|
|
||||||||
-Dependent Antiangiogenic Activity, as well as Long-Lasting Tumor Immunity Elicited by Peptide Vaccination 1
Department of Internal Medicine, Medical School, University Clinic and Fundación para la Investigación Médica Aplicada, University of Navarra, Pamplona, Spain
| Abstract |
|---|
|
|
|---|
production, which exerted a potent antiangiogenic activity. The capacity of the host to mount this antitumor response is lost once the number of CD25+ T reg cells is restored over time. However, CD25+ T reg cell depletion before immunization with AH1 (a cytotoxic T cell determinant from CT26 tumor cells) permits the induction of a long-lasting antitumoral immune response, not observed if immunization is conducted in the presence of regulatory cells. A study of the effect of different levels of depletion of CD25+ T reg cells before immunization with the peptide AH1 alone, or in combination with a Th determinant, unraveled that Th cells play an important role in overcoming the suppressive effect of CD25+ T reg on the induction of long-lasting cellular immune responses. | Introduction |
|---|
|
|
|---|
-chain (CD25), has been described to be crucial for the control of autoreactive T cells in vivo (reviewed in Ref. 1). Thus, it has been shown that upon Ag stimulation, this CD4+/CD25+ cell population potently suppresses the activation/proliferation of other CD4+ or CD8+ cells in vitro (2, 3). The mechanism of suppression seems to be the inhibition of IL-2 transcription in the effector populations. Indeed, suppression can be abrogated by the addition of exogenous IL-2 or by enhancing endogenous IL-2 production by means of anti-CD28 Ab (4). However, the exact mechanism by which CD25+ T reg cells exert their suppressive effects remains unknown. Although some research groups have reported the need of cell-to-cell contact between suppressor and responder cells to exert the inhibitory function (3, 5) and that secreted cytokines are not required (6), other groups have reported that the suppressive effect of CD25+ T reg cells is mediated by soluble factors and do not require cell-to-cell contact (7, 8). T cell-mediated immunotherapy represents a promising treatment for cancer. The absence of efficient tumor-specific immune responses in cancer patients can be related to a deficient APC function or to T cell tolerance/ignorance toward tumor Ags (9, 10). It has been postulated that CD4+/CD25+ immunoregulatory cells may be engaged in continuously up-regulating the activation thresholds of other T cells, thereby avoiding effective generation of tumor immunity while inhibiting autoimmunity (2, 3, 11, 12). Thus, breaking immunological tolerance may allow effective induction of tumor immunity. Several reports have documented the potential role of CD25+ T reg removal for the induction of tumor rejection (4, 13, 14, 15). Also, depletion of CD25+ T reg cells leads to the activation of otherwise silent tumor-specific CD8+ cells (4, 13, 14) as well as tumor-nonspecific CD4-CD8- NK-like effector cells (4). In addition, recent publications have documented that CD25+ T reg cells may contribute to the control of memory CD8+ T cell responses (16, 17). These reports suggest that inhibition of CD25+ T reg cell action might have a beneficial effect on the induction of antitumor immunity when combined with different strategies of vaccination.
In this work, we have investigated the effect of in vivo administration of anti-CD25 mAb on the induction of antitumor CD4+ and CD8+ T cell responses against the BALB/c colon cancer CT26 (18). We have also tested the efficacy of CD25+ cell depletion in combination with peptide vaccination protocols using a cytotoxic T cell determinant (TCd) (18) and Th cell determinants (THd) (19), both of them derived from the sequence of murine leukemia virus (MuLV) gp70 envelope protein that is a tumor rejection Ag expressed by CT26. We have found that removal of CD25+ cells permits the induction of both CD4+ and CD8+ antitumor T cells in response to CT26 tumor challenge. Interestingly, we have found that the induced CD4+ T cells are able to reject CT26 cells, an MHC class II-negative tumor. The mechanism of action of these CD4+ cells is mediated by IFN-
production which exerts antiangiogenic effects. In addition, we have found that CD25+ cell depletion favors the induction of antitumor memory T cell responses after vaccination with TCd and THd peptides. In the present study, we analyze the capacity of activated Th cells to overcome the suppressive effect of CD25+ T reg on the induction of long-lasting cellular immune responses.
| Materials and Methods |
|---|
|
|
|---|
Peptide SPSYVYHQF (from now on AH1) containing a TCd expressed by CT26 cells and presented by H-2Ld MHC class I molecules (18) and LVQFIKDRISVVQA (from now on p320333) containing a Th epitope (19) for BALB/c MHC class II background, both derived from MuLV gp70 envelope protein, were synthesized by the solid phase method of Merrifield (20) using a manual multiple solid-phase peptide synthesizer as described in Ref. 21 . At the end of the synthesis, peptides were cleaved, deprotected, and washed six times with diethyl ether. They were lyophilized and analyzed by HPLC. The purity of peptides was above 80% as judged by HPLC.
Mice
Six-week-old female BALB/c mice were purchased from IFFA Credo (Barcelona, Spain). A breeding pair of RAG2-/- (mice deficient in T and B cells) with BALB/c background was obtained from The Jackson Laboratory (Bar Harbor, ME), and were bred and maintained in pathogen-free conditions. Mouse experimentation followed institutional guidelines and was approved by the intrainstitutional ethical committee.
In vivo depletion experiments
In vivo depletion of CD25+ cells was conducted by i.p. injection of 0.3 mg of anti-CD25 Abs (obtained from rat anti-mouse hybridoma PC61 (American Type Culture Collection, Manassas, VA) and purified as previously described (22)), 4 days before tumor challenge. In some experiments, different doses of anti-CD25 mAb were used to obtain partial depletions. In some experiments, mice were depleted of CD4+ and/or CD8+ cells by i.p. injection of 0.3 mg of anti-CD4 and/or anti-CD8 Abs (obtained from rat anti-mouse hybridomas GK 1.5 and H35.17.2, respectively) on days -1, 0, 1, 6, and 10, as previously described (22), day 0 being the day of peptide immunization. The efficiency of depletions at the day of tumor challenge was assessed by flow cytometry using PBMC isolated from fresh heparinized blood samples by Ficoll-Hypaque centrifugation. In all cases, the levels of depletion were higher than 95%. Depletion of NK cells was conducted by i.p. administration of rabbit anti-Asialo GM1 antiserum (Wako, Neuss, Germany) using 100 µg per dose on days -2, -1, and 3 after challenge with CT26 tumor cells. The efficiency of NK depletions was assessed, at the day of tumor challenge, by flow cytometry using anti CD3 and anti-DX5 Abs. Depletion of CD3-/DX5+ cells was in all cases above 95%. Also, the efficiency of NK depletion was assessed by measuring the remaining lytic activity of spleen cells 3 days after a single injection of rabbit anti-Asialo GM1 antiserum. This was done using Yac-1 cells (American Type Culture Collection) as target cells in a conventional 51Cr release assay (23). A single injection with 100 µg of Ab was able to completely abrogate NK activity (not shown).
Adoptive T cell transfer experiments
CD4+ cells were purified from naive mice or from CD25+ and CD8+ T cell-depleted mice by positive selection using anti-CD4 mAb coated to magnetic beads (Dynal Biotech, Oslo, Norway). Briefly, spleen cells from normal BALB/c mice were incubated with anti-CD4 coated Dynabeads for 1 h at 4°C following manufacturers instructions. After positive selection using a magnetic concentrator, beads were removed by using DETACHaBEAD (Dynal Biotech). After two washes in PBS, cells were counted and used for adoptive transfer experiments. In some experiments, CD4+/CD25+ cells were purified from a CD4+-enriched cell preparation obtained from naive mice, by incubation of cells with anti-CD25 mAb followed by positive selection using anti-IgG-coated Dynabeads according to manufacturers instructions (Dynal Biotech). After detachment of beads by overnight incubation at 37°C, cells were washed and counted for adoptive transfer experiments.
Tumor challenge experiments
To measure the antitumoral capacity of the different treatments and/or immunization protocols, mice were challenged by s.c. injection on the right flank with 5 x 105 CT26 tumor cells at different time points. In some experiments animals were immunized with different combinations of peptides in IFA (Difco, Detroit, MI) or IFA alone as described previously (19). Tumor size was expressed as the square value of the small diameter of the tumor, times the value of its larger diameter. Mice were sacrificed when tumor size reached a volume greater than 8 cm3.
Recognition of CT26 tumor cell lysate by CD4+ T cells from mice exposed to CT26 tumor cells
The presence of antitumoral CD4+ cells was measured in mice 30 days after challenge with CT26 tumor cells. CD4+ T cells were purified from naive mice or from mice previously depleted from CD25+ and CD8+ cells as described above and stimulated in vitro (2 x 105 CD4+ cells/well and 4 x 105 mitomycin-treated spleen cells/well from naive mice) with or without different dilutions of cell extracts from CT26, MC38, P815, A20, NS1, or 18Neo cells. To obtain cell extracts, 107 tumor cells or 18Neo cells/ml were lysed by six cycles of freezing and thawing followed by sonication and centrifugation. CT26 colon cancer, MC38 adenocarcinoma, P815mastocytoma, A20 lymphoma, and NS1 myeloma cells were obtained from the ATCC collection (American Type Culture Collection). 18Neo cells are derived from NIH 3T3 cells and were kindly provided by Dr. J. Berzofsky (National Institutes of Health, Bethesda, MD). Culture supernatants were collected after 48 h of culture to measure production of IFN-
by using a commercial ELISA kit (BD PharMingen, San Diego, CA) according to the manufacturers instructions. Cell proliferation was assayed after 3 days of culture by measuring [methyl-3H]thymidine incorporation. Briefly, the second day of culture 0.5 µCi [methyl-3H]thymidine were added to each well and incubated overnight. Cells were harvested (Filtermate 196 harvester; Packard Instrument, Meriden, CT) and incorporated radioactivity was measured using a scintillation counter (Topcount; Packard Instrument).
PCR primers and RT-PCR
Cell extracts from CT26, MC38, P815, A20, NS1, or 18Neo cells were obtained as described above. Total RNA was isolated from cell extracts using Ultraspect RNA isolation kit (Biotex, Houston, TX) following manufacturers instructions. One microgram of RNA was reverse-transcribed as previously described (24) and the cDNA was amplified with Taq polymerase using specific primers for MuLV gp70 env (sense primer: ACCTTGTCCGAAGTGACCG, antisense primer: GTACCAATCCTGTGTGGTCG, to amplify a 594-bp fragment as described (18)) or for
-actin (sense primer: TCTACAATGAGCTGCGTGTG, antisense primer: GGTGAGGATCTTCATGAGGT, to amplify a 314-bp fragment as described (24)). Amplified cDNA was electrophoresed through 1% agarose and visualized under UV after ethidium bromide staining.
Matrigel angiogenesis assay
Angiogenesis assays were conducted by injecting 0.3 ml of ice-cold Matrigel (Collaborative Biomedical Products, Bedford, MA) containing 10 ng/ml vascular endothelial growth factor and 10 ng/ml basic fibroblast growth factor (Peprotech, London, U.K.) mixed with 5 x 105 CT26 cells to BALB/c mice: 1) untreated; 2) depleted of CD25+ and CD8+ T cells, 3) depleted of CD25+ and CD4+ T cells. To study the effect of IFN-
on angiogenesis, two subgroups of mice, depleted of CD25+ and CD8+ T cells or depleted of CD25+ and CD4+ cells, were injected with anti-IFN-
Abs at days 0, 2, and 5 after matrigel implantation (n = 6 in all groups). Matrigel injections were performed s.c. on the right flank of the mice. Nine days after implantation, plugs were harvested, surrounding tissue was dissected away, and the pellets were liquefied by incubation at 4°C overnight in 300 µl of PBS. The remaining pellets were further disrupted using a mechanic homogenizer. Hemoglobin content was quantified by measuring absorbance of the samples at 410 nm and by comparing with the absorbance of standard hemoglobin solutions.
Statistics
Statistical analysis was conducted using the computer program SPSS for Windows (Chicago, IL). Evaluation of the antiangiogenic effect of CD25+ and CD8+ cell depletion and the differences in the IFN-
production between groups were done using the Shapiro-Wilk test followed by the Dunnett test.
| Results |
|---|
|
|
|---|
Immunization of BALB/c mice with AH1 (a TCd expressed by CT26 cells) is unable to induce a protective CTL response against challenge with CT26 tumor cells (18). This is due to the inability of AH1 to induce a competent Th response (19). However, when mice were depleted of CD4+ cells, immunization with AH1 protected all animals from tumor challenge (Ref. 19 and Table I), paradoxically suggesting that CD4+ T cells were not necessary, or might even be detrimental for the induction of CTL responses. This made us think that elimination of CD4+/CD25+ regulatory cells might be at the origin of this result. To study whether the protective effect of immunization with AH1, in mice depleted of CD4+ cells, was mediated by the elimination of CD4+/CD25+ cells, we selectively depleted this subpopulation by i.p. injection of anti-CD25 Abs previous to challenge with CT26 tumor cells. The efficiency of this depletion was in all cases above 95% (not shown), as assessed by flow cytometry. It was found that CD25+ cell depletion led to a full protection (6 of 6 mice) against tumor challenge (Table II). Interestingly, and in contrast to what was found in CD4+ cell-depleted mice, the protection observed after depletion of CD25+ cells did not require immunization with AH1. Thus, all CD25+ depleted and nonimmunized mice remained protected against CT26 tumor challenge, whereas all CD4+-depleted and nonimmunized mice developed tumors (compare Tables I and II).
|
|
|
To identify the subpopulations of cells responsible for the protection against CT26 tumor grafting in mice depleted of CD25+ cells, we conducted the following experiments of combined cell depletion previous to tumor challenge: 1) CD25+ and CD4+, 2) CD25+ and CD8+, 3) CD25+ and CD4+ and CD8+, and 4) CD25+ and NK cells. It was found that depletion of CD4+ cells in mice depleted of CD25+ had a negative effect on protection against tumor challenge. Thus, only 4 of 12 mice (33%) remained free of tumors after this combined depletion. Similarly, depletion of CD25+ and CD8+ cells had a negative effect on protection, only 11 of 20 mice (55%) remained protected (Fig. 1). By contrast, protection after combined depletion of NK and CD25+ cells was similar to that found in mice depleted of CD25+ T cells only. Combined depletion of CD25+, CD4+, and CD8+ cells, completely abrogated protection (6 of 6 mice developed tumors) indicating that T cells are responsible for protection after depletion of CD25+ cells.
|
CD4+ cells, induced in the absence of CD25+ and CD8+ cells, produce IFN-
in response to CT26 tumor Ags
As shown in Fig. 1, 55% of mice depleted of CD25+ and CD8+ cells remained free of tumor after challenge with CT26 tumor cells. However, combined depletion of CD25+, CD8+, and CD4+ cells completely abrogated protection suggesting that in the first case, protection is mediated by CD4+ cells. This fact prompted us to study the capacity of CD4+ cells, induced in the absence of CD25+ and CD8+ cells, to respond to CT26 tumor Ags. For this purpose, we purified CD4+ cells from: 1) nonprotected undepleted mice (control group); 2) from CD25+ and CD8+ cell-depleted mice that remained protected after CT26 tumor challenge, and 3) from CD25+ and CD8+ depleted mice that developed tumors after CT26 tumor challenge. Cells from these three groups were cultured for 48 h in the presence of cell extracts from CT26 or 18Neo cells (see Materials and Methods) and the production of IFN-
was measured by ELISA.
As shown in Fig. 2A, CD4+ cells, from CD25+ and CD8+ depleted mice that remained protected after CT26 tumor challenge, produce high levels of IFN-
in response to extracts from CT26 tumor cells. These levels were higher than those produced by CD4+ cells from unprotected mice depleted of CD25+ and CD8+ cells (group 3), or from CD4+ cells from naive mice (group 1) (p < 0.05). These results suggest that CD4+ T cells, induced after depletion of CD25+ cells, are specific of tumor Ags. To study the specificity of activated CD4+ T cells, a group of CD25+ and CD8+ cell-depleted mice (n = 5), which remained protected after CT26 tumor challenge, were rechallenged s.c. with 5 x 105 cells from a different tumor (A20). This new challenge was conducted 45 days after depletion of CD25+ cells, when this subpopulation had reached normal levels. It was found that 4 of 5 mice (as opposed to 0 of 5 from the control group) rejected this second challenge with A20 lymphoma. We also measured proliferation of CD4+ T cells (from the different groups of mice) in response to cell extracts from CT26, MC38, P815, A20, NS1 tumor cells as well as from 18 Neo cells. For this purpose, 30 days after CT26 challenge, CD4+ T cells were isolated from the following groups: 1) mice depleted of CD25+ cells (all protected from tumor challenge); 2) mice depleted of CD25+ and CD8+ T cells, which remained protected after tumor challenge; 3) mice depleted of CD25+ and CD8+T cells, which developed tumors after CT26 challenge, and 4) from undepleted unprotected mice. As shown in Fig. 2B, CD4+T cells from mice from groups 1 and 2, were able to proliferate in response to all the cell extracts tested, whereas CD4+ T cells from groups 3 and 4 were not. However, the proliferative response of CD4+T cells to the cell extracts was dependent on the cell extract tested. Thus, it was found that response to CT26, MC38, A20 and NS1 was significantly higher that that observed for P815 or 18Neo (p < 0.05). Because the MuLV gp70 env transcript is expressed in a variety of tumor cells and has been described as a tumor Ag (18, 25, 26, 27), we tested the presence of gp70 RNA transcripts in the different cell lines by RT-PCR. As shown in Fig. 2B (upper panels), MuLV gp70 env is expressed by CT26, MC38, A20, and to a lesser extend by P815 cells. We were unable to detect MuLV env expression in NS1 cells, despite the capacity of CD4+T cells to proliferate in response to tumor extracts from NS1. These data suggest that MuLVgp70 is not the only source of the determinants recognized by such antitumor CD4+ T cells.
|

To study the antitumoral effect of these CD4+ cells, we isolated CD4+ cells from mice depleted of CD25+ and CD8+ cells which remained protected after CT26 tumor challenge as well as from those mice which developed tumors. CD4+ cells from these two groups were adoptively transferred (107 cells/mice) to BALB/c mice previously depleted from CD8+ cells. As control, a group of mice depleted of CD8+ was injected with saline. The same day of cell infusion, mice were challenged with 5 x 105 CT26 tumor cells. The evolution of tumors was assessed 30 days after. As shown in Table IV, two of the three mice depleted of CD8+ cells that were adoptively transferred with CD4+ cells from protected mice remained free of tumors, whereas all the mice infused with CD4+ cells from unprotected mice or with saline developed tumors. To expand and reinforce these results in a slightly different setting, we adoptively transferred these antitumor CD4+ cells in RAG2-/- mice. Three groups of RAG2-/- mice were adoptively transferred with: 1) antitumor CD4+ cells (seven mice) obtained from mice depleted of CD25+ and CD8+ cells which remained protected after CT26 tumor challenge; 2) CD4+ cells from naive mice (five mice) and 3) with saline only (three mice), the same day of CT26 tumor challenge. As shown in Table V, 5 of 7 mice infused with antitumor CD4+ cells remained free of tumors (71% of protection) whereas only 1 of 5 mice infused with CD4+ cells from naive mice was protected (20% of protection). None of the mice injected with saline were protected (0% of protection). To study the possible role of IFN-
on this protective effect, a group of RAG2-/- mice adoptively transferred with antitumor CD4+ cells (n = 4) was treated at days 0, 2, and 4 after CT26 tumor challenge, with three i.p. injections of 100 µl of ascitic fluid containing neutralizing anti-IFN-
Abs. This treatment completely abrogated the protective effect of adoptive transfer of antitumor CD4+ cells (4 of 4 mice developed tumors) (Table V).
|
|
inhibits tumor angiogenesis
As shown in Fig. 3, CD4+ cells induced in the absence of CD25+ and CD8+ cells, produce IFN-
in response to CT26 tumor extracts. Because it has been recently described that CD4+ T cells can inhibit tumor growth by inhibiting tumor angiogenesis, and that this inhibition is IFN-
-dependent (28, 29), we conducted in vivo matrigel assays to measure the extent of angiogenesis stimulated by CT26 cells in the following groups of six mice: 1) mice doubly depleted of CD25+ and CD8+, 2) mice doubly depleted of CD25+ and CD8+ and treated with anti-IFN-
Abs, 3) mice doubly depleted of CD25+ and CD4+, 4) mice doubly depleted of CD25+ and CD4+ and treated with anti-IFN-
Abs, and 5) undepleted mice. All five groups of mice were injected with matrigel containing CT26 cells as described in Materials and Methods.
|
production because injection of Abs against IFN-
is able to restore the levels of angiogenesis observed in nondepleted mice. However, double depletion of CD25+ and CD4+ cells did not have any effect on angiogenesis, suggesting that the main group of cells responsible for the observed antiangiogenic effect were CD4+ T cells induced in the absence of CD25+ cells. Depletion of CD25+ cells facilitates the induction of antitumor memory T cell responses after peptide vaccination
As described above, depletion of CD25+ cells allows mice to induce a protective T cell immune response against challenge with CT26 tumor cells. However, this protective effect was observed when the challenge was done 10 days after depletion of CD25+ cells. As described previously, mice depleted of CD25+ cells following administration of anti-CD25 mAb Abs recover the normal level of CD25+ cells 35 days after this administration (15, 30). We then studied whether the protective effect following depletion of CD25+ cells was dependent on the period of time elapsed between depletion and challenge with CT26 tumor cells. Thus, we injected CT26 tumor cells at days 10, 20, 40, or 50 after CD25+ cell depletion. Protective immunity in response to CT26 tumor cells was 100% when the challenge was conducted at day 10 after depletion. However, the antitumor efficacy decreases to 50% or to 0% when the challenge with CT26 cells was performed at days 40 and 50 after depletion, respectively (Table VI).
|
In contrast to immunization with AH1 alone, joint immunization with AH1 and peptide p320333, a THd peptide derived from MuLV gp70 envelope protein, is able to induce a protective antitumoral CD8+ T cytotoxic cell response against challenge with CT26 tumor cells (19). However, the protective effect induced by this joint immunization only lasts a short period of time. Indeed, we have found a protection of 90% if the challenge with CT26 tumor cells is conducted 1015 days after immunization (19). By contrast, the protection decreased to only 010% if mice were challenged >20 days after immunization (not shown). Because CD25+ regulatory cells seemed to play a negative role in the induction of long-term antitumoral responses after immunization with AH1, we studied the protective effect of immunization of mice with AH1 alone, or in combination with peptide p320333, under different degrees of depletions of CD25+ regulatory cells. Thus, five groups of mice were treated by i.p. injection of 0, 1, 10, 50, and 300 µg of anti-CD25 mAb Ab. The levels of depletion attained were 0 ± 5%, 33.8 ± 7.5%, 66.2 ± 8.4%, 95.5 ± 1.7%, and 99.3 ± 0.5%, respectively. These groups of mice were immunized with AH1 alone, AH1 plus p320333 or with IFA only (see Materials and Methods). Fifty days after immunization, mice were challenged with CT26 tumor cells and tumor size was measured 20 days after challenge. In Fig. 4A, we represent with a dot the tumor size in each individual mouse, whereas in Fig. 4B we represent the average tumor size from each group of mice against the degree of CD25+ cell depletion. As shown, immunization with AH1 alone, or with AH1 plus p320333, after total depletion of CD25+ cells resulted in long-term protection levels of 83 and 100%, respectively.
|
| Discussion |
|---|
|
|
|---|
It has been described that the Ab-mediated depletion of CD25+ T reg cells facilitates the induction of tumor immunity by favoring activation of tumor-specific CD8+ cells (4, 13, 14) as well as tumor nonspecific CD4-CD8- NK-like effector cells (4). In the present publication, we show that depletion of CD25+ cells allows the induction of both antitumor CD4+ and CD8+ cells, a result in agreement with the recent publication by Golgher et al. (30). Indeed, simultaneous depletion of CD25+ and CD8+ T cells, or CD25+ and CD4+ T cells, but not triple depletion of CD25+, CD4+, and CD8+ T cells, permits rejection of CT26 tumor cells in an important number of animals. Combined depletion of NK cells and CD25+ cells did not abrogate protection, suggesting that NK cells do not play a determinant role in protection.
Many studies, including our own, have described the role of CD4+ T cells in providing help for the induction of CTLs (23, 31, 32, 33, 34, 36). However, CD4+ T cells can coordinate other antitumor effector pathways independent of CTLs (37). We have found that CD4+ T cells, obtained from mice depleted from CD25+ and CD8+ cells that remained protected after CT26 tumor challenge, produced high amounts of IFN-
in response to CT26 tumor Ags in vitro. However, it was also found that activated CD4+ T cells proliferated, not only in response to extracts from CT26, but also, in response to extracts from MC38, A20, P815, NS1, and 18Neo cells. Several interpretations might explain this finding: 1) first, depletion of CD25+ T reg cells might down-regulate the activation threshold of CD4+ T cells specific for Ags from the cell extracts. In other words, proliferations in response to cell extracts (Fig. 2B) might be the result of an in vitro induction of T cells by these extracts, and not of an in vivo induction after challenge with CT26 tumor cells. However, we do not favor this interpretation because when mice depleted of CD25+ and CD8+ T cells that rejected CT26 tumor cells were challenged with a second tumor (A20), once the level of CD25+ T reg cells was restored, these mice rejected the tumor, a result in agreement with that recently reported by Golgher et al. (30). 2) A second interpretation might be related to traces of other Ags from the FBS where CT26 tumor cells are grown. These Ags would induce a T cell response in vivo that would be expanded in vitro during the proliferation assays. If this were the case, a similar level of proliferation should be expected for all cell extracts. However, because proliferation of CD4+ T cells in response to CT26, MC38, A20, and NS1 cell extracts was significantly higher than that in response to extracts from P815 or 18Neo cells (p < 0.05), we do not favor this interpretation either. 3) A third possibility might be related to a cross-reaction between shared Ags. Thus, using RT-PCR, we studied if the gp70 env gene was an Ag shared by the cell lines used in our study. It was found that the gp70 gene was expressed in CT26, MC39, A20, and to a lesser extent in P815 cells, but not in NS1 or in 18Neo cells. Thus, gp70 alone cannot explain all the differences in proliferation, suggesting that besides gp70, other tumor Ags might be involved in tumor rejection mediated by CD4+ T cells. In summary, although we favor that the observed proliferation from Fig. 2B is most likely related to shared Ags between cells, additional experiments are needed to identify these shared Ags and to establish whether they are autoantigens shared by normal tissues.
Adoptive transfer of these antitumor CD4+ cells, conducted in the present study using BALB/c mice as well as in RAG2-/- mice, demonstrate that these T cells are able to protect mice against tumor challenge, and that this protective effect is mediated by IFN-
. In agreement with results reported by other research groups (28, 37, 38). In this study, we show that in the absence of CD25+ T reg cells, an IFN-
-producing antitumor CD4+ cell subpopulation emerges in response to tumor cells, exerting potent IFN-
-dependent antiangiogenic effects.
Because IFN-
has multiple biological activities, and its receptor (IFN-
R) is expressed in almost all cell types (39, 40), this cytokine might have direct effects on tumor cells such as: 1) inhibiting cell proliferation or sensitizing cells to apoptosis (41, 42); 2) up-regulating MHC class I expression and thereby increasing tumor cell lysis (43); 3) up-regulating MHC class II expression on tumor cells (44, 45), 4) stimulating NK activity (46), or 5) inducing the expression of angiogenesis inhibitors, like IFN-
-inducible protein-10, by tumor and stromal cells (47). We have not found any inhibitory effect of IFN-
on proliferation of CT26 tumor cells in vitro even at doses of 7500 U/ml (around 3 x 106 pg/ml) (not shown). Up-regulation of MHC class I molecules and the susceptibility to CTL-dependent lysis may not be the mechanisms of action of IFN-
produced by CD4+ cells because mice were depleted of CD25+ and also of CD8+ T cells. Moreover, adoptive transfer of these CD4+ T cells to RAG2-/- (mice deficient in T and B cells) protected against tumor challenge. When we tested the expression of MHC class II molecules in CT26 cells after incubation with different concentrations of IFN-
, it was found that even at 2000 IU/ml cytokine, CT26 cells did not acquire detectable MHC class II expression (not shown). In addition, when we measured the cytotoxic activity of purified CD4+ T cells from protected mice, against IFN-
-treated CT26 cells, no activity was found even at an E:T ratio of 100:1 (not shown). Because alternatives 14 do not seem to be relevant to explain the protective effect of IFN-
produced by CD4+ cells, and as shown in Fig. 3, IFN-
inhibits angiogenesis, we favor the hypothesis that IFN-
-dependent antiangiogenic activity may constitute an important effector mechanism explaining the antitumor activity of these CD4+ T cells.
Depletion of CD25+ T reg cells per se allows the immune system to mount an efficient antitumoral immune response in mice against tumors that are poorly immunogenic (4, 14, 15, 30). However, when we conducted tumor challenge 50 days after depletion of CD25+ T cells, once the population of CD25+ T reg cells was restored, all challenged mice developed lethal tumors. Thus, the beneficial effect of depleting CD25+ T reg cells only takes place shortly after depletion of these cells, when their levels are still very low, suggesting that vaccination immediately after depletion of CD25+ T reg cells might greatly enhance the ability of the host to mount a protective antitumoral immune response. This strategy might even permit to induce antitumoral responses using the class I epitope only, because as shown in our work, a single administration of anti-CD25 mAb before immunization with AH1 permits the induction of a long-lasting protective antitumor immune response (83% of protection). However, in the absence of depletion of CD25+ cells, AH1 is unable to induce a protective response against challenge with CT26 tumor cells (18) due to the incapacity of this peptide to induce a competent Th response (19). Our results are in accordance with two recent publications suggesting that the presence of CD4+/CD25+ cells may restrict or control memory T cell responses (16, 17). In addition to the results reported by Kursar et al. (16), we show in this study that depletion of CD25+ T cells, previous to a single immunization (priming immunization), permits peptide vaccination to induce a protective long-lasting antitumoral effect which is not observed in the presence of CD25+ reg cells. We are aware that maintaining a CD25+ T reg-depleted status for a long period of time, may have the risk of developing autoimmunity (48, 49, 50). Also, depletion of T cells expressing the CD25+ marker would not only eliminate T reg cells, but also would deplete activated lymphocytes, including antitumor-specific CD4+ and CD8+ T cells, a situation that might facilitate tumor growth (14). For these reasons, depletion of CD25+ cells should probably be reserved to de novo vaccination under conditions of great caution.
When the antitumor efficacy after immunization with AH1 alone is compared with that attained after coimmunization with AH1 and Th peptide p320333, under different levels of depletion of CD25+ T reg cells, it is clear that Th cells play an important role to overcome the suppressive effect of CD25+ T reg cells. Thus, we have found that the protective effect of vaccinating with AH1 alone requires total depletion of CD25+ cells previous to immunization with AH1, and is very inefficient (0% protection) in the presence of as low as a 4.5% of total CD25+ cells. However, coimmunization of AH1 and p320333 allows total protection under both conditions, and reaches a considerable long-lasting protective response (33%) even in the presence of a 66.2% of total CD25+ T reg cells. To our knowledge, our results describe for the first time that Th cells may play an important role in overcoming the suppressive effect of CD25+ T reg on the induction of cellular immune responses. These results might be of great relevance when developing strategies of vaccination against cancer.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Juan J. Lasarte, Department of Internal Medicine, Medical School, University Clinic and Fundación para la Investigación Médica Aplicada, University of Navarra, Irunlarrea, 1, 31008, Pamplona, Spain. E-mail address: jjlasarte{at}unav.es ![]()
3 Abbreviations used in this paper: T reg, T regulatory cell; TCd, cytotoxic T cell determinant; THd, Th cell determinant; MuLV, murine leukemia virus. ![]()
Received for publication February 7, 2003. Accepted for publication September 30, 2003.
| References |
|---|
|
|
|---|
. Cancer Res. 62:5267.
but not interleukin 4 in the suppression of T helper type 1-mediated colitis by CD45RBlowCD4+ T cells. J. Exp. Med. 183:2669.
-induced, CD8+ T-cell-dependent immune defense of B16 melanoma. Cancer Res. 61:8643.
) monoclonal antibody. Cancer Res. 59:3128.
subtypes and levels of type I interferons in the liver and peripheral mononuclear cells in patients with chronic hepatitis C and controls. Hepatology 29:1900.[Medline]
-dependent inhibition of tumor angiogenesis by tumor-infiltrating CD4+ T cells requires tumor responsiveness to IFN-
. J. Immunol. 166:2276.
receptor expression by nonhematopoietic cells. Immunity 12:677.[Medline]
. Proc. Natl. Acad. Sci. USA 96:8633.
receptor in human tissues. Eur. J. Immunol. 22:2403.[Medline]
and its receptor. Annu. Rev. Immunol. 11:571.[Medline]
modulates TRAIL-mediated apoptosis in human colon carcinoma cells. Anticancer Res. 21:3733.[Medline]
-induced apoptosis. Gene Ther. 10:1067.[Medline]
receptors. Immunity 1:447.[Medline]
increases HLA-DR synthesis and expression. J. Immunol. 130:1492.[Abstract]
-interferon. J. Exp. Med. 160:255.
affect tumorigenicity and response to IL-12 therapy and antiangiogenesis. Immunity 9:25.[Medline]
-chains (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 155:1151.[Abstract]
This article has been cited by other articles:
![]() |
J. Qian, S. Hong, S. Wang, L. Zhang, L. Sun, M. Wang, J. Yang, L. W. Kwak, J. Hou, and Q. Yi Myeloma cell line-derived, pooled heat shock proteins as a universal vaccine for immunotherapy of multiple myeloma Blood, October 29, 2009; 114(18): 3880 - 3889. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Du, L. Jin, X. Han, Z. Song, H. Zhang, and W. Liang Naringenin: A Potential Immunomodulator for Inhibiting Lung Fibrosis and Metastasis Cancer Res., April 1, 2009; 69(7): 3205 - 3212. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Liu, H. S. Noh, J. Chen, J. H. Kim, L. D. Falo Jr., and Z. You Potent Tumor-Specific Protection Ignited by Adoptively Transferred CD4+ T Cells J. Immunol., September 15, 2008; 181(6): 4363 - 4370. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Morse, A. C. Hobeika, T. Osada, D. Serra, D. Niedzwiecki, H. K. Lyerly, and T. M. Clay Depletion of human regulatory T cells specifically enhances antigen-specific immune responses to cancer vaccines Blood, August 1, 2008; 112(3): 610 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gil-Guerrero, J. Dotor, I. L. Huibregtse, N. Casares, A. B. Lopez-Vazquez, F. Rudilla, J. I. Riezu-Boj, J. Lopez-Sagaseta, J. Hermida, S. Van Deventer, et al. In Vitro and In Vivo Down-Regulation of Regulatory T Cell Activity with a Peptide Inhibitor of TGF-{beta}1 J. Immunol., July 1, 2008; 181(1): 126 - 135. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Atanackovic, Y. Cao, T. Luetkens, J. Panse, C. Faltz, J. Arfsten, K. Bartels, C. Wolschke, T. Eiermann, A. R. Zander, et al. CD4+CD25+FOXP3+ T regulatory cells reconstitute and accumulate in the bone marrow of patients with multiple myeloma following allogeneic stem cell transplantation Haematologica, March 1, 2008; 93(3): 423 - 430. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Litzinger, R. Fernando, T. J. Curiel, D. W. Grosenbach, J. Schlom, and C. Palena IL-2 immunotoxin denileukin diftitox reduces regulatory T cells and enhances vaccine-mediated T-cell immunity Blood, November 1, 2007; 110(9): 3192 - 3201. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Zimmermann, A. Casati, C. Schiering, S. Caserta, R. Hess Michelini, V. Basso, and A. Mondino Tumors Hamper the Immunogenic Competence of CD4+ T Cell-Directed Dendritic Cell Vaccination J. Immunol., September 1, 2007; 179(5): 2899 - 2909. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Charalambous, M. Oks, G. Nchinda, S. Yamazaki, and R. M. Steinman Dendritic Cell Targeting of Survivin Protein in a Xenogeneic Form Elicits Strong CD4+ T Cell Immunity to Mouse Survivin J. Immunol., December 15, 2006; 177(12): 8410 - 8421. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Beyer and J. L. Schultze Regulatory T cells in cancer Blood, August 1, 2006; 108(3): 804 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Jarnicki, J. Lysaght, S. Todryk, and K. H. G. Mills Suppression of Antitumor Immunity by IL-10 and TGF-beta-Producing T Cells Infiltrating the Growing Tumor: Influence of Tumor Environment on the Induction of CD4+ and CD8+ Regulatory T Cells J. Immunol., July 15, 2006; 177(2): 896 - 904. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Andaloussi and M. S. Lesniak An increase in CD4+CD25+FOXP3+ regulatory T cells in tumor-infiltrating lymphocytes of human glioblastoma multiforme Neuro-oncol, July 1, 2006; 8(3): 234 - 243. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Taieb, N. Chaput, N. Schartz, S. Roux, S. Novault, C. Menard, F. Ghiringhelli, M. Terme, A. F. Carpentier, G. Darrasse-Jese, et al. Chemoimmunotherapy of tumors: cyclophosphamide synergizes with exosome based vaccines. J. Immunol., March 1, 2006; 176(5): 2722 - 2729. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Tirapu, E. Huarte, C. Guiducci, A. Arina, M. Zaratiegui, O. Murillo, A. Gonzalez, C. Berasain, P. Berraondo, P. Fortes, et al. Low Surface Expression of B7-1 (CD80) Is an Immunoescape Mechanism of Colon Carcinoma Cancer Res., February 15, 2006; 66(4): 2442 - 2450. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Comes, O. Rosso, A. M. Orengo, E. Di Carlo, C. Sorrentino, R. Meazza, T. Piazza, B. Valzasina, P. Nanni, M. P. Colombo, et al. CD25+ Regulatory T Cell Depletion Augments Immunotherapy of Micrometastases by an IL-21-Secreting Cellular Vaccine J. Immunol., February 1, 2006; 176(3): 1750 - 1758. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chattopadhyay, S. Mehrotra, A. Chhabra, U. Hegde, B. Mukherji, and N. G. Chakraborty Effect of CD4+CD25+ and CD4+CD25- T Regulatory Cells on the Generation of Cytolytic T Cell Response to a Self but Human Tumor-Associated Epitope In Vitro J. Immunol., January 15, 2006; 176(2): 984 - 990. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Moore, A. Gallimore, S. J. Draper, K. R. Watkins, S. C. Gilbert, and A. V. S. Hill Anti-CD25 Antibody Enhancement of Vaccine-Induced Immunogenicity: Increased Durable Cellular Immunity with Reduced Immunodominance J. Immunol., December 1, 2005; 175(11): 7264 - 7273. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wolf, A. M. Wolf, H. Rumpold, H. Fiegl, A. G. Zeimet, E. Muller-Holzner, M. Deibl, G. Gastl, E. Gunsilius, and C. Marth The Expression of the Regulatory T Cell-Specific Forkhead Box Transcription Factor FoxP3 Is Associated with Poor Prognosis in Ovarian Cancer Clin. Cancer Res., December 1, 2005; 11(23): 8326 - 8331. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ko, S. Yamazaki, K. Nakamura, T. Nishioka, K. Hirota, T. Yamaguchi, J. Shimizu, T. Nomura, T. Chiba, and S. Sakaguchi Treatment of advanced tumors with agonistic anti-GITR mAb and its effects on tumor-infiltrating Foxp3+CD25+CD4+ regulatory T cells J. Exp. Med., October 3, 2005; 202(7): 885 - 891. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dercamp, K. Chemin, C. Caux, G. Trinchieri, and A. P. Vicari Distinct and Overlapping Roles of Interleukin-10 and CD25+ Regulatory T Cells in the Inhibition of Antitumor CD8 T-Cell Responses Cancer Res., September 15, 2005; 65(18): 8479 - 8486. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Beyer, M. Kochanek, K. Darabi, A. Popov, M. Jensen, E. Endl, P. A. Knolle, R. K. Thomas, M. von Bergwelt-Baildon, S. Debey, et al. Reduced frequencies and suppressive function of CD4+CD25hi regulatory T cells in patients with chronic lymphocytic leukemia after therapy with fludarabine Blood, September 15, 2005; 106(6): 2018 - 2025. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Robertson, H.-C. Chang, D. Pelloso, and M. H. Kaplan Impaired interferon-{gamma} production as a consequence of STAT4 deficiency after autologous hematopoietic stem cell transplantation for lymphoma Blood, August 1, 2005; 106(3): 963 - 970. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kudo-Saito, J. Schlom, K. Camphausen, C. N. Coleman, and J. W. Hodge The Requirement of Multimodal Therapy (Vaccine, Local Tumor Radiation, and Reduction of Suppressor Cells) to Eliminate Established Tumors Clin. Cancer Res., June 15, 2005; 11(12): 4533 - 4544. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. M. Haeryfar, R. J. DiPaolo, D. C. Tscharke, J. R. Bennink, and J. W. Yewdell Regulatory T Cells Suppress CD8+ T Cell Responses Induced by Direct Priming and Cross-Priming and Moderate Immunodominance Disparities J. Immunol., March 15, 2005; 174(6): 3344 - 3351. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Yu, Y. Lee, W. Liu, T. Krausz, A. Chong, H. Schreiber, and Y.-X. Fu Intratumor depletion of CD4+ cells unmasks tumor immunogenicity leading to the rejection of late-stage tumors J. Exp. Med., March 7, 2005; 201(5): 779 - 791. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Prasad, K. J. Farrand, S. A. Matthews, J. H. Chang, R. S. McHugh, and F. Ronchese Dendritic Cells Loaded with Stressed Tumor Cells Elicit Long-Lasting Protective Tumor Immunity in Mice Depleted of CD4+CD25+ Regulatory T Cells J. Immunol., January 1, 2005; 174(1): 90 - 98. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |