recognition system must have involved coevolutionary forces acting to influence selected structural features of all three components, HLA-E and its functional counterparts, MHC class Ia signal sequences, and the CD94/NKG2 receptors.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Peter E. Jensen, Department of Pathology and Laboratory Medicine, Woodruff Memorial Building, Room 7313, Emory University School of Medicine, 1639 Pierce Drive, Atlanta, GA 30322. E-mail address: pjensen{at}emory.edu ![]()
3 Abbreviations used in this paper: Qdm, Qa-1 determinant modifier;
2m,
2-microglobulin. ![]()
Received for publication February 19, 2003. Accepted for publication June 6, 2003.
| References |
|---|
|
|
|---|
/
-mediated recognition. Eur. J. Immunol. 31:3687.[Medline]
-specific CD8+ CTLs by TCR V
-derived peptides bound to HLA-E. J. Immunol. 167:3800.This article has been cited by other articles:
![]() |
A. Saez-Borderias, N. Romo, G. Magri, M. Guma, A. Angulo, and M. Lopez-Botet IL-12-Dependent Inducible Expression of the CD94/NKG2A Inhibitory Receptor Regulates CD94/NKG2C+ NK Cell Function J. Immunol., January 15, 2009; 182(2): 829 - 836. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Kaiser, J. C. Pizarro, J. Kerns, and R. K. Strong Structural basis for NKG2A/CD94 recognition of HLA-E PNAS, May 6, 2008; 105(18): 6696 - 6701. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Petrie, C. S. Clements, J. Lin, L. C. Sullivan, D. Johnson, T. Huyton, A. Heroux, H. L. Hoare, T. Beddoe, H. H. Reid, et al. CD94-NKG2A recognition of human leukocyte antigen (HLA)-E bound to an HLA class I leader sequence J. Exp. Med., March 17, 2008; 205(3): 725 - 735. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Derre, M. Corvaisier, B. Charreau, A. Moreau, E. Godefroy, A. Moreau-Aubry, F. Jotereau, and N. Gervois Expression and Release of HLA-E by Melanoma Cells and Melanocytes: Potential Impact on the Response of Cytotoxic Effector Cells. J. Immunol., September 1, 2006; 177(5): 3100 - 3107. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Betser-Cohen, G. Katz, T. Gonen-Gross, N. Stern, T. I. Arnon, H. Achdout, R. Gazit, and O. Mandelboim Reduced KIR2DL1 Recognition of MHC Class I Molecules Presenting Phosphorylated Peptides. J. Immunol., June 1, 2006; 176(11): 6762 - 6769. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Tennakoon, R. S. Mehta, S. B. Ortega, V. Bhoj, M. K. Racke, and N. J. Karandikar Therapeutic Induction of Regulatory, Cytotoxic CD8+ T Cells in Multiple Sclerosis. J. Immunol., June 1, 2006; 176(11): 7119 - 7129. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Barel, N. Pizzato, P. Le Bouteiller, E. J. H. J. Wiertz, and F. Lenfant Subtle sequence variation among MHC class I locus products greatly influences sensitivity to HCMV US2- and US11-mediated degradation Int. Immunol., January 1, 2006; 18(1): 173 - 182. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Wooden, S. R. Kalb, R. J. Cotter, and M. J. Soloski Cutting Edge: HLA-E Binds a Peptide Derived from the ATP-Binding Cassette Transporter Multidrug Resistance-Associated Protein 7 aSnd Inhibits NK Cell-Mediated Lysis J. Immunol., August 1, 2005; 175(3): 1383 - 1387. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Kaiser, F. Barahmand-pour, W. Paulsene, S. Medley, D. E. Geraghty, and R. K. Strong Interactions between NKG2x Immunoreceptors and HLA-E Ligands Display Overlapping Affinities and Thermodynamics J. Immunol., March 1, 2005; 174(5): 2878 - 2884. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nattermann, H. D. Nischalke, V. Hofmeister, G. Ahlenstiel, H. Zimmermann, L. Leifeld, E. H. Weiss, T. Sauerbruch, and U. Spengler The HLA-A2 Restricted T Cell Epitope HCV Core35-44 Stabilizes HLA-E Expression and Inhibits Cytolysis Mediated by Natural Killer Cells Am. J. Pathol., February 1, 2005; 166(2): 443 - 453. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |