The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Báfica, A.
Right arrow Articles by Sher, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Báfica, A.
Right arrow Articles by Sher, A.
The Journal of Immunology, 2003, 171: 1123-1127.
Copyright © 2003 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: In Vivo Induction of Integrated HIV-1 Expression by Mycobacteria Is Critically Dependent on Toll-Like Receptor 2 1

André Báfica2,*, Charles A. Scanga*, Marco L. Schito{dagger}, Sara Hieny* and Alan Sher*

* Immunobiology Section, Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases and {dagger} Chemical Immunology Section, Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
Mycobacterial infection has been implicated as a possible factor in AIDS progression in populations where HIV-1 and Mycobacterium tuberculosis are coendemic. In support of this concept, we have previously shown that HIV-1-transgenic (Tg) mice infected with mycobacteria display enhanced viral gene and protein expression. In this study, we demonstrate that the induction of HIV-1 observed in this model is dependent on Toll-like receptor 2 (TLR2), a pattern recognition receptor known to be involved in mycobacteria-host interaction. Spleen cells from HIV-1-Tg mice deficient in TLR2 (Tg/TLR2-/-) were found to be completely defective in p24 production induced in response to live M. tuberculosis or Mycobacterium avium as well as certain mycobacterial products. Importantly, following in vivo mycobacterial infection, Tg/TLR2-/- mice failed to display the enhanced HIV-1 gag/env mRNA and p24 protein synthesis exhibited by wild-type Tg animals. Together, these results argue that TLR2 plays a crucial role in the activation of HIV-1 expression by mycobacterial coinfections.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
Mycobacterium tuberculosis and HIV-1 are coendemic in many areas of the world and patients simultaneously infected with these two agents exhibit greater morbidity and mortality than individuals harboring either pathogen alone (1, 2). Although AIDS clearly leads to heightened susceptibility to mycobacterial infection, there is also evidence suggesting that M. tuberculosis and Mycobacterium avium may accelerate the progression of HIV disease through a process of immune activation of viral expression (1, 2, 3, 4). In support of this hypothesis, live mycobacteria as well as mycobacterial products have been shown to stimulate HIV-1 gene expression or replication in human peripheral blood monocytes, lymphocytes, or cell lines in vitro (5, 6, 7). Nevertheless, it has been difficult to assess the relevance of, and to study the mechanism(s) of, such mycobacterial-induced immune activation in vivo (1, 2).

We have used a transgenic (Tg)3 mouse expressing complete DNA copies of the HIV-1 genome to investigate the influence of coinfecting pathogens on latent viral expression in vivo (8). Upon exposure to Toxoplasma gondii (8), Plasmodium chabaudi (9), or M. avium (10), these animals display enhanced expression of HIV-1 transcripts as well as p24 (a capsid protein encoded by the gag gene) and assemble small numbers of infectious viral particles detected by coculture with human T cell lines. In the case of T. gondii infection, such activation of HIV-1 gene expression was found to be markedly reduced in control Tg mice in which the NF-{kappa}B region of the long-terminal repeat (LTR) (3) was inactivated by sequence substitution (8). Interestingly, in this transgenic mouse model, APC (macrophages, dendritic, and B cells) rather than T cells provide the major source of increased HIV-1 production. Indeed, the former cells show elevated p24 secretion when exposed to microbial products such as LPS or mycobacterial extracts (10, 11).

Recent evidence indicates that the innate and adaptive immune response to mycobacteria is highly dependent on signaling through Toll-like receptors (TLR) (12, 13). Two members of this conserved family, TLR2 and TLR4, have been shown to be involved in triggering proinflammatory cytokine production and NF-{kappa}B activation in response to M. tuberculosis or subcellular products from a number of different mycobacterial species (14, 15, 16, 17, 18). In particular, TLR2 is required for the induction of cytokine responses to the mycobacterial cell wall components lipoarabinomannam (14), 19-kDa lipoprotein (19), and monosylated phosphatidylinositol (20). In addition, mice deficient in this receptor show impaired resistance to high doses of M. tuberculosis (17). These findings suggest that TLR2 may play an important role in the immune activation of HIV-1 by mycobacterial infection and, in particular, from non-T cell sources of the virus.

In the present study, we have used our HIV-1 Tg mouse model to assess the role of TLR2 in the induction of HIV-1 expression by mycobacteria in vitro as well as in vivo. We show that the entire response to mycobacterial pathogens by cultured Tg cells is TLR2-dependent, and that live mycobacterial infection fails to induce HIV-1 transcription and p24 production in vivo in Tg mice deficient in TLR2. These observations support the concept that TLR2 signaling is a major driving force in the immune activation of HIV-1 by mycobacterial coinfections.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Experimental animals

The transgenic mouse line 166 which contains multiple copies of the complete proviral genome of HIV-1 strain NL4–3 was derived as previously described (8). TLR2-/- mice (21) on a partially crossed 129/Ola x C57/BL6 background were kindly provided by Drs. D. T. Golenboch and S. Akira (Osaka University, Osaka, Japan). HIV-1 Tg mice were crossed with either TLR2-deficient or wild-type 129/Ola x C57/BL6 mice (The Jackson Laboratory, Bar Harbor, ME); these F1 animals were then intercrossed to derive homozygous Tg/TLR2-/- and Tg/TLR+/+ mice identified by PCR of tail snips as previously described (21). The homozygous animals were then bred as lines in an American Association for the Accreditation of Laboratory Animal Care-accredited animal facility. Mice of both sexes between 6- and 12-wk old were used in all experiments.

Pathogens and experimental infections

Stocks of M. tuberculosis strains H37Rv and H37Ra (108 CFU/ml) and M. avium strain 2-151 SmT (1.2 x 108 CFU/ml) were prepared in liquid broth and stored at -70°C. In some experiments, mycobacteria were killed by heating at 60°C for 30 min and the loss in viability confirmed by the failure to form colonies on agar. For in vivo infection, mice (4–6/group) were injected i.p. with 107 CFU/animal of M. avium suspended in PBS. To assess bacterial load, spleens were harvested at 1-wk postinfection and single cell suspensions were diluted in buffered saline and cultured on agar plates as previously described (22). Control mice in the same experiments were infected with 30 cysts of the avirulent ME49 T. gondii strain by i.p. inoculation.

Induction of HIV-1 expression in vitro

Spleens from mice were disrupted through a nylon mesh (40 µm) to obtain single cell suspensions and depleted of RBC by osmotic lysis. The cells were then suspended in RPMI 1640 culture medium as previously described (22) and stimulated with live or heat-killed M. tuberculosis, M. avium, or soluble M. avium extract (MAg; Ref.23). Additionally, cultures were stimulated with the following bacterial components: culture filtrate protein (CFP), phosphatidylinositol mannoside (PIM)1,2 from M. tuberculosis (both provided by the National Institute of Allergy and Infectious Diseases Tuberculosis Research Materials and Vaccine Testing Contract N01AI-75320 at Colorado State University, Fort Collins, CO), LPS (Escherichia coli 0117:B08; Sigma-Aldrich, St. Louis, MO), and a synthetic lipoprotein S-[2,3-bis(palmitoyloxy)-(2-RS)-propyl]-N-palmitoyl-(R)-Cys-(S)-Ser-Lys4-OH, trihydrochloride (Pam3Cys; EMC Microcollections, Tubingen, Germany). TNF-{alpha} and p24 were then assayed by ELISA in supernatants at 24 or 48 h, respectively, using commercial kits (TNF-{alpha}: R&D Systems, Minneapolis, MN; p24: Beckman Coulter, Miami, FL).

Measurement of HIV-1 gene expression by real-time RT-PCR

Total RNA was isolated from spleen as previously described (22). Real-time PCR was performed on an ABI Prism 7900 sequence detection system (Applied Biosystems, Foster City, CA) using SYBR Green PCR Master Mix after reverse transcription of 1 µg of RNA. The relative amount of PCR product was determined by the comparative cycle threshold method as described by the manufacturer, in which each sample was normalized to hypoxanthine guanine phosphoribosyltransferase (hprt) and expressed as a fold increase vs untreated controls. The following primer pairs were used: for hprt, GTTGGTTACAGGCCAGACTTTGTTG (forward) and GAGGGTAGGCTGGCCTATAGvGCT (reverse); for env, GGGGACCAGGGAGAGCATT (forward) and TGGGTCCCCTCCTGAGGA (reverse); for gag, CCAGATGAGAGAACCAAGGG (forward) and TTGTGAAGCTTGCTCGGCTCT (reverse).

Measurement of p24 levels in plasma and ex vivo culture supernatants

At 1 wk postinfection, mice were bled from the tail vein into EDTA-treated vacutainer tubes (BD Biosciences, Franklin Lakes, NJ). Plasma was separated and kept frozen at -40°C to assay for p24 antigenemia by ELISA as described above. To control for individual variations in basal p24 levels (range 200–300 pg/ml) between animals, antigenemia was calculated as the fold increase in p24 vs the preinfection level for each individual mouse. The means and SE were then calculated on the pooled values from all animals assayed. In additional experiments, ex vivo production of p24 by freshly isolated spleens from infected and control mice was assessed by incubating single cell suspensions (5 x 106/ml) for 48 h at 37°C in culture medium as previously described (22).

Statistical analysis

Nonparametric statistical analysis was determined by two-tailed, Mann-Whitney t test at 95% confidence intervals.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
Transgenic spleen cells stimulated with M. tuberculosis orM. avium induce HIV-1 p24 expression in vitro

To assess the ability of live mycobacteria to stimulate HIV-1 expression in vitro, we exposed Tg spleen cells to different doses of a virulent (H37Rv) or avirulent (H37Ra) strain of M. tuberculosis or M. avium and measured p24 production in supernatants 48 h later. As shown in Fig. 1A, all three mycobacterial isolates stimulated comparable p24 levels. Heat killing of the mycobacteria did not diminish the levels of p24 induced in vitro (Fig. 1B), arguing that infection of host cells by live bacteria is not required for HIV-1 induction. Similar results to those shown in Fig. 1 were observed when highly enriched peritoneal macrophages were used instead of bulk spleen cells (data not shown).



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 1. Mycobacteria induce HIV-1 expression in Tg spleen cells in vitro. A, HIV-1-Tg spleen cells were exposed to different bacterial doses of either the virulent H37Rv or avirulent H37Ra strains of M. tuberculosis or a virulent 2-151 SmT strain of M. avium. B, Similar cultures were exposed to live or heat-killed H37Rv mycobacteria. After 48 h, p24 was measured in supernatants by ELISA. The experiment shown is representative of three performed. *, Values significantly different (p < 0.01) from those obtained from unexposed control cells.

 
TLR2 interaction is required for the induction of HIV-1 p24 by mycobacterial components as well as live bacteria in vitro

Because mycobacteria have previously been shown to synthesize molecules that can stimulate cellular function through TLR2 (13), we hypothesized that such TLR2 ligands present in the heat-killed mycobacteria were responsible for the induction of p24 observed. To test this concept, we generated HIV-1 Tg mice deficient in TLR2 by crossing HIV-1 Tg animals with TLR2 knockout mice. Consistent with their expected phenotype, these Tg/TLR2-/-, in contrast to Tg/TLR2+/+ animals, failed to produce TNF-{alpha} when stimulated with a known nonmycobacterial TLR2 ligand (the synthetic lipoprotein Pam3Cys) while responding normally to the TLR4 ligand, LPS (Fig. 2B). Similarly, while both Pam3Cys and LPS induced p24 production from Tg/TLR2+/+ spleen cells in vitro, the response to Pam3Cys (but not LPS) was completely ablated in the Tg/TLR2-/- cells arguing that TLR2 signaling is a potent stimulus for HIV-1 induction (Fig. 2A).



View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 2. TLR2 is required for HIV-1 induction by mycobacterial components as well as live bacteria in vitro. A and B, Spleen cells from Tg/TLR2+/+ ({blacksquare}) or Tg/TLR2-/- ({square}) mice were left untreated (media) or exposed to mycobacterial components (CFP, PIM, or MAg = 10 µg/ml), or bacterial stimuli (Pam3Cys or LPS = 100 ng/ml). C and D, Similar cultures were exposed to different doses of live M. tuberculosis (H37Rv strain) or M. avium. p24 (A and C) and TNF-{alpha} levels (B and D) were measured in the supernatants at 48 and 24 h, respectively. The means ± SE of measurements from quadruplicates wells are shown. The experiment shown was performed twice with similar results. *, Values significantly different (p < 0.01) between exposed and unexposed cultures.

 
When tested in the same assay, the purified M. tuberculosis cell wall component PIM also stimulated a p24 response (Fig. 2A) which was TLR2-dependent, consistent with its previously described activity as a TLR2 ligand (20). Importantly, the p24 responses to unfractionated mycobacterial preparations such as CFP from M. tuberculosis and MAg were also found to be completely abolished in Tg/TLR2-/- spleen cells, suggesting that HIV-1 induction by mycobacteria occurs predominantly through TLR2 interaction (Fig. 2A). Indeed, a similar total dependency on TLR2 was observed when the same analysis was repeated using live mycobacteria instead of bacterial components (Fig. 2C). Interestingly, while the p24 response to the live pathogen was inhibited, Tg/TLR2-/- spleen cells still produced significant quantities of TNF-{alpha} (Fig. 2D) as well as a 3- to 6-fold elevation in TNF-{alpha} mRNA (data not shown). These data suggest the involvement of other TLR and/or the existence of alternative pathways for TNF-{alpha} induction by mycobacteria. In support of the latter possibility, a reduced but nevertheless significant TNF-{alpha} response was detected when splenocytes from MyD88-/- mice were exposed to the same live bacterial stimulus (data not shown).

Mycobacterial-induced HIV-1 activation in vivo is totally dependent on TLR2

We have previously shown that infection of Tg mice with M. avium results in up-regulated expression of HIV-1 mRNA and p24 protein (10). To determine whether TLR2 in addition to its role in vitro is critical for the induction of HIV-1 by mycobacteria in vivo, we infected both Tg/TLR+/+ and Tg/TLR2-/- mice i.p. with M. avium and compared virus expression 1 wk later. At this time point, the TLR2-deficient animals displayed a small, but significant, increase in splenic bacterial CFU vs the TLR2-sufficient mice (Fig. 3A). As a control for the experiment, Tg/TLR+/+ and Tg/TLR2-/- animals were infected with T. gondii, a pathogen that also induces HIV-1 transgene expression but which appears to trigger APC function by a TLR2-independent mechanism (24). As shown in Fig. 3B, M. avium infection induced a >2.0-fold elevation in plasma p24 levels in Tg/TLR2+/+ animals but no detectable increase in the Tg/TLR2-/- mice. Similarly, M. avium infection triggered a significant 3.0-fold augmentation in ex vivo p24 production by spleen cells from TLR2-sufficient mice, but again no apparent increase in the TLR2-deficient animals (Fig. 3C). Finally, whereas spleens from M. avium-infected Tg/TLR2+/+ showed significant elevations in both env and gag mRNA expression, no gene induction was evident in the same tissue from TLR2-deficient animals despite the increased in vivo bacterial load (Fig. 3D). Importantly, T. gondii also triggered increases in p24 production and viral mRNA levels in the TLR2-sufficient animals, while no difference in HIV-1 expression was observed in the Tg/TLR2-/- mice (Fig. 3, B–D). The latter finding confirms that the Tg/TLR2-/- animals do not have a generalized defect in their HIV-1 response to microbial challenge.



View larger version (40K):
[in this window]
[in a new window]
  		FIGURE 3. In vivo mycobacterial-induced HIV-1 expression is critically dependent on TLR2. A, Bacterial loads in spleens of Tg/TLR2+/+ and Tg/TLR2-/- mice at 1 wk postinfection with M. avium. B, Plasma p24 levels in Tg/TLR2+/+ and Tg/TLR2-/- mice 1 wk following inoculation with saline, M. avium, or T. gondii. The data shown are the ratios between the prebleed and postinfection values as described in Materials and Methods. C, Ex vivo p24 production by splenocytes from the same groups of mice shown in B measured at 48 h of culture. D, env and gag mRNA levels in spleens of M. avium- and T. gondii-infected Tg/TLR2+/+ and Tg/TLR2-/- mice as a ratio with saline-injected control mice as determined by real-time RT-PCR (see Materials and Methods). Bars in each panel are means ± SE of measurements on four individual mice. The experiments shown were performed twice with similar results. *, Values significantly different (p < 0.05) from uninfected controls values (B and C) or between measurements on Tg/TLR2+/+ vs Tg/TLR2-/- animals (A and D).

 
Previous studies have established the ability of TLR ligands such as LPS and CpG-DNA to activate HIV expression in virus-infected, transfected, or transgenic cells (11, 25). In the present report, we have used a transgenic mouse model to investigate the role of TLR signaling in the in vivo induction of proviral gene expression by live mycobacterial pathogens frequently associated with HIV-1 infection in humans. Although both TLR2 and TLR4 ligands were capable of triggering an HIV-1 response in transgenic cells in vitro, the absence of TLR2 was sufficient to completely ablate HIV-1 expression induced by live M. tuberculosis and M. avium in vitro and by M. avium infection in vivo. This profound effect of TLR2 deficiency is unlikely to be the result of a loss in TNF-{alpha} production, because Tg/TLR2-/- cells showed only a partial impairment in the secretion of that cytokine. Moreover, the addition of neutralizing anti-TNF-{alpha} Abs failed to inhibit mycobacterial-induced p24 production in vitro and no stimulation of p24 synthesis was observed when exogenous TNF-{alpha} at concentrations as high as 10 ng/ml was added to Tg spleen cell cultures (data not shown).

Recent studies have shown that mycobacteria contain ligands capable of triggering several TLR in addition to TLR2 (reviewed in Ref.13). For example, the mycobacterial glycolipids PIM4–6 have been demonstrated to be TLR4 agonists (18) while mycobacterial DNA in common with other bacterial DNA should contain CpG oligonucleotide motifs able to stimulate TLR9 (reviewed in Ref.26). Moreover, we and our colleagues (11) have recently demonstrated additive effects of TLR2, TLR4, and TLR9 agonists on HIV-1 expression in transgenic spleen cells in vitro. The finding reported in this study that the induction of HIV-1 by live mycobacteria both in vitro and in vivo is totally dependent on TLR2 suggests that mycobacterial TLR2 ligands such as PIM1,2, lipoarabinomannan, and the 19-kDa lipoprotein are the dominant TLR agonists presented to APC by live bacteria. However, because Tg/TLR2-/- spleen cells stimulated with mycobacteria generated a significant TNF-{alpha} response while totally defective in p24 production, it is also possible that on a quantitative basis TLR2 ligands may preferentially trigger the pathway(s) leading to HIV-1 LTR activation as opposed to proinflammatory cytokine production. Several examples of such associations between specific TLR triggering and differential effector responses have now been documented (20, 27). Because TNF-{alpha} production is retained in TLR2-deficient mice, it is possible that TLR2, in addition to triggering NF-{kappa}B, stimulates an NF-{kappa}B-independent pathway essential for the induction of the Tg LTR. Indeed, a number of transcription factors distinct from NF-{kappa}B have previously been shown to participate in HIV LTR induction in infected human cells (reviewed in Ref.28).

Although studies in TLR2-/- mice have established a role for this receptor in host resistance to both M. tuberculosis and M. avium (Ref.17 and C. Feng, C. Scanga, C. Collazo-Custodio, A. Cheever, S. Hieny, P. Caspar, and A. Sher, manuscript in preparation) in each case, the effect of TLR2 deficiency is partial either manifesting itself only at high bacterial inocula (17) or resulting in delayed mortality relative to MyD88-deficient animals (C. Feng, C. Scanga, C. Collazo-Custodio, A. Cheever, S. Hieny, P. Caspar, and A. Sher, manuscript in preparation). On the basis of this evidence, one can speculate that it may be possible to design interventions targeting TLR2 that interfere with M. tuberculosis-induced HIV-1 expression without jeopardizing host control of bacterial infection. Further studies using aerogenic infection of Tg/TLR2-/- mice with M. tuberculosis are planned to systematically investigate the differential effects of TLR2 deficiency on host resistance and HIV-1 induction with the goal of exploring this strategy.


   Acknowledgments
 
We are grateful to Drs. Douglas T. Golenboch and Shizuo Akira for providing the TLR2 KO mice; Drs. Carl Feng, Warwick Britton, and Julio Aliberti for helpful discussions; and Drs. Hana Golding, Karen Elkins, and Gene Shearer for critical review of this manuscript.


   Footnotes
 
1 This work was supported in part by the National Institutes of Health Intramural AIDS Targeted Antiviral Program. Back

2 Address correspondence and reprint requests to Dr. André Báfica, Immunobiology Section, Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Building 50, Room 6146, 50 South Drive, Bethesda, MD 20892. E-mail address: abafica@niaid.nih.gov Back

3 Abbreviations used in this paper: Tg, transgenic; LTR, long-terminal repeat; TLR, Toll-like receptor; CFP, culture filtrate protein; PIM, phosphatidylinositol mannoside; MAg, soluble M. avium extract. Back

Received for publication May 1, 2003. Accepted for publication June 6, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Collins, K. R., M. E. Quinones-Mateu, Z. Toossi, E. J. Arts. 2002. Impact of tuberculosis on HIV-1 replication, diversity, and disease progression. AIDS Rev. 4:165.[Medline]
  2. Del Amo, J., A. S. Malin, A. Pozniak, K. M. De Cock. 1999. Does tuberculosis accelerate the progression of HIV disease: evidence from basic science and epidemiology. AIDS 13:1151.[Medline]
  3. Whalen, C., C. R. Horsburgh, D. Hom, C. Lahart, M. Simberkoff, J. Ellner. 1995. Accelerated course of human immunodeficiency virus infection after tuberculosis. Am. J. Respir. Crit. Care Med. 151:129.[Abstract]
  4. Goletti, D., D. Weissman, R. W. Jackson, N. M. Graham, D. Vlahov, R. S. Klein, S. S. Munsiff, L. Ortona, R. Cauda, A. S. Fauci. 1996. Effect of Mycobacterium tuberculosis on HIV replication: role of immune activation. J. Immunol. 157:1271.[Abstract]
  5. Zang, Y., K. Nakata, M. Weiden, W. N. Rom. 1995. Mycobacterium tuberculosis enhances human immunodeficiency virus 1 replication by transcriptional activation at the long terminal repeat. J. Clin. Invest. 95:2324.
  6. Shattock, R. J., J. S. Friedland, G. E. Griffin. 1994. Phagocytosis of Mycobacterium tuberculosis modulates human immunodeficiency virus replication in human monocytic cells. J. Gen. Virol. 75:849.[Abstract/Free Full Text]
  7. Bernier, R., B. Barbeau, M. Olivier, M. J. Tremblay. 1998. Mycobacterium tuberculosis mannose-capped lipoarabinomannan can induce NF-{kappa}B-dependent activation of human immunodeficiency virus type 1 long terminal repeat in T cells. J. Gen. Virol. 79:1353.[Abstract]
  8. Gazzinelli, R. T., A. Sher, A. Cheever, S. Gerstberger, M. A. Martin, P. Dickie. 1996. Infection of human immunodeficiency virus 1 transgenic mice with Toxoplasma gondii stimulates proviral transcription in macrophages in vivo. J. Exp. Med. 183:1645.[Abstract/Free Full Text]
  9. Freitag, C., C. Chougnet, M. Schito, K. A. Near, G. M. Shearer, C. Li, J. Langhorne, A. Sher. 2001. Malaria infection induces virus expression in human immunodeficiency virus transgenic mice by CD4 T cell-dependent immune activation. J. Infect. Dis. 183:1260.[Medline]
  10. Doherty, T. M., C. Chougnet, M. Schito, B. K. Patterson, C. Fox, G. M. Shearer, G. Englund, A. Sher. 1999. Infection of HIV-1 transgenic mice with Mycobacterium avium induces the expression of infectious virus selectively from a Mac-1-positive host cell population. J. Immunol. 163:1506.[Abstract/Free Full Text]
  11. Equils, O., M. L. Schito, H. Karahashi, Z. Madak, A. Yarali, K. S. Michelsen, A. Sher, M. Arditi. 2003. TLR-2 and TLR-9 signaling results in HIV-LTR transactivation and HIV replication in HIV-1 transgenic mouse spleen cells: implications of simultaneous activation of TLRs on HIV replication. J. Immunol. 170:5159.[Abstract/Free Full Text]
  12. Stenger, S., R. L. Modlin. 2002. Control of Mycobacterium tuberculosis through mammalian Toll-like receptors. Curr. Opin. Immunol. 14:452.[Medline]
  13. Heldwein, K. A., M. J. Fenton. 2002. The role of Toll-like receptors in immunity against mycobacterial infection. Microbes Infect. 4:937.[Medline]
  14. Underhill, D. M., A. Ozinsky, K. D. Smith, A. Aderem. 1999. Toll-like receptor-2 mediates mycobacteria-induced proinflammatory signaling in macrophages. Proc. Natl. Acad. Sci. USA 96:14459.[Abstract/Free Full Text]
  15. Means, T. K., S. Wang, E. Lien, A. Yoshimura, D. T. Golenbock, M. J. Fenton. 1999. Human Toll-like receptors mediate cellular activation by Mycobacterium tuberculosis. J. Immunol. 163:3920.[Abstract/Free Full Text]
  16. Lien, E., T. J. Sellati, A. Yoshimura, T. H. Flo, G. Rawadi, R. W. Finberg, J. D. Carroll, T. Espevik, R. R. Ingalls, J. D. Radolf, D. T. Golenbock. 1999. Toll-like receptor 2 functions as a pattern recognition receptor for diverse bacterial products. J. Biol. Chem. 274:33419.[Abstract/Free Full Text]
  17. Reiling, N., C. Holscher, A. Fehrenbach, S. Kroger, C. J. Kirschning, S. Goyert, S. Ehlers. 2002. Cutting edge: Toll-like receptor (TLR)2- and TLR4-mediated pathogen recognition in resistance to airborne infection with Mycobacterium tuberculosis. J. Immunol. 169:3480.[Abstract/Free Full Text]
  18. Abel, B., N. Thieblemont, V. J. Quesniaux, N. Brown, J. Mpagi, K. Miyake, F. Bihl, B. Ryffel. 2002. Toll-like receptor 4 expression is required to control chronic Mycobacterium tuberculosis infection in mice. J. Immunol. 169:3155.[Abstract/Free Full Text]
  19. Brightbill, H. D., D. H. Libraty, S. R. Krutzik, R. B. Yang, J. T. Belisle, J. R. Bleharski, M. Maitland, M. V. Norgard, S. E. Plevy, S. T. Smale, et al 1999. Host defense mechanisms triggered by microbial lipoproteins through Toll-like receptors. Science 285:732.[Abstract/Free Full Text]
  20. Jones, B. W., T. K. Means, K. A. Heldwein, M. A. Keen, P. J. Hill, J. T. Belisle, M. J. Fenton. 2001. Different Toll-like receptor agonists induce distinct macrophage responses. J. Leukocyte Biol. 69:1036.[Abstract/Free Full Text]
  21. Takeuchi, O., K. Hoshino, T. Kawai, H. Sanjo, H. Takada, T. Ogawa, K. Takeda, S. Akira. 1999. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. >Immunity 11:443.[Medline]
  22. Schito, M. L., P. E. Kennedy, R. P. Kowal, E. A. Berger, A. Sher. 2001. A human immunodeficiency virus-transgenic mouse model for assessing interventions that block microbial-induced proviral expression. J. Infect. Dis. 183:1592.[Medline]
  23. Doherty, T. M., A. Sher. 1998. IL-12 promotes drug-induced clearance of Mycobacterium avium infection in mice. J. Immunol. 160:5428.[Abstract/Free Full Text]
  24. Scanga, C. A., J. Aliberti, D. Jankovic, F. Tilloy, S. Bennouna, E. Y. Denkers, R. Medzhitov, A. Sher. 2002. Cutting edge: MyD88 is required for resistance to Toxoplasma gondii infection and regulates parasite-induced IL-12 production by dendritic cells. J. Immunol. 168:5997.[Abstract/Free Full Text]
  25. Pomerantz, R. J., M. B. Feinberg, D. Trono, D. Baltimore. 1990. Lipopolysaccharide is a potent monocyte/macrophage-specific stimulator of human immunodeficiency virus type 1 expression. J. Exp. Med. 172:253.[Abstract/Free Full Text]
  26. Cheadle, E. J., A. M. Jackson. 2002. Bugs as drugs for cancer. Immunology 107:10.[Medline]
  27. Hirschfeld, M., J. J. Weis, V. Toshchakov, C. A. Salkowski, M. J. Cody, D. C. Ward, N. Qureshi, S. M. Michalek, S. N. Vogel. 2001. Signaling by Toll-like receptor 2 and 4 agonists results in differential gene expression in murine macrophages. Infect. Immun. 69:1477.[Abstract/Free Full Text]
  28. Pereira, L. A., K. Bentley, A. Peeters, M. J. Churchill, N. J Deacon. 2000. A compilation of cellular transcription factor interactions with the HIV-1 LTR promoter. Nucleic Acids Res. 28:3.



This article has been cited by other articles:


Home page
 BloodHome page
Y. Ogawa, T. Kawamura, T. Kimura, M. Ito, A. Blauvelt, and S. Shimada
Gram-positive bacteria enhance HIV-1 susceptibility in Langerhans cells, but not in dendritic cells, via Toll-like receptor activation
Blood, May 21, 2009; 113(21): 5157 - 5166.
[Abstract] [Full Text] [PDF]

Home page
 Antimicrob. Agents Chemother.Home page
R. T. Trifonova, G. F. Doncel, and R. N. Fichorova
Polyanionic Microbicides Modify Toll-Like Receptor-Mediated Cervicovaginal Immune Responses
Antimicrob. Agents Chemother., April 1, 2009; 53(4): 1490 - 1500.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
J. Sun, T. Soos, V. N. KewalRamani, K. Osiecki, J. H. Zheng, L. Falkin, L. Santambrogio, D. R. Littman, and H. Goldstein
CD4-Specific Transgenic Expression of Human Cyclin T1 Markedly Increases Human Immunodeficiency Virus Type 1 (HIV-1) Production by CD4+ T Lymphocytes and Myeloid Cells in Mice Transgenic for a Provirus Encoding a Monocyte-Tropic HIV-1 Isolate
J. Virol., February 15, 2006; 80(4): 1850 - 1862.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
A. Bafica, C. A. Scanga, C. G. Feng, C. Leifer, A. Cheever, and A. Sher
TLR9 regulates Th1 responses and cooperates with TLR2 in mediating optimal resistance to Mycobacterium tuberculosis
J. Exp. Med., December 19, 2005; 202(12): 1715 - 1724.
[Abstract] [Full Text] [PDF]

Home page
 Antimicrob. Agents Chemother.Home page
M. G. Netea, J. W. M. Van der Meer, R. P. Sutmuller, G. J. Adema, and B.-J. Kullberg
From the Th1/Th2 Paradigm towards a Toll-Like Receptor/T-Helper Bias
Antimicrob. Agents Chemother., October 1, 2005; 49(10): 3991 - 3996.
[Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Zhang, G. Li, A. Bafica, M. Pantelic, P. Zhang, H. Broxmeyer, Y. Liu, L. Wetzler, J. J. He, and T. Chen
Neisseria gonorrhoeae Enhances Infection of Dendritic Cells by HIV Type 1
J. Immunol., June 15, 2005; 174(12): 7995 - 8002.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
J. E. Comer, C. L. Galindo, A. K. Chopra, and J. W. Peterson
GeneChip Analyses of Global Transcriptional Responses of Murine Macrophages to the Lethal Toxin of Bacillus anthracis
Infect. Immun., March 1, 2005; 73(3): 1879 - 1885.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
E. Schlaepfer, A. Audige, B. von Beust, V. Manolova, M. Weber, H. Joller, M. F. Bachmann, T. M. Kundig, and R. F. Speck
CpG Oligodeoxynucleotides Block Human Immunodeficiency Virus Type 1 Replication in Human Lymphoid Tissue Infected Ex Vivo
J. Virol., November 15, 2004; 78(22): 12344 - 12354.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Bafica, C. A. Scanga, M. Schito, D. Chaussabel, and A. Sher
Influence of Coinfecting Pathogens on HIV Expression: Evidence for a Role of Toll-Like Receptors
J. Immunol., June 15, 2004; 172(12): 7229 - 7234.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
M. G. Netea, C. van der Graaf, J. W. M. Van der Meer, and B. J. Kullberg
Toll-like receptors and the host defense against microbial pathogens: bringing specificity to the innate-immune system
J. Leukoc. Biol., May 1, 2004; 75(5): 749 - 755.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
A. Bafica, C. A. Scanga, O. Equils, and A. Sher
The induction of Toll-like receptor tolerance enhances rather than suppresses HIV-1 gene expression in transgenic mice
J. Leukoc. Biol., March 1, 2004; 75(3): 460 - 466.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Báfica, A.
Right arrow Articles by Sher, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Báfica, A.
Right arrow Articles by Sher, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS