|
|
||||||||
Division of Cell Biology and Immunology, Department of Pathology, University of Utah School of Medicine, Salt Lake City, UT 84132
| Abstract |
|---|
|
|
|---|
integrins, except it lacks a functional metal ion-dependent adhesion site domain and is expressed without an
-chain partner. The majority of the Pactolus protein is held within the cell in dense granules in a highly glycosylated form. This intracellular form of Pactolus can be released to the cell surface following inflammatory activation or ligation of Pactolus on the cell surface. In addition, intracellular Pactolus translocates to the neutrophil surface following induction of apoptosis. Neutrophil activation studies suggest that Pactolus does not serve as an activating or phagocytic receptor for the neutrophil. To further define the function of Pactolus, a Pactolus-null mouse was generated. Pactolus-deficient animals mature appropriately and possess normal numbers of neutrophils, display appropriate migration into sites of inflammation, and combat introduced infections efficiently. These data suggest that Pactolus does not function as a neutrophil phagocytic or adhesion receptor, but may instead serve as a sugar-bearing ligand for lectin recognition by other cells. | Introduction |
|---|
|
|
|---|
integrin-like protein found on mature and immature murine neutrophils (1). It exhibits close homology, in the extracellular region, to the
2 and
7 integrin subunits (2). However, unlike the
2 integrin subunit, Pactolus is missing the metal ion-dependent adhesion site domain that is important for ligand binding and subunit interactions (3, 4, 5, 6, 7). All integrins are heterodimers consisting of
and
subunits. An
-chain partner for Pactolus has not been found, suggesting that Pactolus is expressed as a monomer on the cell surface. The predicted size of the full length Pactolus peptide is 81,000 Mr; however, extensive glycosyl modifications provide for a final mature protein of
130,000 Mr (1). The pactolus gene produces two distinct transcripts: one that predicts a truncated form, and a second that produces the transmembrane protein. The truncated form appears to be rapidly degraded upon translation (if, indeed, it is translated), whereas the transmembrane form has a long half-life (>12 h). The neutrophil is the major, if not exclusive, mature cell that transcribes the pactolus gene and produces the protein. Two distinct alleles of pactolus exist: that of the C57BL/6 animal specify production for only the transmembrane form, whereas those of BALB/c, C3H/HeJ, and 129/sv produce both the full-length and truncated transcripts (1).
Stimulation of neutrophils with PMA or Pactolus antiserum can induce an immediate increase in Pactolus surface expression independent of protein synthesis. This suggests that Pactolus is stored in an intracellular compartment and, upon stimulation, is exocytosed to the surface of the neutrophil. This type of response is similar to that of other neutrophil activation receptors, such as human CR1 and human/mouse Mac-1, both of which serve as neutrophil phagocytic receptors (8, 9, 10).
Neutrophils play a critical role during an inflammatory response, because they are the first major cell type recruited to a site of infection (for review, see Ref. 11). When an infection occurs, neutrophils migrate from the blood to the tissue site. This process involves activation of both the endothelial cell layer as well as the circulating neutrophils, relying upon the selectins and integrins (and their respective ligands) for extravasations (12). The selectins are instrumental for the tethering and rolling of the neutrophils on the endothelial cells, whereas the integrins are involved in tight adherence and extravasations into the tissue matrix (13). The neutrophils then follow a gradient of cytokines, chemokines, and bacterial/viral products to the site of infection. When neutrophils arrive at the focus of infection, they are in a primed state and can follow several options to clear the infection. They can degranulate, releasing proteases, cytokines, and superoxides, creating an environment inhospitable for the infective agent. The primed neutrophil can also phagocytose the pathogen, usually making use of complement and Ab deposited on the pathogen surface as opsonins for the relevant neutrophil receptors (14). Many such recruited and activated neutrophils are in excess and consequently undergo apoptosis and are removed from the site via phagocytosis by macrophages (15). This cleanup step can make use of a number of receptor/ligand interactions between the neutrophil and macrophage (some well-characterized, some not) (16, 17, 18), removing both apoptotic and necrotic cells (19).
Our previous analyses of Pactolus suggested that it may function as an activating receptor for neutrophils, perhaps aiding in cell migration and/or phagocytosis of pathogens. It was with this model in mind that we analyzed the expression of Pactolus by migrating neutrophils and the cellular responses to Pactolus ligation. Surprisingly we found that Pactolus did not appear to be involved in any neutrophil function, including migration, cross-linking activation, or phagocytosis. In addition, Pactolus-deficient animals demonstrated normal neutrophil functions, including migration and response to bacterial infections. These data leave open the possibility that Pactolus instead may serve as a ligand to mark dead and dying neutrophils for elimination.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 and BALB/c mice were obtained from the National Cancer Institute, National Institutes of Health (Bethesda, MD), and 129/sv mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Murine neutrophils were obtained either from the bone marrow or by lavage after peritoneal cavity recruitment. Neutrophils were stimulated with 100 ng/ml PMA, 100 µM fMLP, or 5 µM leukotriene B4 (LTB4;4 Sigma-Aldrich, St. Louis, MO). Cells were stimulated with Bac Pac (Pactolus polyclonal Ab) or a preimmune control serum at a 1/500 dilution.
Neutrophil isolation
Bone marrow neutrophils were isolated following the protocol previously described (20). Briefly, bone marrow tissue was flushed from murine femurs with cold PBS. The RBC were lysed by treating the marrow with ACK lysing buffer (0.15 M NH4Cl, 1 mM KHCO3, and 0.1 mM Na2EDTA) for 4 min on ice. After two washes, the cells were resuspended in PBS and layered onto a Percoll (Amersham Pharmacia Biotech, Arlington Heights, IL) gradient consisting of equal volumes of the different densities of 1.080 g/ml (lower layer) and 1.065 g/ml (upper layer). The gradients were then centrifuged at 1000 x g for 20 min at 4°C. Cells were visible as a pellet (most mature neutrophils) and at the interface of the two densities (less mature neutrophils). Cells were removed and centrifuged in PBS to remove the Percoll and were ready for use. Unless specified, all gradient dilutions were made following the protocol from Amersham Pharmacia Biotech using 0.15 M NaCl. Neutrophils were obtained from the peritoneal cavity by recruitment. Mice were injected with either 1 ml of a 1% solution of oyster glycogen or 0.5 ml of a 3% thioglycolate solution into the peritoneal cavity. After 4 h a peritoneal lavage was performed. The lavage fluid consisted of primarily neutrophils (21) and was confirmed by cytospin staining.
FACS analysis
Mouse bone marrow cells and peritoneal neutrophils were isolated. RBC were lysed as described previously. Some 1 x 106 cells were used for each staining reaction. Cells were stimulated with agonists (PMA, fMLP, and LTB4) for 20 min at 37°C. The rabbit anti-Bac Pac (1) was detected using an FITC-conjugated goat anti-rabbit Ig Ab (Cappel Laboratories, West Chester, PA). The two other Abs used to FACS were Mac-1 (clone M1/70; BD PharMingen, San Diego, CA) and L-selectin (clone MEL-14; eBioscience, San Diego, CA). Annexin V protein directly conjugated to PE (BD Biosciences, Mountain View, CA) was used to identify external phosphatidylserine, the result of membrane inversion. The dye 7-amino-actinomycin D (7AAD) (BD Biosciences), which is detected in the far red FL3 spectrum, was used to discriminate permeable, 7-AAD-positive cells in the later stages of apoptosis and death, from those that still possess intact membranes (alive or early in apoptosis) that are not permeable to the dye (7-AAD-negative).
Surface iodination
Oyster glycogen and thioglycolate neutrophils were isolated from the peritoneal cavity. Cells were surface iodinated using IODO beads (Pierce, Rockford, IL), following the recommended protocol. Some 1 x 106 cells were labeled per reaction with 1 mCi of Na125I/106 cells.
Granule fractionation, marker assay, and Western blot analysis
Granule fractionation was performed using the protocol previously described (22). Neutrophils (3 x 108) were isolated as described and resuspended in disruption buffer (100 mM KCl, 3 mM NaCl, 1 mM ATPNa2, 3.5 mM MgCl2, and 10 mM piperazine N,N'-bis2[ethan-sulfonic acid], pH 7.2) containing 0.5 mM PMSF (Sigma-Aldrich). A two-layer Percoll gradient was set up according to the protocol. Cells were nitrogen cavitated for 5 min at 380 psi using a nitrogen bomb (Parr Instruments, Moline, IL). The cavitate was then centrifuged to remove whole cells and nuclei, and was layered onto a two-layer Percoll gradient. Granules were centrifuged at 37,000 x g for 30 min at 4°C. Fractions were collected from the bottom of the tube. Percoll was removed from the fractions by centrifugation at 100,000 x g for 1.5 h. Each fraction was then assayed for specific granule markers: myeloperoxidase (MPO; azurophilic), gelatinase B (MMP-9), alkaline phosphatase (AP; secretory vesicles), and Pactolus. Fractions were sonicated for 5 min, freeze-thawed twice, then assayed for MPO in a 4/1 dilution of assay buffer to fraction volume (0.2 mg/ml o-dianisidine and 158 µM H2O2 in 50 mM KPO4, pH 6.0) for 5 min. Reactions were performed in triplicate, and absorbance was recorded at 460 nm. AP was assayed following the protocol provided with a phosphatase substrate kit (Pierce). Gelatinase and Pactolus were assayed by Western blot. Fraction samples were separated by SDS-PAGE, blotted to nylon membranes, and probed with Abs against gelatinase (Chemicon, Temecula, CA) or Pactolus (the Bac Pac antiserum) (1). Gelatinase was quantified by densitometer analysis and Multianalyst software (Bio-Rad, Hercules, CA). See below for greater detail for Western blot analysis of the Pactolus protein.
Induced apoptosis and necrosis
Bone marrow cells were isolated from C57BL/6 mouse. Apoptosis was induced by placing the bone marrow samples into a six-well (Ultra Low Attachment Plate; Costar, Cambridge, MA) dish and irradiated with 302-nm UV transilluminator for 10 min, followed by 4-h incubation at 37°C in a 5% CO2 incubator. Necrosis was induced by taking the same bone marrow sample and incubating at 55°C for 15 min, followed by a 3-h culture at 37°C in a 5% CO2 incubator.
Generation and analysis of a Pactolus-deficient mouse
The targeting construct was produced by subcloning two EcoRI fragments of the pactolus gene (8.4 and 6.7 kb) into pSK vector (Stratagene, San Diego, CA) from
phage containing pieces of pactolus (2, 23). The BglII site of exon 5 in the 8.4-kb subclone was changed to a ClaI site by cutting with BglII and inserting a double-stranded oligo containing the ClaI site. The KT3 Lox A plasmid that contained the neomycin gene under the control of the polymerase II promoter was cut with ClaI, and the neomycin fragment was gel-purified, then inserted in the reverse orientation into the new ClaI site of exon 5. The new plasmid containing 15.1 kb of the pactolus gene interrupted by the neomycin gene was linearized by SalI and SpeI, then ligated into the thymidine kinase 1 (TK1)-TK2C vector XhoI and XbaI sites. The resulting plasmid was linearized with NotI for transfection into the embryonic stem (ES) cell line.
ES cell lines were transfected with the linear pactolus gene-targeting construct, then selected for G418 resistance and gancyclovir sensitivity. DNA was isolated from the ES cells and analyzed by Southern blot after digestion with EcoRI (5' probe) or SstI (3' probe). The probes for Southern blots were made by PCR of the either the
phage DNA (for the 5' probe, exon 1, primers 1047 and 860) or pactolus cDNA (for the 3' probe, exon 12, primers 1008 and 1231). An ES cell line derived from the 129/sv strain containing one copy of the pactolus-targeted allele, 2e#6, (as evidenced by Southern blot analysis with both 5' and 3' probes) was injected into blastocysts and implanted in pseudopregnant female mice. One male chimera offspring (85% chimera) was mated to C57BL/6 female mice and was successful for germline transmission of the disrupted gene. The F1 generation, heterozygous for the modified pactolus allele (+/-) was mated to generate the F2 population.
Tail DNA isolation and genotyping
Tail clips (1 cm) were added to 1 ml of tail digestion buffer (0.1 M NaCl, 0.02 M EDTA, 1% SDS, and 0.01 M Tris, pH 8) with 0.2 mg of proteinase K and incubated at 55°C overnight. After the debris settled, 500 µl of supernatant was transferred to a new tube, followed by phenol and chloroform extraction and ethanol precipitation. Nine nanograms of DNA was used per PCR reaction with the genotype primers (1 µg total/10 µl reaction): 863, 1028, and 1052 (primers 1, 2, and 3 in Fig. 7D are primers 863, 1028, and 1052, respectively.) Genotyping PCR reactions used 68°C annealing, 5-s elongation, and 28 cycles. Primers 863f and 1028r made the exon 5 product (95 bp). Primers 1052f and 1028r made the neomycin/exon 5 product (130 bp).
|
Cells were isolated from murine bone marrow with PBS, and total RNA was extracted (24). cDNA synthesis reactions were previously described (25). The PCR reaction were prepared as previously described (25). The 95°C denaturing, 72°C elongation, 1 s for annealing, and denaturing times were kept constant, whereas the annealing temperature, elongation time, number of reaction cycles, and amount of DNA (
200 ng for cDNA and 9 ng for genomic DNA) per reaction varied with the experiment. The actin PCR (product size, 135 bp) required 60°C annealing, 5-s elongation, and 15 cycles, whereas the pactolus PCR required 60°C annealing, 4-s elongation, and 25 cycles. The pactolus PCR product with primers 1001f and 900r (which span exons 34, before the neomycin) was 223 bp, that with primers 803f and 828r (exons 46, over neomycin insertion) was 215 bp, and that with primers 1010f and 1004r (exons 68, after the neomycin insertion) was 407 bp. The primers were as follows (sequence listed 5' to 3'): actin control for equivalent cDNA: primer 62, GTAACAATGCCATGTTCAAT; primer 339, CTCCATCGTGGGCCGCTCTAG; Southern probe PCR primers: primer 1047f, TCCCAAGCAGCTGCCCTTCTG; primer 860r, TTTGCTCCCTGGAGGCCTTG; primer 1008r, TGGCCATCATATCTCTCACAG; primer 1231f, TGCAACTCTGGCTACGCTGG; genotyping primers: primer 863f, CTCTGGCTCTGCGCAAGGCC; primer 1052f, CGCTCGATGTTCAGCCCAAGC; primer 1028r, CGATTCGGCCTGACCTGGAG; and pactolus PCR primers: primer 1001f, CAAGGACAATGTTGAGCACCTG; 900r, CCGCTCGAGACAGCTGCCTCTGGTCCCTC; 803f, CAAAGTGGACTTCCAGCGGACCCAG; 828r, GAGTCCGCAGTCAGCTTCAG; 1010f, GCTTTGGATCCATTGTGAAC; 1004r, TAGGTTTTCACCATCCTTGAG.
Immunoprecipitation and Western blot analysis
Cell fractions were first cleared of Percoll, and total cells were lysed in RIPA solution (50 mM NaCl, 25 mM Tris (pH 7.5), 1 mM EDTA, 0.1% SDS, 1% sodium deoxycholate, 1% Nonidet P-40, 1% BSA, 1 mM PMSF, and complete TM (mini protease inhibitor mixture tablet; Roche, Indianapolis, IN)). Fractions were then precleared with 10 mg of protein G-Sepharose overnight at 4°C. After preclearing, samples were incubated with mAb against Pactolus for 1 h, followed by removal of the Ab-protein complex with protein G-Sepharose for 30 min at 4°C. Absorbed complexes were then washed five times: once with 1 M NaCl and RIPA, twice with RIPA, and twice in a final wash solution (50 mM NaCl, 25 mM Tris (pH 7.5), and 1 mM EDTA). The samples were then boiled under reducing conditions in 2x sample buffer (4x Tris-SDS (pH 6.8), 20% glycerol, 4% SDS, 0.2 M DTT, and 0.012% bromophenol blue) for 5 min before they were loaded onto an 8% Tris-glycine polyacrylamide gel. After electrophoresis, polyvinylidene difluoride (Immobilon-P; Millipore, Bedford, MA) was prepared according to the manufacturers protocol, and the proteins were transferred for 1.25 h at 30 V. After transfer the membranes were soaked in 100% methanol for 30 s and allowed to dry for 20 min. Membranes were then placed into blocking solution (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, and 5% milk) for 15 min, followed by incubation of the membrane with a 1/1000 dilution of rabbit polyclonal Bac Pac Ab or control Ab for 1 h at room temperature. Membranes were then washed twice (10-min machine wash) in Tris-buffered saline-Tween (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, and 0.05% Tween 20). Membranes were then incubated at room temperature with a 1/5000 dilution of goat anti-rabbit HRP (Bio-Rad) in blocking solution for 30 min. Membranes were again washed twice (10-min machine wash) in Tris-buffered saline-Tween, then incubated for 5 min with SuperSignal chemiluminescent substrate (Pierce) and visualized on blue x-ray film.
| Results |
|---|
|
|
|---|
Previous studies of Pactolus have shown that the majority of the mature protein is held within the neutrophil and can be translocated to the cell surface after treatment with PMA or direct ligation with anti-Pactolus polyclonal antiserum (Bac Pac antiserum) (1). The latter finding suggested that interaction of Pactolus with its putative ligand should enhance cell surface expression by translocating the intracellular Pactolus to the cell surface. Using the anti-Pactolus Ab for cell immunofluorescence, we have also found that the majority of Pactolus protein in an unactivated neutrophil is held within intracellular granules (data not shown). To follow up on these data, we first examined the intracellular localization of Pactolus and then evaluated whether neutrophil inflammatory migration resulted in translocation of the intracellular stores of Pactolus to the cell surface.
Neutrophils were isolated from the bone marrow of C57BL/6 mice using a Percoll (Amersham Pharmacia Biotech) centrifugation method for neutrophil isolation. Such cells were then used for granule fractionation (20, 22). The literature conditions described were for human neutrophils; however, similar banding patterns were obtained from mouse bone marrow neutrophils. Isolated neutrophils were placed in relaxation buffer and nitrogen-cavitated using a nitrogen bomb (Parr Instruments). After cavitation, the supernatant was collected and centrifuged over another discontinuous Percoll gradient (22). The gradient was then fractionated and evaluated for the presence of known granule markers MPO, AP, or MMP-9. As shown (Fig. 1), fractionation and separation of AP, MPO, and gelatinase was evident, providing a profile similar to that seen for the analogous human markers (22).
|
Neutrophils can be isolated from bone marrow using a discontinuous Percoll gradient (see Materials and Methods). The bulk of mature neutrophils in the marrow have been defined to reside at the bottom of the gradient, whereas more immature granulocytes are identified at the middle interface and lymphocytes at the top. Mouse marrow was thus fractionated, and cell lysates were analyzed by Western blot. As shown (Fig. 2), the most mature neutrophils (B) were enriched for the high m.w. form of Pactolus compared with the smaller form, whereas the relatively immature granulocytes (M) primarily possessed the smaller form.
|
We next chose to investigate whether the recruitment of neutrophils into a site of inflammation would translocate this intracellular Pactolus to the cell surface, and whether both forms of the protein (130,000 and 98,000 Mr) would be expressed on the cell surface. To accomplish this we used two different neutrophil-recruiting stimuli: injection of either 1% oyster glycogen or 3% thioglycolate into the peritoneal cavity of a naive C57BL/6 mouse (21). Each compound recruits neutrophils into the peritoneal cavity in similar numbers within the same time frame. We reasoned that if neutrophil recruitment used Pactolus ligation (and ligation of Pactolus does induce translocation of the intracellular stores) (1), then elevated levels of Pactolus protein should be present on the surface of the newly recruited peritoneal cavity neutrophils.
Sterile solutions of 1% oyster glycogen or 3% thioglycolate were injected into the peritoneal cavity of C57BL/6 mice. After 4 h, peritoneal lavages were performed, and cells were incubated with or without PMA for 20 min at 37°C in 5% CO2 and analyzed by FACS (Fig. 3A). We have previously shown that PMA promotes the release of intracellular Pactolus to the cell surface. Those cells recruited with oyster glycogen expressed low levels of cell surface Pactolus, in that treatment with PMA resulted in translocation of the intracellular protein to the cell surface. Alternatively, those neutrophils recruited with thioglycolate already expressed Pactolus at the maximum level, in that treatment with PMA had no effect. These recruited cells, with or without PMA, were labeled with Na125I, and the Pactolus proteins were identified by immunoprecipitation. As shown (Fig. 3B), only the 130,000 Mr form of Pactolus was found on the cell surface. There were virtually identical quantities of the protein on the surface of the control or PMA-treated, thioglycolate-recruited cells, whereas the oyster glycogen-recruited cells required PMA-mediated translocation for maximal Pactolus expression. As a control, the level of Mac-1 staining was equal in both the oyster glycogen and thioglycolate-recruited neutrophils (and could not be increased with PMA treatment), suggesting the Mac-1 intracellular stores were fully translocated to the cell surface during neutrophil migration (data not shown).
|
Agonists involved in the exocytosis of Pactolus
The preceding data suggested that the recruitment of neutrophils into the peritoneal cavity did not use Pactolus as a migration receptor, because the cells recruited with oyster glycogen expressed basal levels of Pactolus after recruitment. However, the cells recruited with thioglycolate did express high levels of Pactolus, suggesting that these two agents are not identical in their effects in the animal. During the course of an immune response, chemokines and other inflammatory products are released to enhance the recruitment and activation of neutrophils and macrophages (26). If Pactolus expression was not elevated by the process of recruitment, would it be increased via neutrophil activation? Incubation of bone marrow neutrophils in culture with thioglycolate did not alter the cell surface expression level of Pactolus (data not shown), suggesting the translocation of Pactolus on the recruited cells was not due to neutrophil/thioglycolate interactions. To test whether a product released by a cell other than the neutrophil was responsible for the Pactolus translocation, a peritoneal wash of an animal previously treated with thioglycolate was incubated with bone marrow cells (
40% of which are neutrophil precursors and synthesize Pactolus). Such treated cells demonstrated an increase in Pactolus staining and a decrease in L-selectin staining (compared with the naive wash control; Fig. 4A). These data suggested a soluble product in the irritated peritoneal cavity was responsible for the translocation of Pactolus.
|
Both mast cells and macrophages produce a variety of products after activation that are highly stimulatory for the inflammatory process (27). Therefore, total bone marrow cells were treated with a number of different compounds, and the expression of Pactolus was compared with that of PMA-treated controls. One of the most potent inflammatory products found that translocated intracellular Pactolus to the surface was LTB4. LTB4 stimulates neutrophil chemotaxis, enhances cell-cell contacts, and stimulates neutrophils to become activated, leading to degranulation and the release of enzymes, mediators, and superoxides (28). Mast cells synthesize and release LTB4 after activation/degranulation. Bone marrow was isolated from a C57BL/6 mouse and stimulated with LTB4 or fMLP. Pactolus, Mac-1, and L-selectin were then analyzed by FACS (Fig. 4C). LTB4 was able to increase Pactolus movement to the surface of the neutrophil. fMLP had a minor effect on Pactolus expression of such cells. Mac-1 was also increased on the surface after stimulation with LTB4 and fMLP, similar to Pactolus. L-selectin expression was unchanged in the presence of both compounds.
The same experiment as that described above was then performed upon mature neutrophils that had been recruited into the peritoneal cavity with oyster glycogen (Fig. 4D). Treatment of such cells with LTB4 and fMLP did demonstrate an increased level of Pactolus cell surface staining. The same was not evident for Mac-1, suggesting that Mac-1 had already translocated to the cell surface in the process of neutrophil migration. Interestingly, L-selectin was shed from such cells after LTB4 and fMLP treatment. These data (and those previously reported) (1) suggest that Pactolus and Mac-1 reside in different intracellular granules. In addition they suggest that thioglycolate treatment of the peritoneal cavity results in a higher level of inflammatory activation than does oyster glycogen treatment.
Use of pathway inhibitors to block the translocation of Pactolus
We have shown that Pactolus can be translocated to the cell surface by at least two pathways. The first involves direct ligation of the protein itself with anti-Pactolus Bac Pac antiserum, and the second requires cellular activation pathways such as LTB4-mediated signaling. Are such pathways functionally distinct? To explore this issue we incubated C57BL/6 bone marrow cells in pertussis toxin (PTXN) for 3 h, followed by stimulation with preimmune serum, Bac Pac antiserum, or LTB4. The LTB4 receptor is coupled to a PTXN-sensitive G
protein (29). Cells were then analyzed by FACS to determine whether the increase in Pactolus expression was blocked (Fig. 5). The non-PTXN-treated cells demonstrated elevated levels of Pactolus staining in cells treated with either LTB4 or Bac Pac antiserum. However, the PTXN-treated cells did not demonstrate elevated Pactolus staining with LTB4 treatment, but did with Bac Pac activation, suggesting that PTXN is unable to block this pathway. The far right panel is an overlay of Pactolus staining of the Bac Pac-stimulated cells in the absence or the presence of PTXN. The two populations overlap, suggesting that PTXN does not block Bac Pac-activated cells from translocating intracellular Pactolus.
|
Translocation of Pactolus to the cell surface after apoptosis
The translocation of Pactolus protein to the cell surface after treatment with staurosporine could be due to the direct inhibition of kinase activities and/or the induction of apoptosis of the treated cells. To test the latter hypothesis, we used a standard apoptosis-inducing protocol, UV light, followed by a 3-h incubation in culture. For this assay we used total bone marrow cells,
50% of which are Pactolus-expressing granulocyte precursors. As a contrast, we induced cell necrosis by incubating cells at 55°C for 15 min. Cells were also cultured at 37°C for 3 h in a 5% CO2 incubator as a control. After apoptosis/necrosis induction, cells were stained with either preimmune serum or anti-Pactolus antiserum (Bac Pac), followed by an FITC-bound anti-rabbit anti-serum (FL1) and were counterstained with PE-labeled annexin V (FL2) to test for the presence of phosphatidylserine on the cell membrane (indicative of the membrane inversion observed on cells in the early stages of apoptosis). Cells were also treated with the dye 7AAD, which discriminates between intact, nonpermeable cells and those that take up the dye due to membrane leakage. This dye is detected in FL3.
UV-treated and control cells were first split into 7AAD-negative and -positive quadrants (Fig. 6, A, F, and K; the cells treated for necrosis had no significant population of 7AAD-negative cells). These two populations were then analyzed for Pactolus expression and annexin V binding. The control cells (Fig. 6, BE) showed a low level of Pactolus expression indicative of the majority of the protein still residing within the cells. In contrast, the UV-treated cells (Fig. 6, GJ) demonstrated an elevated level of Pactolus expression on those Pactolus-expressing cells, suggesting such treatment leads to translocation of the intracellular protein to the cell surface. In both the 7AAD-positive and -negative UV-treated samples, the highest level of Pactolus translocation was coincident with the highest level of annexin V binding, providing for a direct correlation between the induction of apoptosis and the release of intracellular Pactolus. The elevated levels of Pactolus on the surface of the UV-treated cells that were 7AAD-positive (contrasting G and H) also suggests that cells undergoing postapoptotic necrosis did not shed the Pactolus protein. This Pactolus translocation was also evident by those cells induced to undergo necrosis directly (Fig. 6, L and M). These data suggest that Pactolus can be induced to translocate to the cell surface during either necrotic or apoptotic neutrophil death, and that after such cell death, the Pactolus protein is not shed, but remains associated with the cell.
|
The extracellular sequence of Pactolus is very similar to that of the
integrin subunits. This sequence conservation, however, is not maintained in the cytoplasmic residues, suggesting that potential cytoplasmic signaling via Pactolus would occur via different routes than those used by integrins. The Pactolus cytoplasmic sequence has several potential phosphorylation sites. A number of different agonists were used (PMA, Bac Pac antiserum, and pervanadate) in a variety of time courses using bone marrow cells or neutrophils recruited into the peritoneal cavity with thioglycolate to induce phosphorylation of neutrophil proteins, including Pactolus. Pactolus protein was immunoprecipitated with monoclonal anti-Pactolus Ab, and Western blots were performed using Abs specific for phosphotyrosine, phosphoserine, and phosphothreonine. To confirm that we immunoprecipitated Pactolus, the membranes were stripped and blotted with polyclonal Bac Pac Ab. Under all activation conditions tested we were unable to demonstrate the phosphorylation of Pactolus (data not shown). Although an increase in total cellular protein phosphorylation was observed after PMA and pervanadate treatment, no change was evident after Pactolus ligation (data not shown).
The high degree of homology of Pactolus to the
2 integrin subunit (CD18) raised the possibility that Pactolus, like the CD18 integrin subunit as part of the Mac-1 complex, may be a phagocytic receptor. We used a phagocytic assay with Abs against different neutrophil proteins linked to NeutrAvidin-labeled fluorescent microspheres (Molecular Probes, Eugene, OR). These spheres, which possess avidin, were coated with biotinylated preimmune antiserum, Bac Pac antiserum, or anti-CD18 Abs. Neutrophils were recruited into the peritoneal cavity with 3% thioglycolate and isolated by lavage. Cells were then incubated with the beads for 30 min at 37°C and analyzed by fluorescent microscopy. Two hundred neutrophils were counted blindly, and the phagocytic index was determined. Latex beads coated with preimmune and Bac Pac were only minimally phagocytosed, whereas the CD18-coated beads were very effectively internalized (data not shown). An analogous experiment was conducted using fixed Staphlococcus aureus (Pansorbin) charged with Abs to Pactolus; they too were not phagocytosed compared with the complement-coated controls (data not shown). These data suggest that Pactolus on its own does not serve as a phagocytic receptor on the surface of neutrophils.
Creation and analysis of a Pactolus-deficient animal
To more fully explore the role that Pactolus may have in neutrophil functions in the animal, we generated a pactolus-null animal. A pactolus-targeting construct was prepared for homologous disruption of the endogenous gene as described in Materials and Methods (23). The neomycin gene cassette was inserted into exon 5 of the gene (Fig. 7, A and B). Two probes, one 5' and the other 3', were generated to test for correct homologous recombination. Both these probes were just outside the genomic sequence of the targeting vector (shown by the two cross-hatched lines in Fig. 7). Homologous recombination into 129/sv ES cells yielded a 12-kb SstI digest fragment compared with the wild-type 12.7-kb SstI fragment with a 3' probe in a Southern blot (Fig. 7C). The ES cells were also tested by EcoRI digestion and a 5' probe to confirm appropriate recombination (Fig. 7D). As expected, the vector-disrupted EcoRI fragment detected with the 5' probe was
2 kb shorter than the wild-type fragment. Approximately 50% of the ES cell lines analyzed contained the targeted allele. One such cell (2e#6) was then used with C57BL/6 blastocysts to obtain a chimeric animal demonstrating
85% coat color associated with the ES lineage. This animal was used for germline transmission of the disrupted gene.
A PCR-based assay was developed (Fig. 7E) to easily discriminate among the various genotypes generated in such matings. Transmission rates for the first 95 offspring from such heterozygous matings were 30 (+/+), 49 (+/-), and 16 (-/-). Litter sizes in wild-type and pactolus null matings were similar. Therefore, it appears that the pactolus-null mutation does not affect the viability or the fertility of the mice.
The homozygous pactolus-targeted mice were analyzed for pactolus gene products (Fig. 8A). Bone marrow mRNA isolated from wild-type (+/+), heterozygous (+/-), and homozygous (-/-) pactolus-targeted mice were used for RT-PCR. Three sets of pactolus primers were used: one set was before the neomycin insert (sequences from exons 34), another set flanked the neomycin insert (sequences from exons 56), and the third set was after the neomycin gene (sequences from exons 68). As controls for pactolus expression, mRNA from Pactolus-negative mucosal mast cells (derived with IL-3 from bone marrow) and Pactolus-positive immature connective tissue-like mast cells (derived with stem cell factor) were used (2). Animals that possessed two targeted pactolus alleles clearly did not produce transcripts 3' of the neomycin insertion and would thus be unable to create a membrane-bound form of the protein. Such animals were also analyzed for Pactolus protein production by immunoprecipitation/Western blot analysis (Fig. 8B) and flow cytometry (Fig. 8C). The Pactolus protein was immunoprecipitated from bone marrow cells with anti-Pactolus mAb and subsequently identified via Western blot using a polyclonal anti-Pactolus sera (Bac Pac) (1). The Pactolus protein can be found in two forms, depending on the amount of glycosylation, in total bone marrow samples. These two forms of Pactolus were detected in the wild-type mice (+/+), whereas no Pactolus protein was detected in the pactolus (-/-) mice. The lower m.w. bands seen in the gel are probably Pactolus breakdown products generated by neutrophil proteases released during the experimental procedures. FACS analysis (Fig. 8C) using polyclonal anti-Pactolus Bac Pac antiserum did not show any staining of PMA-treated bone marrow cells obtained from the deficient animal (-/-), whereas the control total marrow cells from C57BL/6 and 129/sv mice, also treated with PMA, demonstrated the expected level of Pactolus-expressing cells (+/+).
|
2 integrin-deficient animals, which demonstrated elevated neutrophils counts in the blood (33, 34).
Two experiments were conducted to determine whether Pactolus-deficient neutrophils demonstrated a loss of migration efficiency. Migration of neutrophils into the skin was evaluated by treating mouse ears with 2% dinitroflurobenzene for 5 h, followed by histological analysis (35). Neutrophils were detected in the ears of Pactolus-deficient animals and demonstrated similar recruitment kinetics as those observed with treated wild-type ears (data not shown). Recruitment of neutrophils into the peritoneal cavity of the Pactolus-deficient animals was also evaluated by the injection of oyster glycogen or thioglycolate. Such cells were isolated, counted, and then analyzed by flow cytometry. Again, we observed similar numbers of neutrophils between wild-type (+/+) and pactolus-null (-/-) animals recruited at the different time points tested. These data, in total, suggest that Pactolus is not required for migration of neutrophils into inflamed tissues, and that Pactolus is not part of the proposed
2 integrin-independent pathway for peritoneal migration (33).
Pactolus-deficient animals do not show susceptibility to bacterial infections
The preceding data suggested that Pactolus is not essential for either neutrophil development or migration, but may be critical for the resistance to bacterial infection, as the majority of the intracellular form of Pactolus is released to the cell surface after neutrophil activation. This model was tested using a peritonitis infection model with Escherichia coli. Wild-type, pactolus-null, 129/sv, and C57BL/6 mice were injected i.p. with
1 x 107 CFU E. coli. The pactolus-null (-/-) mice fared the same as the wild-type strain (+/+) and the two other mouse strains (data not shown). This model was also tested in a similar experiment with Staphylococcus aureus (1 x 108 CFU/animal), which resulted in no apparent difference in resistance to the bacteria between the mouse types (data not shown). Using an established skin infection model with S. aureus, we also saw no difference in the recovery of the Pactolus-null and wild-type mice (data not shown). These data suggest that, at least for the infectious agents analyzed, the Pactolus-deficient animal was as functionally competent as the wild type animal.
| Discussion |
|---|
|
|
|---|
integrin subunits led to the assumption that Pactolus might share in some of the adhesive and cell-signaling properties of the integrins. However, the lack of a functional metal ion-dependent adhesion site domain, divergent cytoplasmic domain, and lack of a paired
-chain have undermined that proposal. Previous studies of Pactolus have highlighted two findings. First, the majority of the protein is found within the cell and can only translocate to the surface after cell activation. Second, the cell specificity of expression of Pactolus is tightly controlled and is only evident in the mature/maturing neutrophil. In fact, expression constructs for Pactolus cannot be transfected into a number of bone marrow-derived cell lines, including B, T, and macrophage cell lines (S. Garrison and J. H. Weis, unpublished observations), suggesting that granule-targeting sequences within the Pactolus protein may not allow for this protein to be produced in most other cell types. The focus of this research has been to expand upon the earlier findings, to try to define neutrophil responses to Pactolus ligation, and to examine the biological effects of an animal lacking Pactolus. The first step in Pactolus function appears to be translocation of the bulk of the protein from an intracellular granule to the cell surface. Although such a translocation can be accomplished by cross-linking the protein directly, we have now shown that activation of cells with inflammatory stimuli such as LTB4 can also induce Pactolus protein expression. Translocation of granule constituents after inflammatory stimuli is not a new finding; a number of neutrophil receptors, including human CR1 and Mac-1, are shuttled to the cell surface after activation (36, 37, 38).
The specific granule to which Pactolus is assigned is difficult to determine, but does not appear to be one of the well-characterized granules. Cross-linking Pactolus does translocate the protein to the surface, but does not provide for the release of many of the other granule compartments, such as MPO (1). Thus, Pactolus and MPO, although demonstrating a similar density in the Percoll gradient, are present in distinct granules. The recruitment of neutrophils into the peritoneal cavity with oyster glycogen does translocate the bulk of the
2 integrin to the cell surface while leaving the majority of the Pactolus protein intracellular. These data suggest that Pactolus is not involved in the process of neutrophil migration to sites of inflammatory stress and does not reside in the same secretory vesicles/granules as the
2 integrins. Finally, the extensive glycosylation of Pactolus that occurs within the neutrophil suggests that this protein follows an unusual maturation pathway.
We have investigated possible signaling pathways and neutrophil functions that could use cell surface-translocated Pactolus. Such cells, once recruited to a site of infection, take on a number of functions to control an infection, including granule release, superoxide production, and phagocytosis of opsonin-tagged foreign particles. As described, we have been unable to ascertain any cell responses that occur after ligation of the Pactolus protein. No increase in granule release after Pactolus ligation has been noted nor has any cellular activation response, including calcium flux (data not shown) and total protein (and Pactolus-specific) phosphorylation. Although it is difficult to rule out all possible cellular responses to Pactolus ligation, the summation of these analyses has generated the conclusion that Pactolus does not function as either an activating or a phagocytic receptor of the neutrophil.
We have also shown that mice lacking Pactolus do not possess any obvious neutrophil developmental phenotype or sensitivity to infections. The immunological literature is rife with examples of the absence of an obvious phenotype with the deletion of a protein for which there are other redundant, functional analogues. Only when single-cell behavior is analyzed or when multiple null mutations are bred into a single animal is a phenotype detected. The same has been shown for Pactolus, in that the null animals appear normal, but the in vitro macrophage response to purified neutrophils lacking Pactolus is not.
The fate of a neutrophil recruited into a site of infection depends upon whether the cell becomes necrotic, releasing cellular fragments into the connective tissue matrix, or undergoes apoptosis. For the latter, the cell membrane remains intact, maintaining potentially harmful granule constituents within the cell. As we have shown, the Pactolus protein is also translocated to the surface when neutrophils are induced to undergo apoptosis. If neutrophils fail to be cleared, chronic inflammation can result (39). A number of murine/human receptors have been described for the macrophage uptake of apoptotic neutrophil. One such set is the
v
3 integrin expressed on the macrophage in a complex with CD36 and potentially CD14 (16). This complex can bind thrombospondin, which then binds to an ill-defined ligand on the surface of the apoptotic cell (16, 17). Another set of macrophage receptors potentially recognizes phosphatidylserine on the surface of the apoptotic cell (17). The potential receptors to mediate this binding include the scavenger receptors SRA-I/I, CD36, and macrosilain/CD68 (18, 40), all of which are known to bind apoptotic cells; however, these receptors may also recognize ligands other than phosphatidylserine on the surface of the neutrophil. An additional potential ligand/receptor interaction includes a macrophage lectin whose binding to apoptotic cells is blocked by N-acetylglucosamine (41). Finally, CD31 homodimers have been implicated as signals for the uptake of neutrophils by macrophages (42). It appears that a combination of these receptors leads to the appropriate clearance of apoptotic neutrophils in the human. Interestingly, if several of these receptors are blocked, phagocytosis of the neutrophils decreases, but is not completely inhibited (19). Pactolus may represent an inducible ligand on the neutrophil that mediates uptake by macrophages. Such an "eat me" tag (43) would most likely use the extensive sialic acid modification present on Pactolus to mediate recognition by a cognate lectin on the surface of a macrophage. Whether such specific binding occurs and how its abrogation might alter the resolution of an inflammatory response are currently under investigation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 S.G., A.H., and R.M. contributed equally to this work, are listed alphabetically, and should be considered co-first authors. ![]()
3 Address correspondence and reprint requests to Dr. John H. Weis, Division of Cell Biology and Immunology, Department of Pathology, University of Utah School of Medicine, Salt Lake City, UT 84132. E-mail address: john.weis{at}path.utah.edu ![]()
4 Abbreviations used in this paper: LTB4, leukotriene B4; AP, alkaline phosphatase; MMP-9, gelatinase B; MPO, myeloperoxidase; PTXN, pertussis toxin; SCR, stem cell factor; 7-AAD, 7-amino-actinomycin D; ES, embryonic stem; TK, thymidine kinase. ![]()
Received for publication April 28, 2003. Accepted for publication October 3, 2003.
| References |
|---|
|
|
|---|
-integrin-like protein preferentially expressed by neutrophils. J. Biol. Chem. 276:35500.
subunit-like cell-surface protein preferentially expressed by cells of the bone marrow. J. Biol. Chem. 273:8711.
3 integrin: integral role of oxygenated residues in
IIb
3 (GPIIb-IIIa) receptor function. J. Biol. Chem. 269:20913.
2 integrin CR3 (CD11b/CD18). Proc. Natl. Acad. Sci. USA 91:10680.
2 integrin CR3 (CD11b/CD18) is a receptor for the hookworm-derived neutrophil adhesion inhibitor NIF. J. Cell Biol. 127:2081.
B activation by tumor necrosis factor
in the Jurkat T cell line is independent of protein kinase A, protein kinase C, and Ca2+-regulated kinases. Cytokine 3:257.[Medline]
m
2) in human neutrophils. J. Clin. Invest. 92:1467.
This article has been cited by other articles:
![]() |
J. S. Hale, T. J. Dahlem, R. L. Margraf, I. Debnath, J. J. Weis, and J. H. Weis Transcriptional control of Pactolus: evidence of a negative control region and comparison with its evolutionary paralogue, CD18 ({beta}2 integrin) J. Leukoc. Biol., August 1, 2006; 80(2): 383 - 398. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. F. Cravatt, A. Saghatelian, E. G. Hawkins, A. B. Clement, M. H. Bracey, and A. H. Lichtman Functional disassociation of the central and peripheral fatty acid amide signaling systems PNAS, July 20, 2004; 101(29): 10821 - 10826. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |