The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hirschfield, G. M.
Right arrow Articles by Pepys, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hirschfield, G. M.
Right arrow Articles by Pepys, M. B.
The Journal of Immunology, 2003, 171: 6046-6051.
Copyright © 2003 by The American Association of Immunologists

Human C-Reactive Protein Does Not Protect against Acute Lipopolysaccharide Challenge in Mice 1

Gideon M. Hirschfield, Jeff Herbert, Melvyn C. Kahan and Mark B. Pepys2

Center for Amyloidosis and Acute Phase Proteins, Department of Medicine, Royal Free and University College Medical School, London, United Kingdom


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The physiological and pathophysiological functions of C-reactive protein (CRP), the classical acute-phase protein, are not well established, despite many reports of biological effects of CRP in vitro and in model systems in vivo. Limited, small scale experiments have suggested that rabbit and human CRP may both protect mice against lethal toxicity of Gram-negative bacterial LPS. However, in substantial well-controlled studies in C57BL/6 mice challenged with Escherichia coli O111:B4 LPS, we show in this work that significant protection against lethality was conferred neither by an autologous acute-phase response to sterile inflammatory stimuli given to wild-type mice 24 h before LPS challenge, nor by human CRP, whether passively administered or expressed transgenically. Male mice transgenic for human CRP, which mount a major acute-phase response of human CRP after LPS injection, were also not protected against the lethality of LPS from either E. coli O55:B5 or Salmonella typhimurium. Even when the acute-phase human CRP response was actively stimulated in transgenic mice before LPS challenge, no protection against LPS toxicity was observed. Indeed, male mice transgenic for human CRP that were pretreated with casein to stimulate an acute-phase response 24 h before LPS challenge suffered significantly greater mortality than unstimulated human CRP transgenic controls. Rather than being protective in this situation, human CRP may thus have pathogenic proinflammatory effects in vivo.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Much is now known about the molecular structure of human C-reactive protein (CRP), 3 the classical acute-phase protein (1), and the routine clinical use of serum CRP assay as a marker of tissue damage, infection, and inflammation (2) has lately been enormously expanded by the recognition that higher baseline serum CRP values, within the range previously considered to be normal, are very significantly predictive of future atherothrombotic events (3). However, despite many reports of properties of CRP in a wide range of in vitro and model in vivo systems, clear understanding of the actual biological functions of this phylogenetically ancient and highly conserved molecule remains elusive. This reflects three critical facts: first, no deficiency state or protein polymorphism of human CRP has yet been reported, so that information from such experiments of nature is lacking; second, mice, the most accessible model for in vivo investigation of the physiological and pathophysiological functions of proteins, produce CRP only as a trace protein that, although inducible in the acute-phase response, never exceeds 1–2 mg/L (4, 5), and no mouse CRP knockout has been produced; third, although CRP is generally conserved, there are nonetheless very important differences between CRP in different species with respect to key structural and functional properties (6, 7, 8). Experiments in which heterologous CRP is administered to mice, or transgenically expressed, are not, therefore, necessarily physiological or representative of the actual functions of human CRP in humans. A further problem is that many in vitro studies have been conducted with heterologous systems, and/or with commercially sourced CRP for which no adequate characterization of purity or integrity is reported. Furthermore, very few studies include controls that are essential for rigorous attribution of observed effects to CRP itself, such as inhibition by anti-CRP Abs or by specific affinity chromatography absorption of the CRP preparations. An example of conflicting observations that may be attributable to technical or methodological differences is the apparent binding of human CRP by Fc{gamma} receptors on human cells. Recent work suggests that this is not demonstrable when F(ab')2 rather than whole IgG anti-CRP Abs are used, or when contamination of commercial CRP preparations with traces of IgG is avoided (9, 10). This does not mean that human CRP may not be bound by Fc receptors on cells of other species, such as mouse, and have significant functional effects, but such interspecies interactions do not establish a physiological role of CRP in humans.

Despite these important caveats, some evidence does point to a role of CRP in host defense against microbial infection. The capacity of human CRP to bind to phosphocholine (11) and related residues that are widely present in bacteria and other pathogens, and then to precipitate soluble ligands, aggregate particulate ligands, and efficiently activate the classical complement pathway (12, 13, 14), all resemble closely the classical properties of Abs. Furthermore, there is direct evidence from model systems that CRP can protect against infection, specifically with strains of Streptococcus pneumoniae (15, 16, 17) and Haemophilus influenzae (18, 19) that express phosphocholine appropriately. Mice transgenic for human CRP are also more resistant to infection with Salmonella typhimurium, an organism to which CRP does not bind (20). There is also evidence that CRP may contribute to resistance against the lethal toxicity of Gram-negative bacterial LPS. This was first reported in transgenic mice expressing the rabbit CRP gene (21), and subsequently shown for wild-type mice to which human CRP was administered by injection (22, 23). If such protection occurred in a homologous system, it would clearly be an important natural function for CRP. However, we report in this work that protection of mice against LPS lethality by passive administration of human CRP is not a universally reproducible phenomenon. Furthermore, human CRP transgenic mice, which mount major acute-phase responses of human CRP following acute-phase stimulation, closely resembling events in humans, were not protected against LPS toxicity. There are also conflicting reports about whether pre-existing acute-phase responses protect mice against LPS lethality, and we confirm in this work our previous finding (22) that mice mounting an acute-phase response to a sterile inflammatory stimulus remain as susceptible as control, nonpretreated animals.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

C57BL/6 mice (Charles River, Margate, Kent, U.K.) and C57BL/6 mice transgenic for human CRP, created by Ciliberto et al. (24) (gift of B. Kyewski, Deutsches Krebsforschungszentrum, Heidelberg, Germany), were housed under conventional conditions. The latter were bred to yield progeny for use in the experiments. The transgenic mice carry a 31-kb ClaI fragment of human genomic DNA comprising the CRP gene, 17 kb of 5'-flanking sequence, and 11.3 kb of 3'-flanking sequence, that was identified at ~6 wk of age by PCR on tail snip samples. DNA was amplified using Ready-To-Go PCR beads (Amersham Pharmacia Biotech, Piscataway, NJ) and the primers CCATGGAGAAGCTGTTGTG (sense) and GTACTGGAGCTACTGTGACT (antisense): 95°C, 2 min and 30 s (1 cycle; denaturation); 95°C, 30 s; 60°C, 30 s; 72°C, 30 s (35 cycles; denaturation, annealing, extension); and 72°C, 5 s (1 cycle; final extension). PCR-amplified products were size fractionated by 1% agarose gel electrophoresis to reveal the 600-bp band representing the transgene.

LPS lethality experiments

Adult mice, age and sex matched in each experiment and weighing ~20 g each, were challenged with i.p. injections of 5 or 10 mg/kg of LPS from E. coli O111:B4 (Sigma-Aldrich, St. Louis, MO) in solution in PBS. In additional experiments, LPS preparations (10 mg/kg) from E. coli O55:B5 and from S. typhimurium (both from Sigma-Aldrich) were used to replicate exactly the challenges reported in previously published studies (21, 22, 23). Lethality was monitored at 24-h intervals over 72 h. In some experiments, acute-phase responses in wild-type and human CRP transgenic mice were initiated 24 h before LPS challenge by s.c. injection of either 0.5 ml 10% (w/v) casein solution (ICN Pharmaceuticals, Costa Mesa, CA) in 0.05 M NaHCO3 buffer (25) or 0.25 or 0.5 ml 2% w/v aqueous silver nitrate solution (Sigma-Aldrich) (26). In other experiments, isolated pure human CRP (see below) in solution in 0.01 M Tris-buffered 0.14 M NaCl containing 0.002 M CaCl2, pH 8.0, was injected i.p. 15 min before and 4 h after LPS challenge. Control animals challenged with LPS received injections of solvent alone in both sets of studies.

Human CRP isolation and assay

Human CRP was isolated from malignant effusion fluids by calcium-dependent affinity chromatography and further purified by gel filtration to greater than 99% purity, determined by specific immunoassay for CRP, total protein estimation, and SDS-PAGE analysis of reduced denatured samples, as previously reported (27). The CRP was composed entirely of intact pentamers, as shown by analytical gel filtration chromatography, and was 100% functionally intact, as shown by calcium-dependent binding to immobilized ligands, phosphocholine, and phosphoethanolamine. Electrospray mass spectrometry of the purified CRP yielded only protomers with the authentic Mr of 23,027, corresponding exactly to the known amino acid sequence of CRP, including the N-terminal pyrrolidone carboxylic acid. The LPS content of the isolated purified CRP, measured by the kinetic chromogenic Limulus amebocyte lysate assay (BioWhittaker, Parc Industriel de Petit Rechain, Verviers, Belgium), was 0.16 ng/mg of CRP. A high sensitivity automated microparticle enhanced latex turbidimetric immunoassay (COBAS MIRA; Roche Diagnostics, Mannheim, Germany) (28), with a lower limit of detection of 0.2 mg/L, was used to assay CRP in sera of human CRP transgenic mice and in pure CRP preparations.

Binding of soluble ligands by human CRP

The COBAS MIRA assay for CRP involves two different mAbs, one of which binds the ligand-binding or "B" face of the CRP molecule (1, 29). When this face of the protein is occluded by a macromolecular ligand, or even by a sufficient concentration of a low m.w. ligand, the Ab cannot bind and the CRP is not detected in the assay even though it remains present in the solution and readily demonstrable by other immunoassay methods using polyclonal Abs. Pneumococcal C-polysaccharide (Statens Serum Institute, Copenhagen, Denmark), the classical ligand for CRP, was used as a positive control to demonstrate this extremely sensitive effect, and was compared with three different LPS preparations: E. coli O111:B4, E. coli O26:B6, and E. coli J5 (Rc mutant) (Sigma-Aldrich). Isolated pure human CRP and all the ligands were in solution in 0.01 M Tris-buffered 0.14 M NaCl containing 0.002 M CaCl2, pH 8.0.

Statistical analysis

Kaplan-Meier survival analysis was performed using SPPS 11.0 for Windows (SPSS, Chicago, IL), and p values were sought by the log rank test and by the Breslow test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Ongoing acute-phase responses do not protect against LPS lethality

Mice in which major acute-phase responses had been induced by sterile inflammation, elicited by s.c. injection of either casein solution (Fig. 1) or silver nitrate solution (data not shown) 24 h beforehand, were not protected against LPS lethality.



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 1. An ongoing acute-phase response does not protect against LPS lethality. Groups of wild-type C57BL/6 mice were challenged by i.p. injection of 10 mg/kg E. coli O111:B4 LPS, 24 h after receiving a single s.c. injection of 0.5 ml of 10% w/v casein, or buffer alone in controls. Solid line, male controls, n = 9; dotted line, casein-pretreated males, n = 8; short dashed line, female controls, n = 8; long dashed line, casein-pretreated females, n = 10. No significant differences in survival between groups of the same sex.

 
Passively administered human CRP does not protect female C57BL/6 mice against E. coli O111:B4 LPS lethality

In contrast to our previous observations (22) in female BALB/c mice receiving S. typhimurium LPS, and the study of Mold et al. (23) in male C57BL/6 mice receiving E. coli O55:B5 LPS, we observed no protection by human CRP injections in the female C57BL/6 mice challenged in this study with E. coli O111:B4 LPS (Fig. 2).



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 2. Passively administered human CRP does not protect against LPS lethality. Groups of female wild-type C57BL/6 received an i.p. injection of isolated purified human CRP, either 6 or 50 mg/kg, or buffer alone in controls, 15 min before i.p. challenge with 10 mg/kg E. coli O111:B4 LPS and again 4 h later. Solid line, controls, n = 17; dotted line, CRP dose 6 mg/kg, n = 14; dashed line, CRP dose 50 mg/kg, n = 14. No significant differences in survival between groups.

 
Baseline and acute-phase production of human CRP in transgenic mice

The known sexual dimorphism in baseline and acute-phase serum concentrations of human CRP in the transgenic mice (17, 30) was confirmed before and after stimulation by injection of casein, silver nitrate, or LPS (Table I). The males had dramatically higher values than the females, and mounted acute-phase production of human CRP that corresponded well with the concentrations seen in human disease.


View this table:
[in this window]
[in a new window]
  		Table I. Serum values of human CRP in transgenic mice (median, range milligrams per liter)

 
Human CRP transgenic mice are not protected against LPS lethality

Both male and female transgenic mice mounted acute-phase responses of human CRP to the stimulus of LPS injection. However, lethality following challenge with E. coli O111:B4 LPS did not differ significantly from that seen in wild-type controls (Fig. 3). Furthermore, the same absence of protection was observed in mice challenged respectively with LPS from E. coli O55:B5 or S. typhimurium that were used in previously reported studies (21, 22, 23) (Figs. 4 and 5).



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 3. Mice transgenic for human CRP are not protected against LPS lethality. Groups of wild-type C57BL/6 mice, and of human CRP transgenic C57BL/6 mice were challenged by i.p. injection of 10 mg/kg E. coli O111:B4 LPS. Solid line, wild-type males, n = 10; dotted line, CRP transgenic males, n = 15; short dashed line, wild-type females, n = 11; long dashed line, CRP transgenic females, n = 10. No significant differences in survival between groups of the same sex.

 


View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 4. Mice transgenic for human CRP are not protected against LPS lethality. Groups of male wild-type C57BL/6 mice and of human CRP transgenic C57BL/6 mice were challenged by i.p. injection of 10 mg/kg E. coli O55:B5 LPS. Solid line, wild type, n = 10; dotted line, CRP transgenic, n = 10. No significant differences in survival between groups.

 


View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 5. Mice transgenic for human CRP are not protected against LPS lethality. Groups of male wild-type C57BL/6 mice, and of human CRP transgenic C57BL/6 mice were challenged by i.p. injection of 10 mg/kg S. typhimurium LPS. Solid line, wild type, n = 9; dotted line, CRP transgenic, n = 17. No significant differences in survival between groups.

 
Ongoing acute-phase responses in human CRP transgenic mice do not protect against LPS lethality

Human CRP transgenic mice that were stimulated by injection of either casein (Fig. 6) or silver nitrate (Figs. 7 and 8) 24 h before challenge with LPS from E. coli O111:B4, and that were therefore mounting acute-phase responses of human CRP at the time of challenge with LPS, were not protected against lethality compared with control transgenic animals that were not prestimulated, or with unstimulated wild-type controls. Indeed, the human CRP transgenic male mice that were pretreated with casein showed greater mortality than the control group (Fig. 6).



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 6. An ongoing acute-phase response stimulated by casein does not protect human CRP transgenic mice against LPS lethality. Groups of human CRP transgenic C57BL/6 mice were challenged by i.p. injection of 10 mg/kg E. coli O111:B4 LPS, 24 h after receiving a single s.c. injection of 0.5 ml of 10% w/v casein, or buffer alone in controls. Solid line, male controls, n = 8; dotted line, casein-pretreated males, n = 9; short dashed line, female controls, n = 5; long dashed line, casein-pretreated females, n = 8. There was significantly greater mortality among males pretreated with casein than in the corresponding control group, p = 0.0053 (log rank test) and p = 0.0126 (Breslow test), but no significant differences in survival between the female groups.

 


View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 7. An ongoing acute-phase response stimulated by silver nitrate does not protect male human CRP transgenic mice against LPS lethality. Groups of male wild-type C57BL/6 and of human CRP transgenic C57BL/6 mice were challenged by i.p. injection of 5 mg/kg E. coli O111:B4 LPS, 24 h after receiving a single s.c. injection of either 0.25 or 0.5 ml of 2% w/v silver nitrate. Solid line, wild-type mice, n = 8; dotted line, CRP transgenic mice given 0.5 ml of silver nitrate, n = 7; short dashed line, wild-type mice given 0.25 ml of silver nitrate, n = 16; long dashed line, CRP transgenic mice given 0.25 ml of silver nitrate, n = 10. No significant differences in survival between groups receiving the same doses of silver nitrate.

 


View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 8. An ongoing acute-phase response stimulated by silver nitrate does not protect female human CRP transgenic mice against LPS lethality. Groups of female wild-type C57BL/6 and of human CRP transgenic C57BL/6 mice were challenged by i.p. injection of 5 mg/kg E. coli O111:B4 LPS, 24 h after receiving a single s.c. injection of either 0.25 or 0.5 ml of 2% w/v silver nitrate. Mortality was monitored at 24-h intervals. Solid line, wild-type mice given 0.5 ml of silver nitrate, n = 5; dotted line, CRP transgenic mice given 0.5 ml of silver nitrate, n = 7; short dashed line, wild-type mice given 0.25 ml of silver nitrate, n = 14; long dashed line, CRP transgenic mice given 0.25 ml of silver nitrate, n = 10. No significant differences in survival between groups receiving the same doses of silver nitrate.

 
Human CRP does not bind to LPS from rough or smooth strains of E. coli

Loss of human CRP immunoreactivity in the Roche MIRA assay is a sensitive test for macromolecular ligand binding by CRP, as shown by the effect of C-polysaccharide (Table II). Addition of LPS from the rough E. coli strain J5, and from two different smooth strains, O111:B4 and O26:B6, however, had no significant effect other than possibly minor inhibition by the extreme highest dose of the latter (Table II).


View this table:
[in this window]
[in a new window]
  		Table II. LPS does not block CRP reactivity in MIRA assay

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The apparently conflicting reports on the possible role of the acute-phase response and of CRP, and other acute-phase proteins, on resistance to LPS lethality in mice may reflect the inherent variability of this model as well as the many variations in experimental procedures used, in particular the strain and sex of mice, the particular variety of LPS, and the species of origin of CRP. Despite marked structural conservation among pentraxins, the plasma protein family to which CRP belongs, there are nonetheless considerable variations between CRPs of different species with respect to fine ligand-binding specificity, presence and nature of glycosylation, protomer assembly, capacity to precipitate and aggregate ligands, baseline circulating concentrations, behavior as acute-phase proteins, and capacity to activate autologous complement (6, 7, 8). Extrapolation from heterologous systems, without even attempting to take account of these and other critical differences, is unlikely to yield robust physiologically relevant information. For example, one recent publication that claims protective effects of CRP against Vibrio vulnificus LPS used commercially sourced CRP from the horseshoe crab, Limulus polyphemus (31). This material was completely uncharacterized with regard to its purity and functional integrity. Furthermore, Limulus CRP is heterogeneous in amino acid sequence (32), is only ~20% homologous with human CRP, is dodecameric rather than pentameric (33), is heavily and heterogeneously glycosylated (34), while human CRP is not a glycoprotein, and Limulus is an arachnid separated from primates by ~700 million years of evolution. More work is evidently required before asserting that observations in such disparate and poorly characterized circumstances have genuine biological relevance.

Experiments in which very large doses of heterologous protein are systemically administered to otherwise healthy animals before and during lethal LPS challenge are also not physiological. In our studies that showed protection, we used the closely related plasma protein, serum amyloid P component, and also human serum albumin as controls. However, in other studies, no control proteins were used (23), while in the work with rabbit CRP transgenic mice, the control animals were not even of the same strain (21). Our present failure to find protection by exogenous human CRP suggests that this rather artificial phenomenon is unlikely to be of general significance. Apart from the heterologous nature of the human CRP in the present transgenic mice, they represent a much more physiological model, either with or without an ongoing acute-phase response before LPS challenge. The whole gamut of acute-phase phenomena, including the cytokine cascade, acute-phase protein synthesis, and activation of all the molecular and cellular proinflammatory and defense systems, is engaged in these mice, so that any effects of human CRP can be mounted in a milieu that is as appropriate as possible. The absence of any protection in such mice therefore provides no evidence in favor of human CRP having an important function in host defense against LPS lethality. This is consistent with clinical experience, in that all patients with septicemia and with septic shock have extremely high circulating CRP concentrations that persist until death, unless there is also concurrent severe liver failure. There is thus no evidence from clinical observation of a protective effect of CRP in this situation.

The Roche MIRA assay for CRP depends on two mAbs, one of which specifically recognizes the B, or binding, face of the CRP pentamer (28, 35). When this surface of the molecule is occluded by a macromolecular ligand, such as pneumococcal C-polysaccharide, as shown in this study, or by other ligands (our unpublished observations), the CRP is not detected and its apparent concentration is much less than is known to be present and than can be measured, for example, by direct immunoprecipitation assays using polyclonal anti-CRP Abs. It has been reported previously that human CRP does not bind to LPS, and we confirmed in this study, using this very sensitive indirect assay, that there was no evidence of a significant interaction between CRP and LPS from one rough and two smooth strains of E. coli. Of course, LPS is an extremely complex and polymorphic structure, and much more extensive studies are required to determine whether CRP from humans or other species binds to varieties of LPS other than those we have tested. However, the present findings indicate that human CRP, at least in the mouse, does not significantly protect against LPS lethality under conditions, in the transgenic animals, that most closely resemble those existing in patients with septic shock, and that the protection that has been observed in some experiments using very large doses of passively administered human CRP does not depend on binding of LPS by the CRP.

There is substantial evidence that human CRP can, in some circumstances, be proinflammatory and exacerbate tissue damage, by virtue of its capacity to bind to autologous ligands exposed on dead or damaged cells and then to activate complement (36). It is therefore of interest that male mice transgenic for human CRP, which express human CRP much more abundantly than the females with this transgene (Table I), showed a trend to greater LPS-induced mortality when they had a pre-existing acute-phase response with high values of circulating human CRP at the time they were challenged with LPS. However, further studies are required to establish whether this apparent adverse effect is really significant, robustly reproducible, and actually attributable to actions of human CRP itself.


   Footnotes
 
1 This work was supported by Medical Research Council (U.K.) Program Grant G97900510 (to M.B.P.), and by a Medical Research Council (U.K.) Clinical Training Fellowship (to G.M.H.). Back

2 Address correspondence and reprint requests to Dr. Mark B. Pepys, Department of Medicine, Center for Amyloidosis and Acute Phase Proteins, Royal Free and University College Medical School, Rowland Hill Street, London NW3 2PF, U.K. E-mail address: m.pepys{at}rfc.ucl.ac.uk Back

3 Abbreviation used in this paper: CRP, C-reactive protein. Back

Received for publication April 9, 2003. Accepted for publication September 19, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Thompson, D., M. B. Pepys, S. P. Wood. 1999. The physiological structure of human C-reactive protein and its complex with phosphocholine. Structure 7:169.[Medline]
  2. Pepys, M. B.. 2003. The acute phase response and C-reactive protein. D. A. Warrell, and T. M. Cox, and J. D. Firth, and E. J. Benz, Jr, eds. 4th Ed.In Oxford Textbook of Medicine Vol. 2:150. Oxford University Press, Oxford.
  3. Danesh, J., P. Whincup, M. Walker, L. Lennon, A. Thomson, P. Appleby, J. R. Gallimore, M. B. Pepys. 2000. Low grade inflammation and coronary heart disease: prospective study and updated meta-analyses. Br. Med. J. 321:199.[Abstract/Free Full Text]
  4. Siboo, R., E. Kulisek. 1978. A fluorescent immunoassay for the quantification of C-reactive protein. J. Immunol. Methods 23:59.[Medline]
  5. Pepys, M. B.. 1979. Isolation of serum amyloid P component (protein SAP) in the mouse. Immunology 37:637.[Medline]
  6. Oliveira, E. B., E. C. Gotschlich, T.-Y. Liu. 1980. Comparative studies on the binding properties of human and rabbit C-reactive proteins. J. Immunol. 124:1396.[Medline]
  7. De Beer, F. C., M. L. Baltz, E. A. Munn, A. Feinstein, J. Taylor, C. Bruton, J. R. Clamp, M. B. Pepys. 1982. Isolation and characterization of C-reactive protein and serum amyloid P component in the rat. Immunology 45:55.[Medline]
  8. Baltz, M. L., F. C. de Beer, A. Feinstein, E. A. Munn, C. P. Milstein, T. C. Fletcher, J. F. March, J. Taylor, C. Bruton, J. R. Clamp, et al 1982. Phylogenetic aspects of C-reactive protein and related proteins. Ann. NY Acad. Sci. 389:49.[Medline]
  9. Saeland, E., A. van Royen, K. Hendriksen, H. Vile-Weekhout, G. T. Rijkers, L. A. Sanders, J. G. van de Winkel. 2001. Human C-reactive protein does not bind to Fc{gamma}RIIa on phagocytic cells. J. Clin. Invest. 107:641.[Medline]
  10. Hundt, M., M. Zielinska-Skowronek, R. E. Schmidt. 2001. Lack of specific receptors for C-reactive protein on white blood cells. Eur. J. Immunol. 31:3475.[Medline]
  11. Volanakis, J. E., M. H. Kaplan. 1971. Specificity of C-reactive protein for choline phosphate residues of pneumococcal C-polysaccharide. Proc. Soc. Exp. Biol. Med. 136:612.[Medline]
  12. Kaplan, M. H., J. E. Volanakis. 1974. Interaction of C-reactive protein complexes with the complement system. I. Consumption of human complement associated with the reaction of C-reactive protein with pneumococcal C-polysaccharide and with the choline phosphatides, lecithin and sphingomyelin. J. Immunol. 112:2135.[Abstract/Free Full Text]
  13. Siegel, J., R. Rent, H. Gewurz. 1974. Interactions of C-reactive protein with the complement system. I. Protamine-induced consumption of complement in acute phase sera. J. Exp. Med. 140:631.[Abstract]
  14. Volanakis, J. E.. 1982. Complement activation by C-reactive protein complexes. Ann. NY Acad. Sci. 389:235.[Medline]
  15. Mold, C., S. Nakayama, T. J. Holzer, H. Gewurz, T. W. Du Clos. 1981. C-reactive protein is protective against Streptococcus pneumoniae infection in mice. J. Exp. Med. 154:1703.[Abstract/Free Full Text]
  16. Yother, J., J. E. Volanakis, D. E. Briles. 1982. Human C-reactive protein is protective against fatal Streptococcus pneumoniae infection in mice. J. Immunol. 128:2374.[Medline]
  17. Szalai, A. J., D. E. Briles, J. E. Volanakis. 1995. Human C-reactive protein is protective against fatal Streptococcus pneumoniae infection in transgenic mice. J. Immunol. 155:2557.[Abstract]
  18. Weiser, J. N., N. Pan, K. L. McGowan, D. Musher, A. Martin, J. Richards. 1998. Phosphorylcholine on the lipopolysaccharide of Haemophilus influenzae contributes to persistence in the respiratory tract and sensitivity to serum killing mediated by C-reactive protein. J. Exp. Med. 187:631.[Abstract/Free Full Text]
  19. Lysenko, E., J. C. Richards, A. D. Cox, A. Stewart, A. Martin, M. Kapoor, J. N. Weiser. 2000. The position of phosphorylcholine on the lipopolysaccharide of Haemophilus influenzae affects binding and sensitivity to C-reactive protein-mediated killing. Mol. Microbiol. 35:234.[Medline]
  20. Szalai, A. J., J. L. VanCott, J. R. McGhee, J. E. Volanakis, W. H. Benjamin, Jr. 2000. Human C-reactive protein is protective against fatal Salmonella enterica serovar typhimurium infection in transgenic mice. Infect. Immun. 68:5652.[Abstract/Free Full Text]
  21. Xia, D., D. Samols. 1997. Transgenic mice expressing rabbit C-reactive protein are resistant to endotoxemia. Proc. Natl. Acad. Sci. USA 94:2575.[Abstract/Free Full Text]
  22. Noursadeghi, M., M. C. M. Bickerstaff, J. R. Gallimore, J. Herbert, J. Cohen, M. B. Pepys. 2000. Role of serum amyloid P component in bacterial infection: protection of the host or protection of the pathogen. Proc. Natl. Acad. Sci. USA 97:14584.[Abstract/Free Full Text]
  23. Mold, C., W. Rodriguez, B. Rodic-Polic, T. W. Du Clos. 2002. C-reactive protein mediates protection from lipopolysaccharide through interactions with Fc{gamma}R. J. Immunol. 169:7019.[Abstract/Free Full Text]
  24. Ciliberto, G., R. Arcone, E. F. Wagner, U. Ruther. 1987. Inducible and tissue-specific expression of human C-reactive protein in transgenic mice. EMBO J. 6:4017.[Medline]
  25. Baltz, M. L., K. Gomer, A. J. S. Davies, D. J. Evans, G. G. B. Klaus, M. B. Pepys. 1980. Differences in the acute phase responses of serum amyloid P component (SAP) and C3 to injections of casein or bovine serum albumin in amyloid-susceptible and resistant mouse strains. Clin. Exp. Immunol. 39:355.[Medline]
  26. Baltz, M. L., D. Caspi, B. Glatthaar, H. Moser, M. B. Pepys. 1984. The failure of ascorbic acid therapy to alter the induction of remission of murine amyloidosis. Clin. Exp. Immunol. 57:657.[Medline]
  27. De Beer, F. C., M. B. Pepys. 1982. Isolation of human C-reactive protein and serum amyloid P component. J. Immunol. Methods 50:17.[Medline]
  28. Eda, S., J. Kaufmann, W. Roos, S. Pohl. 1998. Development of a new microparticle-enhanced turbidometric assay for C-reactive protein with superior features in analytical sensitivity and dynamic range. J. Clin. Lab. Anal. 12:137.[Medline]
  29. Ashton, A. W., M. K. Boehm, J. R. Gallimore, M. B. Pepys, S. J. Perkins. 1997. Pentameric and decameric structures in solution of serum amyloid P component by X-ray and neutron scattering and molecular modelling analyses. J. Mol. Biol. 272:408.[Medline]
  30. Szalai, A. J., F. W. van Ginkel, S. A. Dalrymple, R. Murray, J. R. McGhee, J. E. Volanakis. 1998. Testosterone and IL-6 requirements for human C-reactive protein gene expression in transgenic mice. J. Immunol. 160:5294.[Abstract/Free Full Text]
  31. Chae, M. R., B. H. Park, J. S. Kim, H. W. Rho, J. W. Park, H. R. Kim. 2000. Protective effect of C-reactive protein against the lethality induced by Vibrio vulnificus lipopolysaccharide. Microbiol. Immunol. 44:335.[Medline]
  32. Nguyen, N. Y., A. Suzuki, R. A. Boykins, T.-Y. Liu. 1986. The amino acid sequence of Limulus C-reactive protein: evidence of polymorphism. J. Biol. Chem. 261:10456.[Abstract/Free Full Text]
  33. Tennent, G. A., P. J. G. Butler, T. Hutton, A. R. Woolfit, D. J. Harvey, T. W. Rademacher, M. B. Pepys. 1993. Molecular characterization of Limulus polyphemus C-reactive protein. I. Subunit composition. Eur. J. Biochem. 214:91.[Medline]
  34. Amatayakul-Chantler, S., R. A. Dwek, G. A. Tennent, M. B. Pepys, T. W. Rademacher. 1993. Molecular characterization of Limulus polyphemus C-reactive protein. II. Asparagine-linked oligosaccharides. Eur. J. Biochem. 214:99.[Medline]
  35. Eda, S., J. Kaufmann, M. Molwitz, E. Vorberg. 1999. A new method of measuring C-reactive protein, with a low limit of detection, suitable for risk assessment of coronary heart disease. Scand. J. Clin. Lab. Invest. 230:32.
  36. Griselli, M., J. Herbert, W. L. Hutchinson, K. M. Taylor, M. Sohail, T. Krausz, M. B. Pepys. 1999. C-reactive protein and complement are important mediators of tissue damage in acute myocardial infarction. J. Exp. Med. 190:1733.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
M. V. Suresh, S. K. Singh, D. A. Ferguson Jr., and A. Agrawal
Human C-Reactive Protein Protects Mice from Streptococcus pneumoniae Infection without Binding to Pneumococcal C-Polysaccharide
J. Immunol., January 15, 2007; 178(2): 1158 - 1163.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
K. Reifenberg, H.-A. Lehr, D. Baskal, E. Wiese, S. C. Schaefer, S. Black, D. Samols, M. Torzewski, K. J. Lackner, M. Husmann, et al.
Role of C-Reactive Protein in Atherogenesis: Can the Apolipoprotein E Knockout Mouse Provide the Answer?
Arterioscler. Thromb. Vasc. Biol., August 1, 2005; 25(8): 1641 - 1646.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Black, A. Wilson, and D. Samols
An Intact Phosphocholine Binding Site Is Necessary for Transgenic Rabbit C-Reactive Protein to Protect Mice against Challenge with Platelet-Activating Factor
J. Immunol., July 15, 2005; 175(2): 1192 - 1196.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
G. M. Hirschfield, J. R. Gallimore, M. C. Kahan, W. L. Hutchinson, C. A. Sabin, G. M. Benson, A. P. Dhillon, G. A. Tennent, and M. B. Pepys
Transgenic human C-reactive protein is not proatherogenic in apolipoprotein E-deficient mice
PNAS, June 7, 2005; 102(23): 8309 - 8314.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
M. B. Pepys
CRP or not CRP? That Is the Question
Arterioscler. Thromb. Vasc. Biol., June 1, 2005; 25(6): 1091 - 1094.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hirschfield, G. M.
Right arrow Articles by Pepys, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hirschfield, G. M.
Right arrow Articles by Pepys, M. B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS