The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schirmbeck, R.
Right arrow Articles by Reimann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schirmbeck, R.
Right arrow Articles by Reimann, J.
The Journal of Immunology, 2003, 171: 1240-1246.
Copyright © 2003 by The American Association of Immunologists

Enhanced Priming of Multispecific, Murine CD8+ T Cell Responses by DNA Vaccines Expressing Stress Protein-Binding Polytope Peptides1

Reinhold Schirmbeck*, Nicolas Fissolo*, Paul Chaplin{dagger} and Jörg Reimann2,*

* Institute of Medical Microbiology and Immunology, University of Ulm, Ulm, Germany; and {dagger} Bavarian-Nordic GmbH, Copenhagen, Denmark


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A polytope DNA vaccine (pCI/pt10) was used that encodes within a 106-residue sequence 10-well characterized epitopes binding MHC class I molecules encoded by the K, D, or L locus (of H-2d, H-2b, and H-2k haplotype mice). The pCI/pt10 DNA vaccine efficiently primed all four Kb/Db-restricted CD8+ T cell responses in H-2b mice, but was deficient in stimulating most CD8+ T cell responses in H-2d mice. Comparing CD8+ T cell responses elicited with the pCI/pt10 DNA vaccine in Ld+ BALB/c and Ld- BALB/cdm2 (dm2) mice revealed that Ld-restricted CD8+ T cell responses down-regulated copriming of CD8+ T cell responses to other epitopes regardless of their restriction or epitope specificity. Although the pt10 vaccine could thus efficiently co prime multispecific CD8+ T cell responses, this priming was impaired by copriming Ld-restricted CD8+ T cell responses. When the pt10 sequence was fused to a 77-residue DnaJ-homologous, heat shock protein 73-binding domain (to generate a 183-residue cT77-pt10 fusion protein), expression and immunogenicity (for CD8+ T cells) of the chimeric Ag were greatly enhanced. Furthermore, priming of multispecific CD8+ T cell responses was readily elicited even under conditions in which the suppressive, Ld-dependent immunodominance operated. The expression of polytope vaccines as chimeric peptides that endogenously capture stress proteins during in situ production thus facilitates copriming of CD8+ T cell populations with a diverse repertoire.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The efficient and specific stimulation of T cell responses is a priority in current vaccine research. Solutions to many unresolved problems of vaccine development against human diseases such as AIDS, tuberculosis, papilloma and herpes virus infection, chronic hepatitis B and C, and cancer, are expected to depend on the specific priming of MHC class I- and class II-restricted T cell responses against the relevant pathogen (1). Current approaches to design T cell-stimulating vaccines are based on novel adjuvants, synthetic peptides, recombinant viruses, or DNA vaccines.

With the availability of the complete sequence of the genomes of many major pathogens, the choice of Ags (and their immunogenic epitopes) has been strikingly expanded. Vaccines incorporating multiple, antigenic peptides binding to either MHC class II molecules (stimulating CD4+ Th cell responses) or class I molecules (stimulating CD8+ CTL responses) are an attractive choice for stimulating cellular immunity (2). This can focus CTL responses to multiple target Ags and/or multiple epitopes of a target Ag, and can provide help for priming CTL responses by codelivering class II-restricted T cell effector functions. By eliminating suppressive or immunodominant epitopes and optimizing MHC binding affinity and TCR contact, the immunogenicity of such synthetic peptide vaccines can be increased considerably.

Multiepitope vaccines can be constructed as either a synthetic peptide vaccine or as a DNA vaccine (or an expression cassette cloned into the genome of a recombinant virus). If the length of the peptide is >50–80 residues, the DNA-based approach is easier for vaccine designs, at least at the stage of experimental, preclinical vaccine designs. We therefore exploited the DNA vaccination approach to test in the mouse some aspects relevant for the design of optimal CTL-stimulating, multiepitope vaccines. Long peptides representing linear constructs of multiepitope or polytope vaccines have higher intrinsic immunogenicity than mixtures of individual peptides, although they require processing for acquiring T cell stimulatory potency (3, 4). Although combinations of epitopes can create new junctional epitopes (that are irrelevant for antipathogen immunity), their disruption by appropriate spacers between epitopes can solve this problem (4). Furthermore, the combination of a multitude of antigenic epitopes may establish novel immunodominance hierarchies that limit the immunogenicity of the subdominant epitopes. This can be overcome by codelivering an appropriate adjuvant (as shown in this report).

The N-terminal domain of the SV40 large tumor Ag (T-Ag)3 associates with the stress protein 73-kDa heat shock protein (hsp73) through a DnaJ-like structure, i.e., the J domain (5, 6, 7, 8, 9). T-Ag associates with hsp73 through the conserved HPD motif and the {alpha}-helical structure of the J domain. We have reported that different mutant T-Ags show stable association with hsp73 if their N terminus is intact (10, 11, 12, 13, 14). The N-terminal domain of T-Ag required for hsp73 association is located within the T77 (but not the T60) fragment that hence contains the intact J domain (15). From this observation we derived a vector system for the efficient expression of hsp73-associated, chimeric proteins (12, 13, 15, 16, 17). In this system the T-Ag-derived J domain is fused N-terminally to different sequences from heterologous viral Ags of different origins and lengths. This allowed us to design DNA vaccines that stably express chimeric, hsp73-binding proteins at a high level. In addition to enhancing expression, hsp70 molecules are innate adjuvants that enhance and modulate the immunogenicity of protein and peptide Ags (reviewed in Refs. 18, 19, 20). The adjuvant effect of hsp molecules seems to have many facets. Hsp induces the migration and maturation (including cytokine/chemokine release) of dendritic cells (DC) (21, 22, 23, 24, 25, 26, 27). Hsp facilitates the priming of CD8+ T cell responses to peptides from tumor Ags, minor H Ags, or viruses by delivering them to processing pathways for MHC class I-restricted presentation (26, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39). Hsp is thus an attractive innate adjuvant in vaccine formulations to enhance its immunogenicity for CTL. We compare the immunogenicity of multiepitope DNA vaccines for CD8+ T cells that express Ag associated or not associated with hsp73.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

C57BL/6J (B6) mice (H-2b), BALB/cJ mice (H-2d Ld+), BALB/cdm2 (dm2) mice (H-2d Ld-), F1 (BALB/c x C57BL/6) mice, and F1 (dm2 x C57BL/6) mice were bred and kept under standard pathogen-free conditions in the animal colony of Ulm University (Ulm, Germany). The H2dm2 strain has a deletion of ~140 kb that encompasses D2d, D3d, D4d, and Ld; dm2 mice are congenic to BALB/c. Male female mice were used at 12–16 wk of age.

Cells

The H-2d mastocytoma cell line P815 (TIB64) was obtained from American Tissue Culture Collection (Manassas, VA). The H-2b (B6-derived) T lymphoma cell line RBL5 was obtained from Dr. H.-U. Weltzien (Freiburg, Germany). The chicken hepatoma cell line LMH was obtained from Dr. H.-J. Schlicht (Ulm, Germany)

Vector constructs

The 106-residue murine polytope sequence (Fig. 1) was obtained from a pt10-encoding Bluescript construct with primers (GAATTCATATGTCTAGAGCCAGCAACGAGAACATG +; generating an EcoRI site) and (GGTACCTAAGTGCTCGGGGCCGGACAC-; generating a KpnI site) and was cloned directly into a pEGFP N1 (Clontech, Palo Alto, CA; catalogue no. 6085-1)-based mammalian pCMV expression vector, generating the plasmid pCMV/pt10. In this vector Ags are expressed under human CMV promoter/enhancer control. Construction of the vectors encoding the SV40 T-Ag derived T60 or T77 fragments (pBlue/T60 and pBlue/T77) has been described (12, 14, 15, 40). The T60- and T77-encoding sequences were cloned into the pCMV expression vector, generating plasmids pCMV/T77 and pCMV/T60. The pt-10-encoding EcoRI-KpnI fragment was cloned C-terminally (in-frame) into plasmids pCMV/T77 and pCMV/T60, generating plasmids pCMV/T77-pt10 and pCMV/T60-pt10, respectively.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 1. Map of the polytope (pt10) vaccine. The plasmid pCMV/pt10 encodes 10 murine, H-2d-, H-2b-, and H-2k-restricted CD8+ T cell epitopes. The amino acid sequences, the protein Ags and the pathogens from which they are derived, and the restricting MHC class I molecules that bind the epitopes are shown. TS, two spacer residues between epitopes 5 and 6. The C-terminal 11 residues represent an Ab-binding epitope (42 ). The epitopes and reference to their first published description are listed in the syfpeithi.bmi-heidelberg.com database.

 
Expression of polytope constructs by transfected cells

LMH cells were transiently transfected with plasmid DNA using the Ca2PO4 method. Briefly, 10 µg of plasmid DNA was adjusted to 0.25 M CaCl2 in a volume of 500 µl and mixed with 500 µl of 2x HBS buffer (280 mM NaCl, 1.5 mM Na2HPO4, and 50 mM HEPES, pH 7.1). Semiconfluent cell monolayers were incubated with the DNA solution for 12 h. Cells were metabolically labeled for 12–15 h with [35S]methionine 36 h after transfection, extracted with lysis buffer (120 mM NaCl, 1% aprotinin (Trasylol, Bayer, Leverkusen, Germany), leupeptin, 0.5% Nonidet P-40, and 50 mM Tris-hydrochloride (pH 8.0)) for 30 min at 4°C. Extracts were cleared by centrifugation and immunoprecipitated for T-Ag using the mAb PAB108 and protein A-Sepharose. Immune complexes bound to protein A-Sepharose were purified with wash buffer (300 mM LiCl, 1% Nonidet P-40, and 100 mM Tris-hydrochloride, pH 8.5), followed by two washes in PBS and 0.1x PBS. Immune complexes were recovered from protein A-Sepharose with elution buffer (1.5% SDS, 5% ME, and 7 mM Tris-hydrochloride, pH 6.8), processed for SDS-PAGE, and analyzed by fluorography.

DNA vaccination

For i.m. nucleic acid immunization, we injected 50 µl of PBS containing 1 µg/µl of plasmid DNA into each tibialis anterior muscle as previously described (12, 41). Intradermal injection of 2 µg of particle-coated DNA with the Helios Gene Gun system (catalogue no. 165-2431; Bio-Rad, Munich, Germany) has been described (14, 15), with the modification that immunization was performed with two shots of 300 psi.

Peptides

Synthetic peptides 1, 2, 3, 5, 6, 7, 8, and 10 listed in Fig. 1 were obtained from Jerini BioTools (Berlin, Germany). Peptides were dissolved in a DMSO stock solution at a concentration of 10 mg/ml and were diluted with culture medium before use.

Determination of splenic CD8+ T cell frequencies

Spleen cells (1 x 107/ml) were incubated for 1 h in RPMI 1640 medium with 0.1 µg/ml of the respective peptide. Thereafter, 5 µg/ml brefeldin A (BFA; Sigma-Aldrich, St. Louis, MO; catalogue no. 15870) was added, and the cultures were incubated for an additional 4–6 h. Cells were harvested and surface-stained with PE-conjugated anti-CD8 mAb (BD PharMingen, San Diego, CA; catalogue no. 01045B). Surface-stained cells were fixed with 2% paraformaldehyde in PBS before intracellular staining for IFN-{gamma}. Fixed cells were resuspended in permeabilization buffer (HBSS, 0.5% BSA, 0.5% saponin, and 0.05% sodium azide), incubated with FITC-conjugated anti-IFN-{gamma} mAb (BD PharMingen; catalogue no. 55441) for 30 min at room temperature, and washed twice in permeabilization buffer. Stained cells were resuspended in PBS/0.3% (w/v) BSA supplemented with 0.1% (w/v) sodium azide. We determined the frequencies of CD8+ IFN-{gamma}+ T cells by FCM analyses. The mean numbers of double-positive CD8+ IFN-{gamma}+ T cells/106 CD8+ spleen cells from three to six individual mice are shown.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Priming multispecific, murine CD8+ T cell responses by polytope DNA vaccines

The plasmid pCMV/pt10 encodes 10 well-characterized epitopes binding to murine MHC class I molecules encoded by the K, D, or L locus of H-2d, H-2b, and H-2k haplotype mice. Fig. 1 lists these 10 epitopes, their amino acid sequences, the protein Ag and the pathogens from which they are derived, and the restricting MHC class I molecules that bind the epitope. The pt10 DNA vaccine has been shown to prime multispecific, murine CTL responses (42).

We injected 100 µg of pCMV/pt10 DNA i.m. into H-2b (C57BL/6, B6; Fig. 2A) or H-2d (BALB/c) mice (Fig. 2B). No booster injections were given. Spleen cells obtained from immunized mice 12–15 days postvaccination were restimulated ex vivo for 5 h with antigenic peptides. The fraction of the splenic CD8+ T cells specifically inducible to IFN-{gamma} expression by stimulation with the respective epitope was determined by FCM. In B6 mice, readily detectable CD8+ T cell responses against the Db-restricted influenza epitope 1, the Kb-restricted OVA epitope 2, the Db-restricted adenovirus epitope 6, and the Kb-restricted Sendai virus epitope 7 were efficiently coprimed. As expected, H-2b mice did not generate CD8+ T cell responses against epitopes binding to H-2d class I molecules (Fig. 2A). Unexpectedly, priming of CD8+ T cell responses to the Kd-restricted influenza epitope 3 and the Ld-restricted CMV epitope 5 was low and inefficient in BALB/c mice (Fig. 2B). Only priming to the Kd-restricted malaria epitope 8 and the Ld-restricted lymphocytic choriomengitis virus epitope 10 was reproducibly detected (Fig. 2B). The pCMV/pt10 DNA vaccine thus efficiently primes CD8+ T cell responses in H-2b mice, but seems to be deficient in stimulating CD8+ T cell responses in H-2d mice.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 2. Priming pt10-specific CD8+ T cell responses. B6 (A), BALB/c (B), Ld- BALB/c dm2 (C), F1 (B6 x BALB/c) (D), and F1 (B6 x dm2) (E) mice were vaccinated i.m. with 100 µg of pCMV/pt10 plasmid DNA. Spleen cells obtained 12 days postvaccination were restimulated for 5 h with H-2b-restricted epitopes 1, 2, 6, and 7 and with H-2d-restricted epitopes 3, 5, 8, and 10. T cells were surface-stained for CD8 and intracellularly stained for IFN-{gamma}. We determined the frequencies of CD8+ IFN-{gamma}+ CD8+ T cells per 106 CD8+ spleen cells by FCM analyses. The mean numbers of IFN-{gamma}+ CD8+ T cells per 106 CD8+ spleen cells ± SD of five individual mice are shown.

 
Ld-restricted CTL down-modulate CD8+ T cell priming to other epitopes presented by different MHC class I molecules

We have reported that CD8+ T cell primed to the immunodominant, Ld-restricted HBsAg epitope suppresses copriming of CD8+ T cells to simultaneously presented Kd-, Dd-, and Kb-restricted HBsAg epitopes (17). We therefore tested whether the pt10 DNA vaccine can elicit CD8+ T cell responses to Kd-restricted epitopes 3 and 8 in Ld- BALB/c substrain dm2 mice. Priming of CD8+ T cell precursors to these two epitopes was strikingly enhanced in dm2 mice (i.e., under conditions where no Ld-restricted CD8+ T cell epitopes were presented; Fig. 2, compare C with B). Hence, priming Ld-restricted CD8+ T cells seems to down-regulate priming of CD8+ T cells to other epitopes of the construct, apparently regardless of their restriction or the nature of the epitope.

We immunized F1 (B6 x BALB/c) mice (Fig. 2D) to test whether the pt10 DNA vaccine can coprime multispecific, H-2b- and H-2d-restricted CD8+ T cell responses. Compared with vaccinated B6 mice, the H-2b-restricted CD8+ T cell responses to epitopes 1, 2, 6, and 7 were deficient in F1 (B6 x BALB/c) mice (Fig. 2, A and D). The H-2d-restricted CD8+ T cell responses against epitopes 3, 5, 8, and 10 primed in BALB/c and F1 (B6 x BALB/c) mice were comparable (Fig. 2, B and D). When Ld- F1 (B6 x dm2) mice were used instead of F1 (B6 x BALB/c) mice, efficient priming of CD8+ T cell responses to H-2b-restricted epitopes 1, 2, 6, and 7 and Kd-restricted epitopes 3 and 8 was observed (Fig. 2E). These data indicate that 1) the pt10 DNA vaccine can efficiently coprime multispecific CD8+ T cell responses restricted by at least four different MHC class I molecules; and 2) priming of Ld-restricted CD8+ T cell responses can down-regulate copriming of CD8+ T cells to epitopes restricted by unrelated MHC class I molecules.

Ld-restricted CD8+ T cell responses, not Ld surface expression, down-modulate copriming of CD8+ T cells restricted by unrelated MHC class I molecules

The Kb-restricted, OVA epitope 2 (SIINFEKL)-specific CD8+ T cell responses were efficiently elicited by the pCMV/OVA DNA vaccine (encoding the complete OVA sequence) in B6 mice, F1 (B6 x dm2) mice, and F1 (B6 x BALB/c) mice (Fig. 3A; groups a–c). The pt10 DNA vaccine contains this Kb-restricted OVA epitope 2. CD8+ T cells specific for this epitope were efficiently primed by the pt10-encoding DNA vaccine in B6 and F1 (B6 x dm2) mice, but not in F1 (B6 x BALB/c) mice (Figs. 2 and 3B). Hence, copriming Ld-restricted CD8+ T cell responses against epitopes encoded by pt10 (see Fig. 2), but not the surface expression of Ld, down-modulates copriming of CD8+ T cell to other epitopes restricted by unrelated MHC class I molecules and present on the same antigenic construct.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 3. Priming OVA-specific CD8+ T cell responses. B6 (a), F1 (B6 x BALB/c) (b), and F1 (B6 x dm2) (c) mice were vaccinated i.m. with 100 µg of OVA-encoding pCMV/OVA (A) or the polytope-encoding pCMV/pt10 (B) plasmid DNA. Spleen cells obtained 14 days postvaccination were restimulated for 5 h with H-2b-restricted OVA epitope 2. T cells were surface-stained for CD8 and intracellularly stained for IFN-{gamma}. We determined the frequencies of CD8+ IFN-{gamma}+ CD8+ T cell per 106 CD8+ spleen cells by FCM analyses. The mean numbers of IFN-{gamma}+ CD8+ T cells per 106 CD8+ spleen cells ± SD of six individual mice of two experiments are shown.

 
Construction of an hsp73-associated polytope DNA vaccine

The pt10 vaccine used primed some CD8+ T cell responses inefficiently. We tested whether alternative designs of the pt10 DNA vaccine enhance the efficiency of multispecific CD8+ T cells priming by this construct and can overcome the suppressive effect of Ld-restricted CD8+ T cell priming. We used an hsp73-mediated expression system (14, 15) by fusing the hsp73 binding SV40 T-Ag-derived DnaJ domain N-terminally in-frame to the polytope-encoding DNA sequence. The 106-residue-encoding pt10 sequence was fused C-terminally to the hsp73-binding, 77-residue, N-terminal T-Ag fragment, to generate the cT77-pt10 chimeric protein (Fig. 4). As a negative control, the T60 N terminus of the T-Ag that does not bind hsp73 (14, 15) was fused to the pt10 sequence to generate the non-hsp-binding fusion protein T60-pt10 (Fig. 4). The expression of the fusion proteins from the expression constructs pCMV/T77-pt10 and pCMV/T60-pt10 was tested after transient transfection of LMH (chicken hepatoma) cells. The mAb 108 (directed against the extreme N terminus of the T-Ag) was used for immunoprecipitation of chimeric Ags from the lysates of the transfectants. Subsequent SDS-PAGE analyses revealed efficient expression of the T77-pt10 fusion protein (Fig. 4). We barely detected the non-hsp-associated T60-pt10 fusion protein (Fig. 4), confirming our observation that stress protein-associated expression of the peptide was always higher than the expression of the corresponding non-hsp73-associated, chimeric proteins (14, 15). The hsp73 stress protein was coprecipitated with the fusion protein from transfected cells expressing peptides encoded by pCMV/T77-pt10, but not from transfected cells expressing peptide encoded by pCMV/T60-pt10 (Fig. 4). This confirms that the tight, noncovalent association between hsp73 and the viral DnaJ domain requires the intact 77-residue domain as described by us in other Ag systems (10, 11, 13, 15, 16). Hence, we have constructed DNA vaccines carrying the immunogenic pt10 domain, but differing in the level of expression and the association with hsp73.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. Expression of the 106-residue pt10 unit using the hsp73-binding expression system. Maps of pt10 and its fusion to the hsp73-binding T77 and non-hsp-binding T60 fragments are shown. LMH cells were transiently transfected with pCMV/T77-pt10 or pCMV/T60-pt10, labeled with [35S]methionine, extracted and immunoprecipitated with anti T-Ag mAb 108, and processed for SDS-PAGE, followed by fluorography of the gels. The positions of hsp73 and the T77-pt10 Ag are indicated.

 
Hsp-associated expression of polytope vaccines facilitates copriming of multispecific CD8+ T cell responses

F1 (B6 x BALB/c) mice were immunized by a single i.m. injection of the DNA vaccines pCMV/pt10 (Fig. 5; group a), pCMV/T77-pt10 (group b), and pCMV/T60-pt10 (group c). The primed CD8+ T cell responses were read out against the H-2b-restricted, pt10-encoded epitopes 1, 2, 6, and 7 (Fig. 5A) and against the H-2d-restricted epitopes 3, 5, 8, and 10 (Fig. 5B). The hsp73-associated expression of the polytope DNA vaccine (group b) was reproducibly superior to the non-hsp-associated expression of the same DNA vaccine (group c) in priming all multispecific CD8+ T cell responses tested. No reproducible differences in the relative efficacy of CD8+ T cell priming were detectable between vaccinations with the conventional pt10 vaccine (group a) and the pCMV/T60-pt10 vaccine (group c). The expression of antigenic domains in tight, noncovalent association with hsp73 thus enhances their immunogenicity for CD8+ T cells. Comparable CD8+ T cell responses to the different epitopes were primed in F1 (B6 x BALB/c) and F1 (B6 x dm2) mice (Fig. 6, compare groups b and c). Thus, priming to Ld-restricted epitopes by the pt10 vaccine, but not the T77-pt10 vaccine, down-modulated copriming to other CD8+ T cell responses.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 5. Hsp73-mediated priming of pt10-specific CD8+ T cell responses. F1 (B6 x BALB/c) mice were vaccinated i.m. with 100 µg of plasmid DNA encoding the pt10 polypeptide (a), the hsp73-associated T77-pt10 chimeric protein (b), or the T60-pt10 chimeric protein (c). Spleen cells obtained 12 days postvaccination were restimulated for 5 h with H-2b-restricted epitopes 1, 2, 6, and 7 (A) and with H-2d restricted epitopes 3, 5, 8, and 10 (B). T cells were surface-stained for CD8 and intracellularly stained for IFN-{gamma}. We determined the frequencies of CD8+ IFN-{gamma}+ CD8+ T cell per 106 CD8+ spleen cells by FCM analyses. The mean numbers of IFN-{gamma}+ CD8+ T cells per 106 CD8+ spleen cells ± SD of four individual mice are shown.

 


View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 6. The hsp73-bound T77-pt10 vaccine overrides suppression of coprimed, Ld-restricted CD8+ T cell responses. F1 (B6 x BALB/c) mice either were not vaccinated (a) or were vaccinated i.m. with 100 µg of plasmid DNA encoding the T77-pt10 expression construct (b). F1 (B6 x dm2) mice were immunized i.m. with 100 µg of plasmid DNA encoding the T77-pt10 expression construct (c). Spleen cells obtained 12 days postvaccination were restimulated for 5 h with the H-2b-restricted epitopes 1, 2, 6, and 7 (A) or the H-2d-restricted epitopes 3, 5, 8, and 10 (B). T cells were surface-stained for CD8 and intracellularly stained for IFN-{gamma}. We determined the frequencies of CD8+ IFN-{gamma}+ CD8+ T cell per 106 CD8+ spleen cells by FCM analyses. The mean numbers of IFN-{gamma}+ CD8+ T cells per 106 CD8+ spleen cells ± SD of three individual mice are shown.

 
The efficacy of hsp73-binding T77-pt10 Ag to specifically prime pt10-specific CD8+ T cell precursors was even more striking in gene gun-mediated, intradermal DNA vaccination (Fig. 7). While priming of IFN-{gamma}-producing, pt10-specific CD8+ T cell responses was not detectable after injection of DNA vaccines encoding the non-hsp-binding pt10 (group a) or T60-pt10 construct (group c), they were readily detectable after intradermal injection of the hsp73-binding T77-pt10-encoding plasmid DNA with the gene gun (group b). The association of Ag with hsp73 thus strikingly enhances its immunogenicity for CD8+ T cell precursors, supporting CD8+ T cell priming even after intradermal delivery of low doses of DNA vaccines. Hence, a high level of Ag expression in association with hsp73 efficiently induces pt10-specific CD8+ T cell responses even under Ld-dependent immunodominance, thereby facilitating copriming of CD8+ T cell populations with a diverse repertoire.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 7. Hsp73-mediated priming of pt10-specific CD8+ T cell responses using the gene gun delivery method. F1 (B6 x BALB/c) mice were vaccinated and boosted intradermally (using the gene gun) with 2 µg of plasmid DNA of the indicated vectors: pCMV/pt10 (a), pCMV/T77-pt10 (b), and pCMV/T60-pt10 (c). Spleen cells obtained 12 days after the booster injection were restimulated for 5 h with the H-2b-restricted epitopes 1, 2, 6, and 7 (A) or the H-2d-restricted epitopes 3, 5, 8, and 10 (B). T cells were surface-stained for CD8 and intracellularly stained for IFN-{gamma}. We determined the frequencies of CD8+ IFN-{gamma}+ CD8+ T cell per 106 CD8+ spleen cells by FCM analyses. The mean numbers of IFN-{gamma}+ CD8+ T cells per 106 CD8+ spleen cells ± SD of three to six individual mice are shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
For this study we constructed DNA vaccines that express the polytope sequence pt10. This chimeric Ag was expressed in a form that either stably bound the constitutively expressed, cytosolic hsp73 molecule or was not hsp bound. As every nascent protein emerging from the ribosome transiently binds hsp73, it seems that the DnaJ-homologous sequence in the nascent polytope protein delays the off rate of hsp. As the DnaJ homologous sequence is present in the N terminus of native as well as mutant T-Ag, and only mutant, not native, T-Ag shows stable hsp73 binding, additional downstream signals (such as accessible epitopes bound by hsp73 substrate binding sites) seem to be required for stable hsp binding. Alternatively, specific post-translational capture of the chimeric, cytosolic protein by hsp73 to target it for alternative, endolysosomal degradation may operate in this system (43, 44, 45). The long half-life of the hsp73/protein complexes may reflect their delayed clearance from the cytosol and/or their extended survival in an endolysosomal compartment. The data in Fig. 4 confirm that stable hsp73 binding allows the expression of protein fragments, which difficult to achieve without hsp binding (12, 15). This offers the chance to express selected immunogenic domains from different protein Ags of interest. The limits of the carrying capacity of the system are not yet clear, but up to 800 residues have been successfully expressed in the system (R. Schirmbeck, manuscript in preparation). This would allow the incorporation of long spacer regions (to block generation of junctional epitopes) (4) or long flanking regions (to facilitate natural processing of the epitope) into a construct. Hence, the system may overcome some of the restrictions in size and heterogeneity inherent in conventional peptide-based approaches.

The use of the chimeric Ag certainly is not restricted to DNA vaccination, but preparative isolation of hsp73/chimeric protein complexes is a feasible option, as has been expertly demonstrated for hsp/peptide complexes (33, 46, 47, 48). In addition to facilitating expression, hsp binding offers other features that make it attractive as a vaccine. Hsp molecules of the hsp70 and hsp90 class are intrinsic adjuvants (as indicated above) and introduce cytosolic proteins into alternative processing pathways (10, 11). As different proteolytic systems seem to give rise to different, although overlapping, repertoires of antigenic epitopes (49), this means of expression can potentially extend the repertoire of immunogenic epitopes presented by an Ag.

We and others have described the immunodominance of the Ld-restricted CD8+ T cell response that interferes with the copriming of CD8+ T cells restricted by other MHC class I molecules in the HBsAg system (17, 50). These data are extended in this report. Two additional Ld-restricted epitopes from two unrelated viruses, i.e., murine CMV and lymphocytic choriomengitis virus, showed a similar immunodominance. This implies either that immunodominance is a property of Ld-restricted CD8+ T cell responses or that we detected by chance three independent examples of immunodominant Ld-restricted CD8+ T cell responses. Detailed analysis of Ld-restricted CD8+ T cell responses in other systems may provide an answer. The cellular and molecular mechanisms that mediates this suppression are unknown, but are under active study in our group. It can be overcome at least partially by supplying high doses of type I IFNs and/or IL-15 to the site where CD8+ T cell precursors are primed in situ (51). This suggests the involvement of a factor-mediated immunoregulation. Further studies are needed to elucidate this phenomenon.

We have previously described and reiterated above the potential advantages of delivery of hsp-bound Ag as vaccines. These include enhanced expression and facilitated expression of even large chimeric proteins (when used as a DNA vaccine), its facilitation of cross-priming, and its ability to introduce Ags into alternative processing pathways. The expression of the polytope vaccine as hsp-binding complexes not only enhanced its immunogenicity, but at least partially overcame the suppressive effect of Ld-dependent immunodominance. This may be related to the adjuvant effect of hsp, e.g., its cytokine-releasing effect. Taken together, these data support the idea that hsp-bound, large protein Ags produced in situ by DNA vaccines display exceptional immunogenicity and can escape suppressive immunoregulation.


    Acknowledgments
 
The excellent technical assistance of Tanja Guentert, Katrin Ölberger, and Claude Oehninger is appreciated.


    Footnotes
 
1 This work was supported by grants from the Deutsche Forschungsgemeinschaft (DFG Schi 505/2-2, to R.S.) and the European Commission (QLK2-CT-2002-00700, to J.R. and R.S. Back

2 Address correspondence and reprint requests to Dr. Jörg Reimann, Institute for Medical Microbiology and Immunology, University of Ulm, Albert Einstein Allee 11, D-89081 Ulm, Germany. E-mail address: joerg.reimann{at}medizin.uni-ulm.de Back

3 Abbreviations used in this paper: T-Ag, large tumor Ag of SV40; B6, C57BL/6 inbred strain; BFA, brefeldin A; c, cytoplasmic; DC, dendritic cell; FCM, flow cytometry; hsp73, 73-kDa heat shock protein; pt10, polytope vaccine used in this study. Back

Received for publication March 6, 2003. Accepted for publication May 27, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Letvin, N. L., D. H. Barouch, D. C. Montefiori. 2002. Prospects for vaccine protection against HIV-1 infection and AIDS. Annu. Rev. Immunol. 20:73.[Medline]
  2. Engler, O. B., W. J. Dai, A. Sette, I. P. Hunziker, J. Reichen, W. J. Pichler, A. Cerny. 2001. Peptide vaccines against hepatitis B virus: from animal model to human studies. Mol. Immunol. 38:457.[Medline]
  3. Alexander, J., C. Oseroff, C. Dahlberg, M. Qin, G. Ishioka, M. Beebe, J. Fikes, M. Newman, R. W. Chesnut, P. A. Morton, et al 2002. A decaepitope polypeptide primes for multiple CD8+ IFN-{gamma} and Th lymphocyte responses: evaluation of multiepitope polypeptides as a mode for vaccine delivery. J. Immunol. 168:6189.[Abstract/Free Full Text]
  4. Livingston, B., C. Crimi, M. Newman, Y. Higashimoto, E. Appella, J. Sidney, A. Sette. 2002. A rational strategy to design multiepitope immunogens based on multiple Th lymphocyte epitopes. J. Immunol. 168:5499.[Abstract/Free Full Text]
  5. Sullivan, C. S., J. M. Pipas. 2001. The virus-chaperone connection. Virology 287:1.[Medline]
  6. Sullivan, C. S., S. P. Gilbert, J. M. Pipas. 2001. ATP-dependent simian virus 40 T-antigen-Hsc70 complex formation. J. Virol. 75:1601.[Abstract/Free Full Text]
  7. Berjanskii, M. V., M. I. Riley, A. Xie, V. Semenchenko, W. R. Folk, S. R. Van Doren. 2000. NMR structure of the N-terminal J domain of murine polyomavirus T antigens: implications for DnaJ-like domains and for mutations of T antigens. J. Biol. Chem. 275:36094.[Abstract/Free Full Text]
  8. Srinivasan, A., A. J. McClellan, J. Vartikar, I. Marks, P. Cantalupo, Y. Li, P. Whyte, K. Rundell, J. L. Brodsky, J. M. Pipas. 1997. The amino-terminal transforming region of simian virus 40 large T and small t antigens functions as a J domain. Mol. Cell. Biol. 17:4761.[Abstract]
  9. Brodsky, J. L., J. M. Pipas. 1998. Polyomavirus T antigens: molecular chaperones for multiprotein complexes. J. Virol. 72:5329.[Free Full Text]
  10. Schirmbeck, R., J. Reimann. 1994. Peptide transporter-independent, stress protein-mediated endosomal processing of endogenous protein antigens for major histocompatibility complex class I presentation. Eur. J. Immunol. 24:1478.[Medline]
  11. Schirmbeck, R., W. Boehm, J. Reimann. 1997. Stress protein (hsp73)-mediated, TAP-independent processing of endogenous, truncated SV40 large T antigen for Db-restricted peptide presentation. Eur. J. Immunol. 27:2016.[Medline]
  12. Schirmbeck, R., O. Gerstner, J. Reimann. 1999. Truncated or chimeric endogenous protein antigens gain immunogenicity for B cells by stress protein-facilitated expression. Eur. J. Immunol. 29:1740.[Medline]
  13. Kammerer, R., D. Stober, P. Riedl, C. Oehninger, R. Schirmbeck, J. Reimann. 2002. Noncovalent association with stress protein facilitates cross-priming of CD8+ T cells to tumor cell antigens by dendritic cells. J. Immunol. 168:108.[Abstract/Free Full Text]
  14. Schirmbeck, R., J. Reimann. 2002. Enhancing DNA vaccine efficacy by stress protein-facilitated antigen expression. G. Dietrich, and W. Goebel, eds. Vaccine Delivery Strategies 103. Horizon Scientific Press, Norfolk, U.K.
  15. Schirmbeck, R., M. Kwissa, N. Fissolo, S. Elkholy, P. Riedl, J. Reimann. 2002. Priming polyvalent immunity by DNA vaccines expressing chimeric antigens with a stress protein-capturing, viral J-domain. FASEB J. 16:1108.[Abstract/Free Full Text]
  16. Riedl, P., S. El Kholy, J. Reimann, R. Schirmbeck. 2002. Priming biologically active antibody responses against an isolated, conformational viral epitope by DNA vaccination. J. Immunol. 169:1251.[Abstract/Free Full Text]
  17. Schirmbeck, R., D. Stober, S. El Kholy, P. Riedl, J. Reimann. 2002. The immunodominant, Ld-restricted T cell response to hepatitis B surface antigen (HBsAg) efficiently suppresses T cell priming to multiple Dd-, Kd-, and Kb-restricted HBsAg epitopes. J. Immunol. 168:6253.[Abstract/Free Full Text]
  18. Li, Z., A. Menoret, P. Srivastava. 2002. Roles of heat-shock proteins in antigen presentation and cross-presentation. Curr. Opin. Immunol. 14:45.[Medline]
  19. Srivastava, P.. 2002. Interaction of heat shock proteins with peptides and antigen presenting cells: chaperoning of the innate and adaptive immune responses. Annu. Rev. Immunol. 20:395.[Medline]
  20. Schild, H., S. D. Arnold, E. Lammert, H. G. Rammensee. 1999. Stress proteins and immunity mediated by cytotoxic T lymphocytes. Curr. Opin. Immunol. 11:109.[Medline]
  21. Todryk, S., A. A. Melcher, N. Hardwick, E. Linardakis, A. Bateman, M. P. Colombo, A. Stoppacciaro, R. G. Vile. 1999. Heat shock protein 70 induced during tumor cell killing induces Th1 cytokines and targets immature dendritic cell precursors to enhance antigen uptake. J. Immunol. 163:1398.[Abstract/Free Full Text]
  22. Byrd, C. A., W. Bornmann, B. H. Erdjument, P. Tempst, N. Pavletich, N. Rosen, C. F. Nathan, A. Ding. 1999. Heat shock protein 90 mediates macrophage activation by Taxol and bacterial lipopolysaccharide. Proc. Natl. Acad. Sci. USA 96:5645.[Abstract/Free Full Text]
  23. Kol, A., T. Bourcier, A. H. Lichtman, P. Libby. 1999. Chlamydial and human heat shock protein 60s activate human vascular endothelium, smooth muscle cells, and macrophages. J. Clin. Invest. 103:571.[Medline]
  24. Singh, J. H., H. U. Scherer, N. Hilf, S. D. Arnold, H. G. Rammensee, R. E. Toes, H. Schild. 2000. The heat shock protein gp96 induces maturation of dendritic cells and down-regulation of its receptor. Eur. J. Immunol. 30:2211.[Medline]
  25. Yoo, C. G., S. Lee, C. T. Lee, Y. W. Kim, S. K. Han, Y. S. Shim. 2000. Anti-inflammatory effect of heat shock protein induction is related to stabilization of I{kappa}B{alpha} through preventing I{kappa}B kinase activation in respiratory epithelial cells. J. Immunol. 164:5416.[Abstract/Free Full Text]
  26. Cho, B. K., D. Palliser, E. Guillen, J. Wisniewski, R. A. Young, J. Chen, H. N. Eisen. 2000. A proposed mechanism for the induction of cytotoxic T lymphocyte production by heat shock fusion proteins. Immunity 12:263.[Medline]
  27. Paul, A. G., P. J. van Kooten, W. van Eden, Z. R. van der. 2000. Highly autoproliferative T cells specific for 60-kDa heat shock protein produce IL-4/IL-10 and IFN-g and are protective in adjuvant arthritis. J. Immunol. 165:7270.[Abstract/Free Full Text]
  28. Arnold, D., S. Faath, H. G. Rammensee, H. Schild. 1995. Cross-priming of minor histocompatibility antigen-specific cytotoxic T cells upon immunization with the heat shock protein gp96. J. Exp. Med. 182:885.[Abstract/Free Full Text]
  29. Feldweg, A. M., P. Srivastava. 1995. Molecular heterogeneity of tumor rejection antigen/heat shock protein GP96. Int. J. Cancer 63:310.[Medline]
  30. Nieland, T. J. F., M. C. A. Tan, M. M. van Muijen, F. Koning, A. M. Kruisbeek, G. M. van Bleek. 1996. Isolation of an immunodominant viral peptide that is endogenously bound to the stress protein GP96/GRP94. Proc. Natl. Acad. Sci. USA 93:6135.[Abstract/Free Full Text]
  31. Lammert, E., D. Arnold, H. G. Rammensee, H. Schild. 1996. Expression levels of stress protein gp96 are not limiting for major histocompatibility complex class I-restricted antigen presentation. Eur. J. Immunol. 26:875.[Medline]
  32. Roman, E., C. Moreno. 1996. Synthetic peptides non-covalently bound to bacterial hsp70 elicit peptide-specific T-cell responses in vivo. Immunology 88:487.[Medline]
  33. Blachere, N. E., Z. Li, R. Y. Chandawarkar, R. Suto, N. S. Jaikaria, S. Basu, H. Udono, P. Srivastava. 1997. Heat shock protein-peptide complexes, reconstituted in vitro, elicit peptide-specific cytotoxic T lymphocyte response and tumor immunity. J. Exp. Med. 186:1315.[Abstract/Free Full Text]
  34. Heikema, A., E. Agsteribbe, J. Wilschut, A. Huckriede. 1997. Generation of heat shock protein-based vaccines by intracellular loading of gp96 with antigenic peptides. Immunol. Lett. 57:69.[Medline]
  35. Ciupitu, A. M., M. Petersson, C. L. O’Donnell, K. Williams, S. Jindal, R. Kiessling, R. M. Welsh. 1998. Immunization with a lymphocytic choriomeningitis virus peptide mixed with heat shock protein 70 results in protective antiviral immunity and specific cytotoxic T lymphocytes. J. Exp. Med. 187:685.[Abstract/Free Full Text]
  36. Kumaraguru, U., R. J. Rouse, S. K. Nair, B. D. Bruce, B. T. Rouse. 2000. Involvement of an ATP-dependent peptide chaperone in cross-presentation after DNA immunization. J. Immunol. 165:750.[Abstract/Free Full Text]
  37. Moroi, Y., M. Mayhew, J. Trcka, M. H. Hoe, Y. Takechi, F. U. Hartl, J. E. Rothman, A. N. Houghton. 2000. Induction of cellular immunity by immunization with novel hybrid peptides complexed to heat shock protein 70. Proc. Natl. Acad. Sci. USA 97:3485.[Abstract/Free Full Text]
  38. Kumaraguru, U., M. Gierynska, S. Norman, B. D. Bruce, B. T. Rouse. 2002. Immunization with chaperone-peptide complex induces low-avidity cytotoxic T lymphocytes providing transient protection against herpes simplex virus infection. J. Virol. 76:136.[Abstract/Free Full Text]
  39. Ishii, T., H. Udono, T. Yamano, H. Ohta, A. Uenaka, T. Ono, A. Hizuta, N. Tanaka, P. Srivastava, E. Nakayama. 1999. Isolation of MHC class I-restricted tumor antigen peptide and its precursors associated with heat shock proteins hsp70, hsp90, and gp96. J. Immunol. 162:1303.[Abstract/Free Full Text]
  40. Kuhröber, A., H. P. Pudollek, K. Reifenberg, F. V. Chisari, H. J. Schlicht, J. Reimann, R. Schirmbeck. 1996. DNA immunization induces antibody and cytotoxic T cell responses to hepatitis B core antigen in H-2b mice. J. Immunol. 156:3687.[Abstract]
  41. Schirmbeck, R., W. Boehm, J. Reimann. 1996. DNA vaccination primes MHC class I-restricted, simian virus 40 large tumor antigen-specific cytotoxic T lymphocytes in H-2d mice that reject syngeneic tumors. J. Immunol. 157:3550.[Abstract]
  42. Thomson, S. A., S. L. Elliott, M. A. Sherritt, K. W. Sproat, B. E. Coupar, A. A. Scalzo, C. A. Forbes, A. M. Ladhams, X. Y. Mo, R. A. Tripp, et al 1996. Recombinant polyepitope vaccines for the delivery of multiple CD8 cytotoxic T cell epitopes. J. Immunol. 157:822.[Abstract]
  43. Chiang, H.-L., S. R. Terlecky, C. P. Plant, J. F. Dice. 1989. A role for a 70-kilodalton heat shock protein in lysosomal degradation of intracellular proteins. Science 246:382.[Abstract/Free Full Text]
  44. Terlecky, S. R., H.-L. Chiang, T. S. Olson, J. F. Dice. 1992. Protein and peptide binding and stimulation of in vitro lysosomal proteolysis by the 73-kDa heat shock cognate protein. J. Biol. Chem. 267:9202.[Abstract/Free Full Text]
  45. Hayes, S. A., J. F. Dice. 1996. Roles of molecular chaperones in protein degradation. J. Cell Biol. 132:255.[Free Full Text]
  46. Peng, P., A. Menoret, P. Srivastava. 1997. Purification of immunogenic heat shock protein 70-peptide complexes by ADP-affinity chromatography. J. Immunol. Methods 204:13.[Medline]
  47. Srivastava, P.. 1997. Purification of heat shock protein-peptide complexes for use in vaccination against cancers and intracellular pathogens. Methods 12:165.[Medline]
  48. Tamura, Y., P. Peng, K. Liu, M. Daou, P. Srivastava. 1997. Immunotherapy of tumors with autologous tumor-derived heat shock protein preparations. Science 278:117.[Abstract/Free Full Text]
  49. Schirmbeck, R., J. Reimann. 2002. Alternative processing of endogenous or exogenous antigens extends the immunogenic, H-2 class I-restricted peptide repertoire. Mol. Immunol. 39:249.[Medline]
  50. Sette, A., C. Oseroff, J. Sidney, J. Alexander, R. W. Chesnut, K. Kakimi, L. G. Guidotti, F. V. Chisari. 2001. Overcoming T cell tolerance to the hepatitis B virus surface antigen in hepatitis B virus-transgenic mice. J. Immunol. 166:1389.[Abstract/Free Full Text]
  51. Kwissa, M., D. Stober, A. Kroger, H. Hauser, J. Reimann, R. Schirmbeck. 2003. Cytokine-facilitated priming of CD8+ T cell responses by DNA vaccination. J. Mol. Med. 81:91.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
P. Riedl, A. Wieland, K. Lamberth, S. Buus, F. Lemonnier, K. Reifenberg, J. Reimann, and R. Schirmbeck
Elimination of Immunodominant Epitopes from Multispecific DNA-Based Vaccines Allows Induction of CD8 T Cells That Have a Striking Antiviral Potential
J. Immunol., July 1, 2009; 183(1): 370 - 380.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Schirmbeck, P. Riedl, M. Kupferschmitt, U. Wegenka, H. Hauser, J. Rice, A. Kroger, and J. Reimann
Priming Protective CD8 T Cell Immunity by DNA Vaccines Encoding Chimeric, Stress Protein-Capturing Tumor-Associated Antigen
J. Immunol., August 1, 2006; 177(3): 1534 - 1542.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
X. Li, X. Yang, Y. Jiang, and J. Liu
A novel HBV DNA vaccine based on T cell epitopes and its potential therapeutic effect in HBV transgenic mice
Int. Immunol., October 1, 2005; 17(10): 1293 - 1302.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Schirmbeck, P. Riedl, N. Fissolo, F. A. Lemonnier, A. Bertoletti, and J. Reimann
Translation from Cryptic Reading Frames of DNA Vaccines Generates an Extended Repertoire of Immunogenic, MHC Class I-Restricted Epitopes
J. Immunol., April 15, 2005; 174(8): 4647 - 4656.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schirmbeck, R.
Right arrow Articles by Reimann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schirmbeck, R.
Right arrow Articles by Reimann, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS