Correction
for Kuchtey et al., J Immunol 171 (5) 2320-2325.
The Journal of Immunology, 2003, 171: 5631.
Copyright © 2003 by The American Association of Immunologists
CpG DNA Induces a Class II Transactivator-Independent Increase in Class II MHC by Stabilizing Class II MHC mRNA in B Lymphocytes
John Kuchtey,
Meghan Pennini,
Rish K. Pai and
Clifford V. Harding
John Kuchtey, Meghan Pennini, Rish K. Pai, and Clifford V. Harding. CpG DNA Induces a Class II Transactivator-Independent Increase in Class II MHC by Stabilizing Class II MHC mRNA in B Lymphocytes. The Journal of Immunology 2003;171:23202325
.
In Materials and Methods, in the first sentence under the heading Ag processing and presentation assays, the sequence of the control CpG oligodeoxynucleotide 1982 is incorrect. The correct sentence is below.
Nonmethylated, phosphorothioate-modified CpG ODN 1826 (TCCATGACGTTCCTGACGTT) and non-CpG ODN 1982 (TCCAGGACTTCTCTCAGGTT) were generously provided by Coley Pharmaceutical Group (Ottawa, Ontario, Canada).