|
|
||||||||

* Institute of Medical Microbiology and Immunology, University of Ulm, Ulm, Germany; and
Bavarian-Nordic GmbH, Copenhagen, Denmark
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
With the availability of the complete sequence of the genomes of many major pathogens, the choice of Ags (and their immunogenic epitopes) has been strikingly expanded. Vaccines incorporating multiple, antigenic peptides binding to either MHC class II molecules (stimulating CD4+ Th cell responses) or class I molecules (stimulating CD8+ CTL responses) are an attractive choice for stimulating cellular immunity (2). This can focus CTL responses to multiple target Ags and/or multiple epitopes of a target Ag, and can provide help for priming CTL responses by codelivering class II-restricted T cell effector functions. By eliminating suppressive or immunodominant epitopes and optimizing MHC binding affinity and TCR contact, the immunogenicity of such synthetic peptide vaccines can be increased considerably.
Multiepitope vaccines can be constructed as either a synthetic peptide vaccine or as a DNA vaccine (or an expression cassette cloned into the genome of a recombinant virus). If the length of the peptide is >5080 residues, the DNA-based approach is easier for vaccine designs, at least at the stage of experimental, preclinical vaccine designs. We therefore exploited the DNA vaccination approach to test in the mouse some aspects relevant for the design of optimal CTL-stimulating, multiepitope vaccines. Long peptides representing linear constructs of multiepitope or polytope vaccines have higher intrinsic immunogenicity than mixtures of individual peptides, although they require processing for acquiring T cell stimulatory potency (3, 4). Although combinations of epitopes can create new junctional epitopes (that are irrelevant for antipathogen immunity), their disruption by appropriate spacers between epitopes can solve this problem (4). Furthermore, the combination of a multitude of antigenic epitopes may establish novel immunodominance hierarchies that limit the immunogenicity of the subdominant epitopes. This can be overcome by codelivering an appropriate adjuvant (as shown in this report).
The N-terminal domain of the SV40 large tumor Ag (T-Ag)3 associates with the stress protein 73-kDa heat shock protein (hsp73) through a DnaJ-like structure, i.e., the J domain (5, 6, 7, 8, 9). T-Ag associates with hsp73 through the conserved HPD motif and the
-helical structure of the J domain. We have reported that different mutant T-Ags show stable association with hsp73 if their N terminus is intact (10, 11, 12, 13, 14). The N-terminal domain of T-Ag required for hsp73 association is located within the T77 (but not the T60) fragment that hence contains the intact J domain (15). From this observation we derived a vector system for the efficient expression of hsp73-associated, chimeric proteins (12, 13, 15, 16, 17). In this system the T-Ag-derived J domain is fused N-terminally to different sequences from heterologous viral Ags of different origins and lengths. This allowed us to design DNA vaccines that stably express chimeric, hsp73-binding proteins at a high level. In addition to enhancing expression, hsp70 molecules are innate adjuvants that enhance and modulate the immunogenicity of protein and peptide Ags (reviewed in Refs. 18, 19, 20). The adjuvant effect of hsp molecules seems to have many facets. Hsp induces the migration and maturation (including cytokine/chemokine release) of dendritic cells (DC) (21, 22, 23, 24, 25, 26, 27). Hsp facilitates the priming of CD8+ T cell responses to peptides from tumor Ags, minor H Ags, or viruses by delivering them to processing pathways for MHC class I-restricted presentation (26, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39). Hsp is thus an attractive innate adjuvant in vaccine formulations to enhance its immunogenicity for CTL. We compare the immunogenicity of multiepitope DNA vaccines for CD8+ T cells that express Ag associated or not associated with hsp73.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6J (B6) mice (H-2b), BALB/cJ mice (H-2d Ld+), BALB/cdm2 (dm2) mice (H-2d Ld-), F1 (BALB/c x C57BL/6) mice, and F1 (dm2 x C57BL/6) mice were bred and kept under standard pathogen-free conditions in the animal colony of Ulm University (Ulm, Germany). The H2dm2 strain has a deletion of
140 kb that encompasses D2d, D3d, D4d, and Ld; dm2 mice are congenic to BALB/c. Male female mice were used at 1216 wk of age.
Cells
The H-2d mastocytoma cell line P815 (TIB64) was obtained from American Tissue Culture Collection (Manassas, VA). The H-2b (B6-derived) T lymphoma cell line RBL5 was obtained from Dr. H.-U. Weltzien (Freiburg, Germany). The chicken hepatoma cell line LMH was obtained from Dr. H.-J. Schlicht (Ulm, Germany)
Vector constructs
The 106-residue murine polytope sequence (Fig. 1) was obtained from a pt10-encoding Bluescript construct with primers (GAATTCATATGTCTAGAGCCAGCAACGAGAACATG +; generating an EcoRI site) and (GGTACCTAAGTGCTCGGGGCCGGACAC-; generating a KpnI site) and was cloned directly into a pEGFP N1 (Clontech, Palo Alto, CA; catalogue no. 6085-1)-based mammalian pCMV expression vector, generating the plasmid pCMV/pt10. In this vector Ags are expressed under human CMV promoter/enhancer control. Construction of the vectors encoding the SV40 T-Ag derived T60 or T77 fragments (pBlue/T60 and pBlue/T77) has been described (12, 14, 15, 40). The T60- and T77-encoding sequences were cloned into the pCMV expression vector, generating plasmids pCMV/T77 and pCMV/T60. The pt-10-encoding EcoRI-KpnI fragment was cloned C-terminally (in-frame) into plasmids pCMV/T77 and pCMV/T60, generating plasmids pCMV/T77-pt10 and pCMV/T60-pt10, respectively.
|
LMH cells were transiently transfected with plasmid DNA using the Ca2PO4 method. Briefly, 10 µg of plasmid DNA was adjusted to 0.25 M CaCl2 in a volume of 500 µl and mixed with 500 µl of 2x HBS buffer (280 mM NaCl, 1.5 mM Na2HPO4, and 50 mM HEPES, pH 7.1). Semiconfluent cell monolayers were incubated with the DNA solution for 12 h. Cells were metabolically labeled for 1215 h with [35S]methionine 36 h after transfection, extracted with lysis buffer (120 mM NaCl, 1% aprotinin (Trasylol, Bayer, Leverkusen, Germany), leupeptin, 0.5% Nonidet P-40, and 50 mM Tris-hydrochloride (pH 8.0)) for 30 min at 4°C. Extracts were cleared by centrifugation and immunoprecipitated for T-Ag using the mAb PAB108 and protein A-Sepharose. Immune complexes bound to protein A-Sepharose were purified with wash buffer (300 mM LiCl, 1% Nonidet P-40, and 100 mM Tris-hydrochloride, pH 8.5), followed by two washes in PBS and 0.1x PBS. Immune complexes were recovered from protein A-Sepharose with elution buffer (1.5% SDS, 5% ME, and 7 mM Tris-hydrochloride, pH 6.8), processed for SDS-PAGE, and analyzed by fluorography.
DNA vaccination
For i.m. nucleic acid immunization, we injected 50 µl of PBS containing 1 µg/µl of plasmid DNA into each tibialis anterior muscle as previously described (12, 41). Intradermal injection of 2 µg of particle-coated DNA with the Helios Gene Gun system (catalogue no. 165-2431; Bio-Rad, Munich, Germany) has been described (14, 15), with the modification that immunization was performed with two shots of 300 psi.
Peptides
Synthetic peptides 1, 2, 3, 5, 6, 7, 8, and 10 listed in Fig. 1 were obtained from Jerini BioTools (Berlin, Germany). Peptides were dissolved in a DMSO stock solution at a concentration of 10 mg/ml and were diluted with culture medium before use.
Determination of splenic CD8+ T cell frequencies
Spleen cells (1 x 107/ml) were incubated for 1 h in RPMI 1640 medium with 0.1 µg/ml of the respective peptide. Thereafter, 5 µg/ml brefeldin A (BFA; Sigma-Aldrich, St. Louis, MO; catalogue no. 15870) was added, and the cultures were incubated for an additional 46 h. Cells were harvested and surface-stained with PE-conjugated anti-CD8 mAb (BD PharMingen, San Diego, CA; catalogue no. 01045B). Surface-stained cells were fixed with 2% paraformaldehyde in PBS before intracellular staining for IFN-
. Fixed cells were resuspended in permeabilization buffer (HBSS, 0.5% BSA, 0.5% saponin, and 0.05% sodium azide), incubated with FITC-conjugated anti-IFN-
mAb (BD PharMingen; catalogue no. 55441) for 30 min at room temperature, and washed twice in permeabilization buffer. Stained cells were resuspended in PBS/0.3% (w/v) BSA supplemented with 0.1% (w/v) sodium azide. We determined the frequencies of CD8+ IFN-
+ T cells by FCM analyses. The mean numbers of double-positive CD8+ IFN-
+ T cells/106 CD8+ spleen cells from three to six individual mice are shown.
| Results |
|---|
|
|
|---|
The plasmid pCMV/pt10 encodes 10 well-characterized epitopes binding to murine MHC class I molecules encoded by the K, D, or L locus of H-2d, H-2b, and H-2k haplotype mice. Fig. 1 lists these 10 epitopes, their amino acid sequences, the protein Ag and the pathogens from which they are derived, and the restricting MHC class I molecules that bind the epitope. The pt10 DNA vaccine has been shown to prime multispecific, murine CTL responses (42).
We injected 100 µg of pCMV/pt10 DNA i.m. into H-2b (C57BL/6, B6; Fig. 2A) or H-2d (BALB/c) mice (Fig. 2B). No booster injections were given. Spleen cells obtained from immunized mice 1215 days postvaccination were restimulated ex vivo for 5 h with antigenic peptides. The fraction of the splenic CD8+ T cells specifically inducible to IFN-
expression by stimulation with the respective epitope was determined by FCM. In B6 mice, readily detectable CD8+ T cell responses against the Db-restricted influenza epitope 1, the Kb-restricted OVA epitope 2, the Db-restricted adenovirus epitope 6, and the Kb-restricted Sendai virus epitope 7 were efficiently coprimed. As expected, H-2b mice did not generate CD8+ T cell responses against epitopes binding to H-2d class I molecules (Fig. 2A). Unexpectedly, priming of CD8+ T cell responses to the Kd-restricted influenza epitope 3 and the Ld-restricted CMV epitope 5 was low and inefficient in BALB/c mice (Fig. 2B). Only priming to the Kd-restricted malaria epitope 8 and the Ld-restricted lymphocytic choriomengitis virus epitope 10 was reproducibly detected (Fig. 2B). The pCMV/pt10 DNA vaccine thus efficiently primes CD8+ T cell responses in H-2b mice, but seems to be deficient in stimulating CD8+ T cell responses in H-2d mice.
|
We have reported that CD8+ T cell primed to the immunodominant, Ld-restricted HBsAg epitope suppresses copriming of CD8+ T cells to simultaneously presented Kd-, Dd-, and Kb-restricted HBsAg epitopes (17). We therefore tested whether the pt10 DNA vaccine can elicit CD8+ T cell responses to Kd-restricted epitopes 3 and 8 in Ld- BALB/c substrain dm2 mice. Priming of CD8+ T cell precursors to these two epitopes was strikingly enhanced in dm2 mice (i.e., under conditions where no Ld-restricted CD8+ T cell epitopes were presented; Fig. 2, compare C with B). Hence, priming Ld-restricted CD8+ T cells seems to down-regulate priming of CD8+ T cells to other epitopes of the construct, apparently regardless of their restriction or the nature of the epitope.
We immunized F1 (B6 x BALB/c) mice (Fig. 2D) to test whether the pt10 DNA vaccine can coprime multispecific, H-2b- and H-2d-restricted CD8+ T cell responses. Compared with vaccinated B6 mice, the H-2b-restricted CD8+ T cell responses to epitopes 1, 2, 6, and 7 were deficient in F1 (B6 x BALB/c) mice (Fig. 2, A and D). The H-2d-restricted CD8+ T cell responses against epitopes 3, 5, 8, and 10 primed in BALB/c and F1 (B6 x BALB/c) mice were comparable (Fig. 2, B and D). When Ld- F1 (B6 x dm2) mice were used instead of F1 (B6 x BALB/c) mice, efficient priming of CD8+ T cell responses to H-2b-restricted epitopes 1, 2, 6, and 7 and Kd-restricted epitopes 3 and 8 was observed (Fig. 2E). These data indicate that 1) the pt10 DNA vaccine can efficiently coprime multispecific CD8+ T cell responses restricted by at least four different MHC class I molecules; and 2) priming of Ld-restricted CD8+ T cell responses can down-regulate copriming of CD8+ T cells to epitopes restricted by unrelated MHC class I molecules.
Ld-restricted CD8+ T cell responses, not Ld surface expression, down-modulate copriming of CD8+ T cells restricted by unrelated MHC class I molecules
The Kb-restricted, OVA epitope 2 (SIINFEKL)-specific CD8+ T cell responses were efficiently elicited by the pCMV/OVA DNA vaccine (encoding the complete OVA sequence) in B6 mice, F1 (B6 x dm2) mice, and F1 (B6 x BALB/c) mice (Fig. 3A; groups ac). The pt10 DNA vaccine contains this Kb-restricted OVA epitope 2. CD8+ T cells specific for this epitope were efficiently primed by the pt10-encoding DNA vaccine in B6 and F1 (B6 x dm2) mice, but not in F1 (B6 x BALB/c) mice (Figs. 2 and 3B). Hence, copriming Ld-restricted CD8+ T cell responses against epitopes encoded by pt10 (see Fig. 2), but not the surface expression of Ld, down-modulates copriming of CD8+ T cell to other epitopes restricted by unrelated MHC class I molecules and present on the same antigenic construct.
|
The pt10 vaccine used primed some CD8+ T cell responses inefficiently. We tested whether alternative designs of the pt10 DNA vaccine enhance the efficiency of multispecific CD8+ T cells priming by this construct and can overcome the suppressive effect of Ld-restricted CD8+ T cell priming. We used an hsp73-mediated expression system (14, 15) by fusing the hsp73 binding SV40 T-Ag-derived DnaJ domain N-terminally in-frame to the polytope-encoding DNA sequence. The 106-residue-encoding pt10 sequence was fused C-terminally to the hsp73-binding, 77-residue, N-terminal T-Ag fragment, to generate the cT77-pt10 chimeric protein (Fig. 4). As a negative control, the T60 N terminus of the T-Ag that does not bind hsp73 (14, 15) was fused to the pt10 sequence to generate the non-hsp-binding fusion protein T60-pt10 (Fig. 4). The expression of the fusion proteins from the expression constructs pCMV/T77-pt10 and pCMV/T60-pt10 was tested after transient transfection of LMH (chicken hepatoma) cells. The mAb 108 (directed against the extreme N terminus of the T-Ag) was used for immunoprecipitation of chimeric Ags from the lysates of the transfectants. Subsequent SDS-PAGE analyses revealed efficient expression of the T77-pt10 fusion protein (Fig. 4). We barely detected the non-hsp-associated T60-pt10 fusion protein (Fig. 4), confirming our observation that stress protein-associated expression of the peptide was always higher than the expression of the corresponding non-hsp73-associated, chimeric proteins (14, 15). The hsp73 stress protein was coprecipitated with the fusion protein from transfected cells expressing peptides encoded by pCMV/T77-pt10, but not from transfected cells expressing peptide encoded by pCMV/T60-pt10 (Fig. 4). This confirms that the tight, noncovalent association between hsp73 and the viral DnaJ domain requires the intact 77-residue domain as described by us in other Ag systems (10, 11, 13, 15, 16). Hence, we have constructed DNA vaccines carrying the immunogenic pt10 domain, but differing in the level of expression and the association with hsp73.
|
F1 (B6 x BALB/c) mice were immunized by a single i.m. injection of the DNA vaccines pCMV/pt10 (Fig. 5; group a), pCMV/T77-pt10 (group b), and pCMV/T60-pt10 (group c). The primed CD8+ T cell responses were read out against the H-2b-restricted, pt10-encoded epitopes 1, 2, 6, and 7 (Fig. 5A) and against the H-2d-restricted epitopes 3, 5, 8, and 10 (Fig. 5B). The hsp73-associated expression of the polytope DNA vaccine (group b) was reproducibly superior to the non-hsp-associated expression of the same DNA vaccine (group c) in priming all multispecific CD8+ T cell responses tested. No reproducible differences in the relative efficacy of CD8+ T cell priming were detectable between vaccinations with the conventional pt10 vaccine (group a) and the pCMV/T60-pt10 vaccine (group c). The expression of antigenic domains in tight, noncovalent association with hsp73 thus enhances their immunogenicity for CD8+ T cells. Comparable CD8+ T cell responses to the different epitopes were primed in F1 (B6 x BALB/c) and F1 (B6 x dm2) mice (Fig. 6, compare groups b and c). Thus, priming to Ld-restricted epitopes by the pt10 vaccine, but not the T77-pt10 vaccine, down-modulated copriming to other CD8+ T cell responses.
|
|
-producing, pt10-specific CD8+ T cell responses was not detectable after injection of DNA vaccines encoding the non-hsp-binding pt10 (group a) or T60-pt10 construct (group c), they were readily detectable after intradermal injection of the hsp73-binding T77-pt10-encoding plasmid DNA with the gene gun (group b). The association of Ag with hsp73 thus strikingly enhances its immunogenicity for CD8+ T cell precursors, supporting CD8+ T cell priming even after intradermal delivery of low doses of DNA vaccines. Hence, a high level of Ag expression in association with hsp73 efficiently induces pt10-specific CD8+ T cell responses even under Ld-dependent immunodominance, thereby facilitating copriming of CD8+ T cell populations with a diverse repertoire.
|
| Discussion |
|---|
|
|
|---|
The use of the chimeric Ag certainly is not restricted to DNA vaccination, but preparative isolation of hsp73/chimeric protein complexes is a feasible option, as has been expertly demonstrated for hsp/peptide complexes (33, 46, 47, 48). In addition to facilitating expression, hsp binding offers other features that make it attractive as a vaccine. Hsp molecules of the hsp70 and hsp90 class are intrinsic adjuvants (as indicated above) and introduce cytosolic proteins into alternative processing pathways (10, 11). As different proteolytic systems seem to give rise to different, although overlapping, repertoires of antigenic epitopes (49), this means of expression can potentially extend the repertoire of immunogenic epitopes presented by an Ag.
We and others have described the immunodominance of the Ld-restricted CD8+ T cell response that interferes with the copriming of CD8+ T cells restricted by other MHC class I molecules in the HBsAg system (17, 50). These data are extended in this report. Two additional Ld-restricted epitopes from two unrelated viruses, i.e., murine CMV and lymphocytic choriomengitis virus, showed a similar immunodominance. This implies either that immunodominance is a property of Ld-restricted CD8+ T cell responses or that we detected by chance three independent examples of immunodominant Ld-restricted CD8+ T cell responses. Detailed analysis of Ld-restricted CD8+ T cell responses in other systems may provide an answer. The cellular and molecular mechanisms that mediates this suppression are unknown, but are under active study in our group. It can be overcome at least partially by supplying high doses of type I IFNs and/or IL-15 to the site where CD8+ T cell precursors are primed in situ (51). This suggests the involvement of a factor-mediated immunoregulation. Further studies are needed to elucidate this phenomenon.
We have previously described and reiterated above the potential advantages of delivery of hsp-bound Ag as vaccines. These include enhanced expression and facilitated expression of even large chimeric proteins (when used as a DNA vaccine), its facilitation of cross-priming, and its ability to introduce Ags into alternative processing pathways. The expression of the polytope vaccine as hsp-binding complexes not only enhanced its immunogenicity, but at least partially overcame the suppressive effect of Ld-dependent immunodominance. This may be related to the adjuvant effect of hsp, e.g., its cytokine-releasing effect. Taken together, these data support the idea that hsp-bound, large protein Ags produced in situ by DNA vaccines display exceptional immunogenicity and can escape suppressive immunoregulation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jörg Reimann, Institute for Medical Microbiology and Immunology, University of Ulm, Albert Einstein Allee 11, D-89081 Ulm, Germany. E-mail address: joerg.reimann{at}medizin.uni-ulm.de ![]()
3 Abbreviations used in this paper: T-Ag, large tumor Ag of SV40; B6, C57BL/6 inbred strain; BFA, brefeldin A; c, cytoplasmic; DC, dendritic cell; FCM, flow cytometry; hsp73, 73-kDa heat shock protein; pt10, polytope vaccine used in this study. ![]()
Received for publication March 6, 2003. Accepted for publication May 27, 2003.
| References |
|---|
|
|
|---|
and Th lymphocyte responses: evaluation of multiepitope polypeptides as a mode for vaccine delivery. J. Immunol. 168:6189.
B
through preventing I
B kinase activation in respiratory epithelial cells. J. Immunol. 164:5416.This article has been cited by other articles:
![]() |
P. Riedl, A. Wieland, K. Lamberth, S. Buus, F. Lemonnier, K. Reifenberg, J. Reimann, and R. Schirmbeck Elimination of Immunodominant Epitopes from Multispecific DNA-Based Vaccines Allows Induction of CD8 T Cells That Have a Striking Antiviral Potential J. Immunol., July 1, 2009; 183(1): 370 - 380. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Schirmbeck, P. Riedl, M. Kupferschmitt, U. Wegenka, H. Hauser, J. Rice, A. Kroger, and J. Reimann Priming Protective CD8 T Cell Immunity by DNA Vaccines Encoding Chimeric, Stress Protein-Capturing Tumor-Associated Antigen J. Immunol., August 1, 2006; 177(3): 1534 - 1542. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, X. Yang, Y. Jiang, and J. Liu A novel HBV DNA vaccine based on T cell epitopes and its potential therapeutic effect in HBV transgenic mice Int. Immunol., October 1, 2005; 17(10): 1293 - 1302. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Schirmbeck, P. Riedl, N. Fissolo, F. A. Lemonnier, A. Bertoletti, and J. Reimann Translation from Cryptic Reading Frames of DNA Vaccines Generates an Extended Repertoire of Immunogenic, MHC Class I-Restricted Epitopes J. Immunol., April 15, 2005; 174(8): 4647 - 4656. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |