The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garin, A.
Right arrow Articles by Combadiere, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garin, A.
Right arrow Articles by Combadiere, C.
The Journal of Immunology, 2003, 171: 5305-5312.
Copyright © 2003 by The American Association of Immunologists

Two Novel Fully Functional Isoforms of CX3CR1 Are Potent HIV Coreceptors 1

Alexandre Garin, Nadine Tarantino, Sophie Faure, Mehdi Daoudi, Cédric Lécureuil, Anne Bourdais, Patrice Debré, Philippe Deterre and Christophe Combadiere2

Laboratoire d’Immunologie Cellulaire et Tissulaire, Institut National de la Santé et de la Recherche Médicale, Unité 543, Hôpital Pitié-Salpêtriere, Paris, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We identified two novel isoforms of the human chemokine receptor CX3CR1, produced by alternative splicing and with N-terminal regions extended by 7 and 32 aa. Expression of the messengers coding these isoforms, compared with that of previously described V28 messengers, is lower in monocytes and NK cells, but higher in CD4+ T lymphocytes. CX3CR1 and its extended isoforms were expressed in HEK-293 cells and compared for expression, ligand binding, and cellular responses. In steady state experiments, all three CX3CR1 isoforms bound CX3CL1 with similar affinity. In kinetic binding studies, however, kon and koff were significantly greater for the extended CX3CR1 isoforms, thereby suggesting that the N-terminal extensions may alter the functions induced by CX3CL1. In signaling studies, all three CX3CR1 isoforms mediated agonist-dependent calcium mobilization, but the EC50 was lower for the extended than for the standard isoforms. In addition, chemotactic responses for these extended isoforms shifted left, also indicating a more sensitive response. Finally, the longer variants appeared to be more potent HIV coreceptors when tested in fusion and infection assays. In conclusion, we identified and characterized functionally two novel isoforms of CX3CR1 that respond more sensitively to CX3CL1 and HIV viral envelopes. These data reveal new complexity in CX3CR1 cell activation and confirm the critical role of the N-terminal domain of the chemokine receptors in ligand recognition and cellular response.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemokines are involved in diverse physiological and pathological conditions, mainly through their deployment of leukocytes (1, 2, 3). They mediate their effects via specific interactions with extracellular regions of chemokine receptors expressed at the leukocyte cell surface. The N-terminal domain of these receptors has been described as a crucial determinant in ligand binding and signaling (4, 5, 6, 7), and thus alterations in this domain may be of critical importance. Furthermore, the N-terminal domain plays a key role in interacting with the HIV envelope gp120 (8, 9, 10), at least for CCR5 and CXCR4, the two principal HIV coreceptors (11, 12, 13). Abs raised against the N terminals of CXCR4 and CCR5 inhibit cell fusion and infection with HIV-1 (8, 14), and the first 20 N-terminal residues of CCR5 function as a coreceptor when grafted onto a CCR2 backbone (15, 16). A current model of chemokine binding suggests a two-step mechanism involving initial recognition of the chemokine receptor N-terminal domain, followed by more specific interactions with the other extracellular domains. Recent findings of post-transcriptional modifications in the N-terminal domain of chemokine receptors indicate that regulation of receptor function is still more complex. CCR9 isoforms, termed CCR9A and CCR9B, which differ by 12 aa residues, differ in their ligand-binding affinity, Ca2+ flux, and chemotaxis (17). Similar modifications were observed for CXCR4-lo, an N-terminal protein isoform of CXCR4 (18). Together these data suggest that N-terminal isoforms of chemokine receptors can alter biochemical functions. Post-transcriptional modifications in the carboxyl-terminal regions have also been reported to affect the regulation of chemokine receptor functions (19).

We previously reported allelic isoforms of CX3CR1 associated with rapid HIV disease progression (20) and reduced susceptibility to acute coronary events (21). CX3CR1 is the receptor for CX3CL1, the only member of the CX3C subfamily (22). CX3CR1 is preferentially expressed in monocytes and NK cells (23) as well as in CD8+ T cells (24), glial cells and astrocytes (25) and may directly modulate neuronal activity and survival (26, 27). CX3CL1 and the chemokine CXCL16 (28) exist in both soluble and membrane-anchored forms. The soluble form of CX3CL1 recruits lymphocytes and monocytes (22, 29), whereas membrane-bound CX3CL1 directly mediates the capture and firm adhesion of CX3CR1-expressing leukocytes (23, 30); this discovery revealed a novel pathway for leukocyte activation. Recent reports point out physiopathological correlates to these functions: CX3CL1 knockout mice are less susceptible than their wild-type littermates to cerebral ischemia-reperfusion injury (31), while CX3CR1 KO mice reject cardiac transplants more slowly in the presence of cyclosporine (32) and form fewer atherosclerotic lesions in an apolipoprotein E background (33, 34). CX3CR1 plays a role in yet another disease; like CCR5 and CXCR4, it serves as an HIV coreceptor (35, 36). CX3CL1 specifically blocks CX3CR1 interaction with the HIV envelope gp120 (37). The physiological relevance of CX3CR1 in HIV nonetheless remains unclear (20, 38, 39).

Here we identify and functionally characterize two novel CX3CR1 isoforms that differ from the classic form of CX3CR1 (referred to here as Met +1) by N-terminal additions of 7 and 32 aa.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells and culture conditions

Resting PBMCs of heparinized venous blood taken from healthy volunteers were isolated by a one-step centrifugation on a Ficoll separating solution (Biochrom, Berlin, Germany). CD4+ T lymphocytes, CD8+ T lymphocytes, and NK cells were then isolated by positive selection through the use, respectively, of anti-CD4 mAbs, anti-CD8 mAbs, and a mixture of anti-CD16 and anti-CD56 mAbs coupled with magnetic beads (Miltenyi Biotec, Paris, France). Negative selection, using a mixture of anti-CD2, -CD7, -CD16, -CD19, and -CD56 mAbs coupled with magnetic beads (Dynal, Compiegne, France), was used to enrich monocytes. Flow cytometric analysis confirmed that the enriched cell populations were 95% pure. U373MG-CD4, HeLa, and HEK-293 cell lines were maintained in DMEM (Life Technologies SARL, Cergy Pontoise, France), supplemented with 10% FCS, 1 mM L-glutamine, and penicillin-streptomycin (100 U/ml). Cells used for HIV fusion and infection were provided by Dr. M. Alizon (Institut National de la Santé et de la Recherche Médicale, Unité 567, Universite Paris V-Rene Descartes, Paris, France). The U373MG-CD4 cells express the CD4 receptor and the lacZ gene driven by the long terminal repeat element, HeLa-EnvLAI cells express HIV-1 LAI, HeLa-EnvADA cells express HIV-1 ADA envelope glycoproteins, and both express HIV-1 trans-activator Tat.

RNA isolation and cDNA synthesis

Total RNA was extracted with the RNeasy Kit (Qiagen, Hilden, Germany) from 107 CD4+ T lymphocytes, monocytes, and NK cells from two healthy blood donors. Total RNA of 107 CD8+ T lymphocytes was extracted from two other healthy blood donors. Treatment with DNase I (30 U) prevented any genomic DNA contamination. Samples were then heated to denature DNase I. For each sample 1 µg of total RNA was reverse transcribed for 1 h at 37°C with an RT-PCR kit (Stratagene, La Jolla, CA).

SYBR-Green quantitative PCR

The SYBR-Green PCR kit (Applied Biosystems, Foster City, CA) was used according to the manufacturer’s instructions in a model 7700 sequence detector (Applied Biosystems). For each PCR, 150 nM forward (clone10-SP1, AGAGCTCTCTGGCTTCTGGGTGGAGAA; V28-SP1, TGGCTGACTGGCAGATCCAGAGGTT) and reverse (RACE-SP1, GGCCAATGGCAAAGATGACGGAGTA) primers were used to amplify 1 nM cDNA. Fluorescence was detected at the end of each elongation phase.

CX3CR1 isoform constructs

The open reading frame (ORF)3 corresponding to the CX3CR1 protein isoforms Met +1, Met -7, and Met -32 were produced from cDNA specific from clone 10 mRNA. Forward primers, designed to be specific to the 5' end of each isoform, were HindIII-tailed in the 5' end (+32 clone, GCGCATATAAGCTTGCCACCATGAGAGAACCCCTGGAGGCGT; +7 clone, GCGCATATAAGCTTGCCACCATGGCCAGTGGGGCCTTCAC). The reverse primer, common to all isoforms, was chosen to be specific to the 3' end of the CX3CR1 ORF and was XhoI-tailed in its 5' end (LT3-CX3CR1, GCGCATATAAGCTTGCCACCATGGATCAGTTCCCTGAATCAGTG). The PCR conditions were as follows: denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min. The PCR products were then digested with HindIII/XhoI, subcloned into the mammalian expression vector pCDNA3.1+ (Invitrogen, Leek, The Netherlands), and then sequenced onto both strands with the BigDye Terminator kit (Applied Biosystems, Warrington, U.K.).

Stable expression of CX3CR1 isoforms by HEK-293 cells

Two micrograms of each expression vector were transfected by 6 µg of Transfast (Promega, Charbonnieres, France) into 106 HEK-293 cells grown in DMEM. Two days later, transfected cells were selected with 1.5 µg/ml G-418 (Life Technologies, Gaithersburg, MD), and cell clones were isolated and tested for CX3CR1 expression by FACS analysis with FITC-anti-CX3CR1 Ab (MBL, Nagoya, Japan). Clones expressing each isoform protein were maintained in DMEM containing 0.5 µg/ml G-418. Three stable clones of each CX3CR1 isoform were independently assayed in further functional assays.

Generation of specific Met -32 isoform polyclonal Abs

Rabbit polyclonal Abs were raised against the human Met -7 and Met -32 CX3CR1 isoforms (AGRO-BIO, La Ferté Saint Aubin, France) and further purified.

Western blot analysis of CX3CR1 protein

HEK-293 cells were suspended at 108 cells/ml in 20 mM Tris (pH 7.5), 1 mM EDTA, and 1 mM DTT supplemented with complete protease inhibitor cocktail (Roche, Meylan, France). The cells were then homogenized at 4°C in a Dounce homogenizer (Kontes, Vineland, NJ). Nuclear and cellular debris was removed by centrifugation for 10 min at 10,000 x g. The supernatant was then centrifuged at 100,000 x g at 4°C for 30 min. The pellet was suspended in lysis buffer (20 mM Tris, 140 mM NaCl, 1 mM EDTA, and 0.1% Nonidet P-40, pH 7.4) supplemented with complete protease inhibitor cocktail. The samples were then assayed for protein content and resuspended in sample buffer (50 mM Tris (pH 7), 3% SDS, 10% glycerol, 5% 2-ME, and bromophenol blue). Proteins were separated by SDS-PAGE with Porzio and Pearson’s method (40). Acrylamide gels (10%) were electrotransferred to Hybond-P nitrocellulose membrane (Amersham Pharmacia Biotech, Orsay, France), and the blots were probed with either polyclonal Abs raised against a peptide corresponding to aa 2–21 of the human CX3CR1 (Chemicon International, Temecula, CA), in accordance with the manufacturer’s instructions or with our polyclonal Abs raised against the human Met -7 or Met -32 isoform. For detection, we used HRP-conjugated goat anti-mouse IgG (Bio-Rad, Marnes-la-Coquette, France) and an ECL detection system (Amersham Pharmacia Biotech, Piscataway, NJ), in accordance with the manufacturer’s instructions, on Curix Blue x-ray film (Agfa, Mortsel, Belgium).

Radioligand competition CX3CR1 binding assay

Binding assays used [125I]CX3CL1 (Amersham Pharmacia Biotech) in duplicate with 5 x 104 CX3CR1-expressing HEK cells as previously described (37). Briefly, cells were incubated in a total volume of 200 µl of PBS containing 1 mg/ml BSA and 0.01% azide (pH 7.4) with 50 pM [125I]CX3CL1 and with or without increasing concentrations of unlabeled human CX3CL1 (PeproTech, Rocky Hill, NJ) or 50 nM unlabeled chemokines (CCL2, CCL5, CCL20, CCL21, CXCL1, CXCL8, CXCL12, and v-macrophage inflammatory protein-II; PeproTech). Azide was added to prevent ligand-mediated internalization of CX3CR1. After 2 h at 37°C, unbound chemokines were separated from cells by centrifugation in 1 ml of PBS complemented with 10% sucrose. Gamma emissions were then counted in the cell pellet. For association studies, cells were incubated with [125I]CX3CL1 for increasing periods of time and washed. For dissociation studies, cells were incubated for 2 h and washed to remove excess [125I]CX3CL1. Cells were then incubated in PBS/BSA/azide and harvested after various periods of incubation. After washing, cells were processed for radioactivity measurements.

Intracellular calcium measurements

Intracytoplasmic free calcium was measured with Fura-2/AM (Molecular Probes, Leiden, The Netherlands). HEK-293 cells (3 x 106) were washed once and loaded for 45 min at 37°C in the dark with 2 µM Fura-2/AM and 2 µM pluronic acid in 1 ml of HBSS buffer supplemented with 10 mM HEPES, 0.5 mM MgCl2, and 1 mM CaCl2. Cells were centrifuged, and the pellet was resuspended in 2 ml of the same buffer and transferred to a quartz cuvette for reading. CX3CL1 was added to the 2-ml cell volume at various concentrations. Fluorescence was monitored with a spectrofluorometer (SAFAS, Monaco) in cuvettes thermostatically controlled at 37°C and stirred continuously. The cell suspension was excited alternately at 340 and 380 nm, and fluorescence was measured at 510 nm. Ten-nanometer slit widths were used for both excitation and emission. Graphic representations of intracellular calcium concentrations were computed with the equation: Ca2+ concentration = 225 x (R-)/(Rmax - R) x Sf380/Sb380, previously determined by Grynkiewicz et al. (41). R was the ratio of the fluorescence measured at the 340 and 380 nm excitations. Rmax was assessed by lysing the cells with 0.5% Triton X-100 for Rmax, and Rmin was determined by adding the excess EGTA. Sb380 and Sf380 were the fluorescence levels with 380 nm excitation, both determined under the same conditions.

Chemotactic activity of CX3CL1 on CX3CR1-transfected HEK-293 cells

Chemotaxis was assayed in a 96-well chemotaxis chamber with a filter porosity of 10 µm (NeuroProbe, Cabin John, MD). HEK-293 cells were washed twice with PBS, resuspended in serum-free RPMI 1640 containing 0.1% BSA, then labeled for 30 min at 37°C with CFSE (Molecular Probes) in PBS. Cells were then washed in PBS and resuspended in RPMI 1640 medium (106 cells/ml); 60 µl of cell suspension was then loaded onto the filter. A final volume of 28 µl of medium with various concentrations of CX3CL1 was placed in the lower chamber. The 96-well plate was incubated for 2–3 h at 37°C in 100% humidity and 5% CO2. The filter-top surface was rinsed with PBS, and the plate was centrifuged for 2 min at 1500 rpm. Fluorescence was measured with a Packard Fusion microplate analyzer (PerkinElmer, Boston, MA).

Fusion and infection assays

Fusion and infection assays were performed as previously described by Sol et al. (42). Briefly, for both assays, 2 x 105 U373MG-CD4 cells were transiently transfected in DMEM with 1 µg of each CX3CR1 isoform and 3 µg of Transfast (Promega, Charbonieres, France). After 48 h, 5 x 104 of these cells were cocultured with HeLa-P4.2-EnvLAI and HeLa-P4.2-EnvADA at a 1:1 ratio for the fusion assay. At the same time, 5 x 104 of these cells were infected in DMEM (DEAE-dextran, 60 µg/ml) for 3 h with 10 ng of LAI, VIA, or V7 virus (respectively, R5-tropic, X4-tropic, and triple-tropic) and then extensively washed in DMEM to remove adsorbed virus. Twenty-four hours later, cells were lysed with 100 µl of lysis buffer (5 mM MgCl2 and 0.1% Nonidet P-40), and chlorophenolred-{beta}-D-galactopyranoside (Calbiochem-Novabiochem, Bad Soden, Germany) was added at a final concentration of 600 mM to assess {beta}-galactosidase activity. This reading was made at an excitation length of 570 nm and an emission length of 690 nm, with an Emax precision microplate reader (Molecular Devices, Wokingham, U.K.). For all experiments, the low background signal obtained with target cells transfected by pCDNA3 was subtracted from the signal reported. Results were also standardized according to CX3CR1 expression, measured as previously described, to estimate the total number of CX3CL1 binding sites.

Statistical analysis

Data handling, analysis, and graphic representation were performed using PRISM 2.01 (GraphPad Software, San Diego, CA). Curve regression and analysis used nonlinear regression analysis. Statistical analyses assessed the means by paired two-sample t tests.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of novel human CX3CR1 transcripts

We previously identified three CX3CR1 transcripts that differ only in their 5'-untranslated regions and demonstrated that they are controlled by three independent promoters (43). Interestingly, one of the three messengers, clone 10, contains two other in-frame AUG codons that can extend the protein by 7 or 32 aa (Fig. 1A). The first AUG codon is flanked by an A in -3, essential for the 40S ribosomal subunit trapping and for fixation of the 60S ribosomal subunit. Downstream, the AUG is flanked by an A in +4, which is less optimal for initiating protein translation than a G (44). This context is reported to be favorable for leaky scanning, so that initiation of translation may also occur at the downstream AUG codon. The second AUG conforms to a fully functional Kozak consensus sequence (A in -3 and G in +4), which should preclude leaky scanning. Finally, the third AUG, which corresponds to the initiating AUG previously described for the classic CX3CR1 isoform, should not be used by clone 10. Thus, clone 10 is probably translated in two isoforms of CX3CR1, which we call Met -32 and Met -7, both longer than Met +1, the classic isoform.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. Identification and cell distribution of a new CX3CR1 messenger. A, 5' sequence and deduced translation of CX3CR1 clone 10 messenger. Uppercase letters represent the potential translated mRNA sequence. Methionine codons are in black boxes, and Kozak consensus sequences are underlined. The positions of codons are indicated above, starting at the methionine of the classic form of CX3CR1 (Met +1). The amino acid charge is indicated under its respective codon. B, Comparison of V28 and clone 10 messenger expression by SYBR-Green quantitative PCR analysis. Total RNA extracted from various cell populations was reverse transcribed, and cDNA products were subjected to specific PCR amplification. Data are expressed as the level of V28 and clone 10 messenger expression after normalization based upon V28 messenger expression within NK cells, according to the following calculations: 2e(CTNK-V28-CTX) x 100, where CT represents the cycle at which a significant increase in SYBR-Green signal intensity is first detected, and X is the messenger within a subpopulation tested. Data are the mean ± SEM of three independent experiments with cDNA from four healthy blood donors (N1 to N4).

 
A key factor affecting chemokine receptor functions is the presence of charged amino acids in the extracellular N terminus. The first 35 aa are thus known to be critical for ligand binding and signaling. Interestingly, the global charge of the additional amino acids in Met -32 is neutral: five are basic, and four are acidic (Fig. 1A). Likewise, all the additional amino acids in the CX3CR1 Met -7 isoform are neutral. Hence, the Met -7 and Met -32 isoforms do not change the global charge of CX3CR1 and thus prevent repulsion. Nevertheless, the presence of four serines in Met -32 and one in Met -7 might provide additional O-glycosylated potential sites that could enhance ligand binding, as reported for CCR5 (45).

To determine the relative expression of these isoforms in PBMCs, we performed SYBR-Green quantitative PCR with primers designed specifically to amplify clone 10, which contains the three AUG and the previously described V28 transcripts that translate only CX3CR1 Met +1. Both transcripts were detected in each of the leukocyte subpopulations tested: CD4+ T lymphocytes, CD8+ T lymphocytes, NK cells, and monocytes. As expected, V28 messengers were expressed mainly by NK cells and monocytes, while clone 10 messenger expression was more homogeneous throughout the subpopulations (Fig. 1B). Nonetheless, the relative expression of V28 and clone 10 messengers varied in each population. V28 messengers were expressed principally in NK cells (14–35 times more than clone 10 messengers) and in monocytes (3–5 times more), CD4+ T lymphocytes contained 2–4 times more clone 10 messengers. Surprisingly, the CD8+ T lymphocytes from blood donor 3 contained 3.5 times more V28 messengers than clone 10 messengers, but this ratio was reversed for blood donor 4 (28 fold less), a finding that suggests a subtle regulation of CX3CR1 transcription within CD8+ T cells. These results indicate that clone 10 messengers are present in each leukocyte subpopulation we tested and may thus cause the production of CX3CR1 Met -7 and CX3CR1 Met -32 isoforms.

CX3CR1 isoforms identification

To test whether the CX3CR1 isoforms were functional, we generated stable HEK-293 cell lines that expressed each isoform and tested them for the presence of cell surface CX3CR1 by flow cytometric analysis. Despite the N-terminal extension, both Met -7 and Met -32 isoforms could be detected with polyclonal CX3CR1-specific Abs. Three clones of each isoform, chosen for their high expression on FACS analysis, underwent further functional testing to ensure that any hypothetical function differences were not clone specific.

The presence of specific CX3CR1 isoforms in the transfected HEK-293 cells was tested by Western blotting (Fig. 2, A and B). The commercial Ab revealed two specific bands, at ~27 and 30 kDa, in the CX3CR1 Met +1 cell extract compared with the control CCR5 transfected HEK-293 cells. The weaker intensity of the 30-kDa band may reflect post-translational modifications occurring with Met +1 or a CX3CR1 protein denaturation defect. Similarly, two specific bands with slightly higher molecular masses appeared in the Met -7 cell extract, and two more with apparent molecular weights of ~31 and 34 kDa in the Met-32 cell extract. With our polyclonal Abs specific to the Met -32 isoform, no bands were detected in either the CX3CR1 Met +1 or CCR5 cell extracts, and a single specific band was observed for the CX3CR1 Met -32 cell extract (Fig. 2B). Polyclonal Abs raised against the Met -7 isoform had no activity. Moreover, the polyclonal Abs raised against the Met -32 isoform did not reveal any identifiable specific bands within the primary cell extract, probably because CX3CR1 expression in these cells was so low compared with that in the HEK-transfected cells (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 2. Identification of CX3CR1 isoforms by Western blot analysis. Membrane extracts from different CX3CR1 isoform-transfected HEK-293 cells were separated by SDS-PAGE and electrotransferred to a nitrocellulose membrane. The CCR5-HEK-293 clone was used as a negative control. The protein markers are indicated in kilodaltons. The blots were probed with polyclonal Abs raised against a peptide corresponding to aa 2–21 of the human CX3CR1 (A) and also against a peptide corresponding to aa -25/-12 of the Met -32 isoform (B).

 
Together, these data indicate that the extended isoforms of CX3CR1 are effectively produced in HEK-transfected cells and suggest that the Met -32 isoform may be produced within primary cells.

CX3CR1 isoforms bind CX3CL1

To compare the capacity of each protein isoform to bind CX3CL1, we performed binding assays on CX3CR1-transfected HEK-293 cells. In steady state experiments, the three isoforms bound the [125I]CX3CL1, which in competition assays was displaced by increasing concentrations of nonradioactive CX3CL1. As the competition curves show (Fig. 3A), the affinity was similar for all three isoforms, with a slight tendency toward better affinity for the elongated forms (IC50 = 0.4 ± 0.1 nM for Met -7 and IC50 = 0.4 ± 0.1 nM for Met -32) compared with the classic form (IC50 = 1.3 ± 0.6 nM for Met +1). These modest increases in affinity did not, however, reach statistical significance. In contrast, the similarity of the total number of CX3CL1 binding sites within each isoform clone suggests that N-terminal additions do not affect membrane expression. In addition, because the N-terminal regions of chemokine receptors are critically involved in ligand recognition, we tested whether N-terminal extension altered CX3CR1 specificity. None of the other human chemokines (CCL2, CCL5, CCL20, CCL21, CXCL1, CXCL8, and CXCL12) or the HHV8-produced viral ligand v-macrophage inflammatory protein-II (tested up to 50 nM) competed significantly against [125I]CX3CL1 (data not shown).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 3. Specific binding of 125I-labeled CX3CL1 to different CX3CR1 isoforms. A, HEK-293 cells stably transfected with CX3CR1 isoforms were incubated with increasing concentrations of unlabeled CX3CL1 in the presence of 0.05 nM [125I]CX3CL1. Cells were then washed, and the bound labeled CX3CL1 was quantitated in a gamma counter. These data were analyzed with PRISM software (GraphPad) and are the means ± SEM of four or six independent experiments performed in duplicate. The IC50 calculated for each isoform is indicated at the right of the curves. B, CX3CR1-transfected HEK-293 cells were incubated with 0.05 nM [125I]CX3CL1 for the times indicated, and cell-associated radioactivity was measured. Data are the mean ± SEM of three independent experiments performed in duplicate. C, CX3CR1-transfected HEK-293 cells were incubated with 0.05 nM [125I]CX3CL1 for 2 h, washed, and resuspended in chemokine-free binding medium. Cells were then harvested at the times indicated, and cell-associated radioactivity was measured. Data are the mean ± SEM of three independent experiments performed in duplicate.

 
Because the IC50 for the extended isoforms showed slight differences in the steady state experiments, we performed kinetic experiments to characterize in more detail CX3CL1 affinity to each CX3CR1 isoform. Surprisingly, the association rate constants (kon) for Met -7 and Met -32 were higher (kon = 5.13 ± 0.57 and 6.20 ± 0.53 nM/min, respectively) than that for Met +1 (kon = 3.17 ± 0.63 nM/min; Fig. 3B), thereby indicating that Met -7 and Met -32 associate more slowly with CX3CL1 than does Met +1. Reciprocally, when the excess ligand was washed, and dissociation was monitored, Met -7 and Met -32 had higher dissociation rate constants (koff = 199 ± 51 and 398 ± 84 min-1, respectively) than Met + 1 (koff = 66 ± 18 min-1; Fig. 3C); this indicates that the Met -7 and Met -32 isoforms dissociated more slowly. Together, these data show that the CX3CR1 N-terminal addition modestly affected the binding and release of CX3CL1. It is nonetheless possible that such modest changes in binding may affect isoform signaling and downstream functions.

CX3CL1 is a better agonist for extended isoforms of CX3CR1

To determine whether changes in binding affected functional moieties, we monitored calcium fluxes in CX3CR1 isoform-transfected HEK-293 clones. Stimulation of each CX3CR1 isoform with 10 nM CX3CL1 elicited a transient increase in intracellular calcium concentration, of similar intensity in each case (Fig. 4A). Interestingly, as Fig. 4B shows, the dose-response curves revealed that the threshold, half-maximal, and saturating concentrations of CX3CL1 were lower for the extended CX3CR1 isoforms (EC50 for Met -7 = 0.13 ± 0.05 nM; EC50 for Met -32 = 0.08 ± 0.04 nM) than for Met +1 (EC50 = 0.57 ± 0.19 nM; p < 0.05). We also performed desensitization analyses with all three isoforms. A concentration of 10 nM CX3CL1 fully abrogated the response to a subsequent stimulation with 100 nM CX3CL1, whereas 1 nM inhibited 50% of the calcium mobilization in response to a second optimal challenge (data not shown). Comparison of the desensitization curves of each isoform showed no differences between them.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 4. Agonist-dependent calcium mobilization in HEK-293 cells expressing the different CX3CR1 isoforms. A, Stably transfected HEK-293 were loaded with Fura-2, and intracellular calcium concentrations were monitored as described in Materials and Methods. Cells were stimulated with 10 nM CX3CL1 at the time indicated by an arrow. The data show one assay that is representative of five independent experiments. B, CX3CL1 potency in CX3CR1 isoform-transfected HEK-293. The amplitude of the transient calcium peak elicited by the concentration of CX3CL1 indicated in CX3CR1 isoform-transfected HEK-293 is shown. Data are the mean ± SEM of five independent experiments.

 
Chemotactic activity of CX3CL1 on CX3CR1 isoforms

All CX3CR1 isoforms responded to CX3CL1 chemotactically in a dose-dependent fashion, producing the expected bell-shaped curve with similar maximal chemotaxis indexes (~1.70; Fig. 5). The Met -32 HEK clones responded to lower CX3CL1 concentrations than Met +1 or Met -7 HEK clones. The half-maximal chemotactic response for Met -32-transfected HEK occurred at ~0.1 nM CX3CL1 while at that concentration, Met +1 and Met -7 cell responses represented only 15% of the maximal migration (p < 0.05). Moreover, desensitization of the migration required lower concentrations of CX3CL1 for Met -7 and Met -32 HEK clones than for Met +1 HEK clones (mid-desensitization at ~10 nM compared with ~100 nM; p < 0.05). Maximum migration of the isoforms was observed at different CX3CL1 concentrations (~0.5 nM for extended CX3CR1 and ~1 nM for CX3CR1 Met +1). Together, these data suggest that cells that express extended isoforms of CX3CR1 are more prone to migration in response to CX3CL1.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 5. Chemotaxis activity of CX3CR1 isoform-transfected HEK-293 in response to CX3CL1. CFSE-labeled HEK-293 cells stably transfected with CX3CR1 isoforms were tested against increasing concentrations of CX3CL1 in a 96-well chemotaxis chamber. After loading 60,000 cells, the 96-well plate was incubated for 3 h at 37°C. Fluorescence in the bottom well was measured. Results are expressed as a chemotactic index, representing the number of cells migrating in response to CX3CL1 relative to the number of cells migrating in the absence of the chemokine. Data are the mean ± SEM of six independent experiments performed in triplicate.

 
Extended forms of CX3CR1 are potent HIV fusion and infection cofactors

CX3CR1 has been described as an HIV-1 coreceptor for a limited number of viral envelopes. Because N-terminal regions of CCR5 and CXCR4 have been involved in interactions with HIV envelopes, we compared the CX3CR1 isoforms in both fusion and infection assays to investigate their HIV-1 coreceptor potencies. The results were normalized to the relative binding capacities to iodinated CX3CR1 of U373MG-CD4 cells transfected with each isoform. Surprisingly, U373MG-CD4 cells transfected with Met -7 and Met -32 isoforms fused with both HeLa-EnvLAI and HeLa-EnvADA cells 5 times more than did Met +1 (p < 0.05), with no difference in terms of viral envelope specificity (Fig. 6A). Fusions with extended isoforms of CX3CR1 occurred at one-third and one-fifth the rates of those obtained with CCR5- and CXCR4-transfected cells, respectively (data not shown). Similarly, both extended CX3CR1 isoforms responded more vigorously to infection (4.5- to 15-fold increased) from three types of viruses, LAI, VIA, and V7 (Fig. 6B). These data showed that both forms of extended CX3CR1 may serve as potent HIV-1 coreceptors for R5 and X4-tropic strains.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 6. Extended CX3CR1 isoforms are potent HIV coreceptors. Fifty thousand U373MG-CD4-lacZ cells transfected with CX3CR1 isoforms were assessed for fusion or infection. A, Coculture was performed with 50,000 HeLa-Tat cells expressing the prototypical R5 (EnvADA) or XR4 envelope (EnvLAI). Fusion was measured after 24 h of cell coculture by measuring {beta}-galactosidase activities with a microplate reader. B, The infection assay was performed at 2 h with 0.5 ng of virus to infect 50,000 CX3CR1-transfected U373MG-CD4-lacZ cells. Infection was measured after 24 h of incubation by measuring {beta}-galactosidase activities with a microplate reader. Data are expressed as fusion or infection activity and represent the following calculations: OD observed in the presence of CX3CR1 isoforms - OD observed in the presence of pcDNA3/binding observed in presence of CX3CR1 isoforms - binding observed in presence of pcDNA3. Data are the mean ± SEM of eight independent experiments performed in triplicate. *, p < 0.05.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously showed the existence of three distinct CX3CR1 mRNAs among leukocyte subpopulations and demonstrated that they were controlled by three different promoters (43). Here, we have identified a novel complexity in CX3CR1 regulation; we characterized two novel CX3CR1 isoforms that differ from the form previously described by N-terminal additions of 7 and 32 aa. These extended isoforms of CX3CR1 are fully functional and may be more sensitive to CX3CL1, as binding, calcium, and chemotaxis assays show. These novel isoforms are potent in vitro HIV coreceptors.

Both isoforms may be translated from a single mRNA (clone 10) that also contains, in-frame, the AUG used for the translation of the classic CX3CR1 form. Accordingly, we measured the relative expression of clone 10 and V28 transcripts in several leukocyte subpopulations. Clone 10 messengers were present within every leukocyte subpopulation tested and were expressed predominantly by CD4+ T lymphocytes. If leaky scanning occurs from the far upstream AUG, the Met -7 isoform may be translated as well as the Met -32 isoform. The environment of the second AUG, however, precludes any leaky scanning and thus prevents translation of the Met +1 form. Therefore, the latter may be synthesized only by the other two alternative messengers described (V28 and clone 6). The presence of multiple consecutive start codons within messengers is a well-known mechanism in leukocyte translation regulation, as Kozak noted for lymphocytes (46). Surprisingly, Abs raised against the N terminus of the Met +1 form can also detect the extended CX3CR1 isoforms on HEK clones. Consistent with the presence of both V28 and clone 10 messengers within the leukocyte subpopulation, CX3CR1 Abs may bind only to the Met +1 form without detecting the longer isoforms. Nevertheless, the increased molecular mass in Fig. 2 and the functional differences in Figs. 3–6 reveal the presence of the extended isoforms. The functional differences between the isoforms may be underestimated, because all three isoforms may be present simultaneously.

The CX3CR1 isoforms described here differ from previously reported chemokine receptor isoforms that are generated by alternative splicing. Two isoforms of CXCR4 have been described (18): one results from a splicing event between a 5' exon coding for the first five N-terminal amino acids and a 3' exon coding for the remaining ORF, and the second transcript, called CXCR4-lo, arises from an intron-coding sequence that exchanges the first nine N-terminal amino acids. Assays of intracellular calcium release and of chemotaxis in transfected cells have shown that both isoforms are responsive to CXCL12. Another example of splicing variants that code for chemokine receptor isoforms is CCR9A and CCR9B, both of which are functional (17). Nevertheless, CCR9B, which is 12 aa shorter than CCR9A, is more sensitive to its ligand CCL25. CCR2 splice variants, known as CCR2A and CCR2B, also result from alternative splicing and differ in the carboxyl-terminal region (19). While both forms are functional, CCR2A is far less abundant than CCR2B in monocytes and macrophages. CX3CR1 Met +1 and the extended isoforms, on the other hand, are driven by two independent promoters. This fact may allow different levels of expression during cell differentiation or maturation and may explain the differential expression we found in leukocyte subpopulations. The two promoters may be differentially regulated upon stimulation as well; this hypothesis remains to be elucidated.

Despite their N-terminal extensions, the two longer isoforms still bind CX3CL1 in steady state experiments with an affinity similar to that of the Met +1 form. The higher association and dissociation rate constants found in the extended isoforms, however, indicate that they not only bind CX3CL1 more slowly, but also retain the ligand much longer. The higher kon and koff that we observed may result from sterical environment modifications, since the level of the kinetic constant correlates directly with the size of the isoforms rather than with additional amino acid charges. Our results indicate that amino extension may not drastically affect specific recognition of CX3CL1, but may instead decrease its accessibility. Nevertheless, the extended tail may anchor the ligand in the binding pocket and limit its release. Moreover, it remains possible that different degrees of post-translational modifications of CX3CR1 isoforms may affect isoform binding differently. Fong et al. (47) showed that tyrosine sulfation of residues 14 and 22 is a key element in CX3CL1 binding. No post-translational modifications of the extended forms of CX3CR1 are currently known, although Western blotting experiments suggest the existence of such phenomena (Fig. 2). The multiple serine residues present in CX3CR1 Met -32 may be susceptible to O-glycosylation and may affect ligand recognition, as proposed for CCR5 (45). However, neither treatment with glycosidase to prevent O-glycosylation nor growing the cells in the absence of sulfate to limit tyrosine sulfation affected the number and size of the bands detected. This suggests either that other post-translational modifications occurred or that CX3CR1 proteins were denatured in various ways.

In addition to their modestly increased affinity, the CX3CR1 extended isoforms appeared slightly more sensitive than the classic form in such functional assays as calcium response and chemotaxis. The threshold, half-maximal, and saturating concentrations required lower levels of CX3CL1. It also remains possible that the signaling pathways mediated by the CX3CR1 isoforms generate different signaling and biological events in response to CX3CL1. We did not, however, observe any significant difference in the phosphorylation of ERK1/2 or in the adherence of CX3CR1 cells to immobilized CX3CL1 (data not shown). Hence, the existence of these CX3CR1 isoforms may expand the range of CX3CL1 concentrations over which a cell can migrate and thus allow more sensitive responses. Although the CX3CR1 isoforms were more sensitive in terms of calcium efflux and chemotaxis, the physiological importance of these slight differences is an unresolved point. We did observe, however, that every difference occurred at physiological CX3CL1 concentrations.

Besides its physiological roles, CX3CR1 is subverted by HIV to allow virus entry. We and others have shown that CX3CR1 is a minor in vitro coreceptor for HIV strains (35, 36, 37). Here, we limited our investigations to biochemical studies relevant to HIV infection, namely, the role of CX3CR1 in both fusion and infection assays and therefore its physical involvement as an HIV coreceptor, and we found that both the Met -7 and Met -32 isoforms were more potent coreceptors than the classic form for the R5, X4, and X4R5 strains of HIV-1. To date, CCR5 and CXCR4 are the principal HIV coreceptors used by the virus to enter cells (48). According to our data, CCR5 and CXCR4 were only 3–5 times more potent in the fusion assay than the Met -7 and Met -32 isoforms. These extended isoforms of CX3CR1 may therefore be physiologically relevant for HIV infection in vivo. Although the presence of messengers could not be correlated to the protein expression, our data showed that clone 10 messengers were expressed more than V28 messengers in CD4+ T lymphocytes and only 3- to 5-fold less in monocytes, both primary targets of HIV. The presence of Met -7 and Met -32 isoforms in these CD4-expressing cells may thus promote virus entry. Further characterization of the mechanism by which fusion increases with these isoforms and further study of their involvement in HIV infection would be useful. For example, post-translational modifications of the N-terminal domain are critical for CCR5 fusion with gp120 (49). It remains possible that, as for CCR5, tyrosine sulfation of the extended CX3CR1 isoforms enhances coreceptor function. These N-terminal extensions and modifications may lead to a better understanding of the coreceptor function and may be targets for new therapeutic approaches. Studies now in progress will help to clarify this issue.

In conclusion, we describe two novel CX3CR1 isoforms with increased sensitivity to their CX3CL1 and gp120 ligands, as shown in binding and functional assays. The physiological advantages of these more sensitive receptors remain to be determined. Further work will address specific distributions of these isoforms, the biological relevance of this polymorphism, and its physiological implications for HIV.


    Footnotes
 
1 This work was supported by a grant from the Agence National de Recherche sur le SIDA and an Action Concertée Incitative grant for Jeunes Chercheurs from the French Ministry of Research. A.G. and S.F. are fellows of the Agence National de Recherche sur le SIDA, and M.D. is a fellow of the Ministry of Research. Back

2 Address correspondence and reprint requests to Dr. Christophe Combadiere, Laboratoire d’Immunologie Cellulaire et Tissulaire, Institut National de la Santé et de la Recherche Médicale, Unité 543, Hôpital Pitié-Salpêtriere, 91 boulevard de l’Hôpital, AP-HP, 75634 Paris Cedex 13, France. E-mail address: combad{at}ccr.jussieu.fr Back

3 Abbreviation used in this paper: ORF, open reading frame. Back

Received for publication October 25, 2002. Accepted for publication September 16, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Murphy, P. M.. 1994. The molecular biology of leukocyte chemoattractant receptors. Annu. Rev. Immunol. 12:593.[Medline]
  2. Luster, A. D.. 1998. Chemokines: chemotactic cytokines that mediate inflammation. N. Engl. J. Med. 338:436.[Free Full Text]
  3. Baggiolini, M.. 2001. Chemokines in pathology and medicine. J. Intern. Med. 250:91.[Medline]
  4. LaRosa, G. J., K. M. Thomas, M. E. Kaufmann, R. Mark, M. White, L. Taylor, G. Gray, D. Witt, J. Navarro. 1992. Amino terminus of the interleukin-8 receptor is a major determinant of receptor subtype specificity. J. Biol. Chem. 267:25402.[Abstract/Free Full Text]
  5. Hebert, C. A., A. Chuntharapai, M. Smith, T. Colby, J. Kim, R. Horuk. 1993. Partial functional mapping of the human interleukin-8 type A receptor: identification of a major ligand binding domain. J. Biol. Chem. 268:18549.[Abstract/Free Full Text]
  6. Monteclaro, F. S., I. F. Charo. 1996. The amino-terminal extracellular domain of the MCP-1 receptor, but not the RANTES/MIP-1{alpha} receptor, confers chemokine selectivity: evidence for a two-step mechanism for MCP-1 receptor activation. J. Biol. Chem. 271:19084.[Abstract/Free Full Text]
  7. Pease, J. E., J. Wang, P. D. Ponath, P. M. Murphy. 1998. The N-terminal extracellular segments of the chemokine receptors CCR1 and CCR3 are determinants for MIP-1{alpha} and eotaxin binding, respectively, but a second domain is essential for efficient receptor activation. J. Biol. Chem. 273:19972.[Abstract/Free Full Text]
  8. Feng, Y., C. C. Broder, P. E. Kennedy, E. A. Berger. 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272:872.[Abstract]
  9. Wu, L., G. LaRosa, N. Kassam, C. J. Gordon, H. Heath, N. Ruffing, H. Chen, J. Humblias, M. Samson, M. Parmentier, et al 1997. Interaction of chemokine receptor CCR5 with its ligands: multiple domains for HIV-1 gp120 binding and a single domain for chemokine binding. J. Exp. Med. 186:1373.[Abstract/Free Full Text]
  10. Farzan, M., H. Choe, L. Vaca, K. Martin, Y. Sun, E. Desjardins, N. Ruffing, L. Wu, R. Wyatt, N. Gerard, et al 1998. A tyrosine-rich region in the N terminus of CCR5 is important for human immunodeficiency virus type 1 entry and mediates an association between gp120 and CCR5. J. Virol. 72:1160.[Abstract/Free Full Text]
  11. Garzino-Demo, A., A. L. DeVico, R. C. Gallo. 1998. Chemokine receptors and chemokines in HIV infection. J Clin. Immunol. 18:243.[Medline]
  12. Hoffman, T. L., R. W. Doms. 1998. Chemokines and coreceptors in HIV/SIV-host interactions. AIDS 12:S17.
  13. Berger, E. A., P. M. Murphy, J. M. Farber. 1999. Chemokine receptors as HIV-1 coreceptors: roles in viral entry, tropism, and disease. Annu. Rev. Immunol. 17:657.[Medline]
  14. Lehner, T.. 2002. The role of CCR5 chemokine ligands and antibodies to CCR5 coreceptors in preventing HIV infection. Trends Immunol. 23:347.[Medline]
  15. Atchison, R. E., J. Gosling, F. S. Monteclaro, C. Franci, L. Digilio, I. F. Charo, M. A. Goldsmith. 1996. Multiple extracellular elements of CCR5 and HIV-1 entry: dissociation from response to chemokines. Science 274:1924.[Abstract/Free Full Text]
  16. Rucker, J., M. Samson, B. J. Doranz, F. Libert, J. F. Berson, Y. Yi, R. J. Smyth, R. G. Collman, C. C. Broder, G. Vassart, et al 1996. Regions in {beta}-chemokine receptors CCR5 and CCR2b that determine HIV-1 cofactor specificity. Cell 87:437.[Medline]
  17. Yu, C. R., K. W. Peden, M. B. Zaitseva, H. Golding, J. M. Farber. 2000. CCR9A and CCR9B: two receptors for the chemokine CCL25/TECK/Ck{beta}-15 that differ in their sensitivities to ligand. J. Immunol. 164:1293.[Abstract/Free Full Text]
  18. Gupta, S. K., K. Pillarisetti. 1999. Cutting edge: CXCR4-Lo: molecular cloning and functional expression of a novel human CXCR4 splice variant. J. Immunol. 163:2368.[Abstract/Free Full Text]
  19. Charo, I. F., S. J. Myers, A. Herman, C. Franci, A. J. Connolly, S. R. Coughlin. 1994. Molecular cloning and functional expression of two monocyte chemoattractant protein 1 receptors reveals alternative splicing of the carboxyl-terminal tails. Proc. Natl. Acad. Sci. USA 91:2752.[Abstract/Free Full Text]
  20. Faure, S., L. Meyer, D. Costagliola, C. Vaneensberghe, E. Genin, B. Autran, J. F. Delfraissy, D. H. McDermott, P. M. Murphy, P. Debre, et al 2000. Rapid progression to AIDS in HIV+ individuals with a structural variant of the chemokine receptor CX3CR1. Science 287:2274.[Abstract/Free Full Text]
  21. Moatti, D., S. Faure, F. Fumeron, M. Amara, P. Seknadji, D. H. McDermott, P. Debre, M. C. Aumont, P. M. Murphy, D. de Prost, et al 2001. Polymorphism in the fractalkine receptor CX3CR1 as a genetic risk factor for coronary artery disease. Blood 97:1925.[Abstract/Free Full Text]
  22. Bazan, J. F., K. B. Bacon, G. Hardiman, W. Wang, K. Soo, D. Rossi, D. R. Greaves, A. Zlotnik, T. J. Schall. 1997. A new class of membrane-bound chemokine with a CX3C motif. Nature 385:640.[Medline]
  23. Imai, T., K. Hieshima, C. Haskell, M. Baba, M. Nagira, M. Nishimura, M. Kakizaki, S. Takagi, H. Nomiyama, T. J. Schall, et al 1997. Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell 91:521.[Medline]
  24. Nishimura, M., H. Umehara, T. Nakayama, O. Yoneda, K. Hieshima, M. Kakizaki, N. Dohmae, O. Yoshie, T. Imai. 2002. Dual functions of fractalkine/CX3C ligand 1 in trafficking of perforin+/granzyme B+ cytotoxic effector lymphocytes that are defined by CX3CR1 expression. J. Immunol. 168:6173.[Abstract/Free Full Text]
  25. Nishiyori, A., M. Minami, Y. Ohtani, S. Takami, J. Yamamoto, N. Kawaguchi, T. Kume, A. Akaike, M. Satoh. 1998. Localization of fractalkine and CX3CR1 mRNAs in rat brain: does fractalkine play a role in signaling from neuron to microglia?. FEBS Lett. 429:167.[Medline]
  26. Meucci, O., A. Fatatis, A. A. Simen, R. J. Miller. 2000. Expression of CX3CR1 chemokine receptors on neurons and their role in neuronal survival. Proc. Natl. Acad. Sci. USA 97:8075.[Abstract/Free Full Text]
  27. Boehme, S. A., F. M. Lio, D. Maciejewski-Lenoir, K. B. Bacon, P. J. Conlon. 2000. The chemokine fractalkine inhibits Fas-mediated cell death of brain microglia. J. Immunol. 165:397.[Abstract/Free Full Text]
  28. Matloubian, M., A. David, S. Engel, J. E. Ryan, J. G. Cyster. 2000. A transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo. Nat. Immunol. 1:298.[Medline]
  29. Pan, Y., C. Lloyd, H. Zhou, S. Dolich, J. Deeds, J. A. Gonzalo, J. Vath, M. Gosselin, J. Ma, B. Dussault, et al 1997. Neurotactin, a membrane-anchored chemokine upregulated in brain inflammation. Nature 387:611.[Medline]
  30. Fong, A. M., L. A. Robinson, D. A. Steeber, T. F. Tedder, O. Yoshie, T. Imai, D. D. Patel. 1998. Fractalkine and CX3CR1 mediate a novel mechanism of leukocyte capture, firm adhesion, and activation under physiologic flow. J. Exp. Med. 188:1413.[Abstract/Free Full Text]
  31. Soriano, S. G., L. S. Amaravadi, Y. F. Wang, H. Zhou, G. X. Yu, J. R. Tonra, V. Fairchild-Huntress, Q. Fang, J. H. Dunmore, D. Huszar, et al 2002. Mice deficient in fractalkine are less susceptible to cerebral ischemia-reperfusion injury. J. Neuroimmunol. 125:59.[Medline]
  32. Haskell, C. A., W. W. Hancock, D. J. Salant, W. Gao, V. Csizmadia, W. Peters, K. Faia, O. Fituri, J. B. Rottman, I. F. Charo. 2001. Targeted deletion of CX(3)CR1 reveals a role for fractalkine in cardiac allograft rejection. J. Clin. Invest. 108:679.[Medline]
  33. Combadiere, C., S. Potteaux, J. L. Gao, B. Esposito, S. Casanova, E. J. Lee, P. Debre, A. Tedgui, P. M. Murphy, Z. Mallat. 2003. Decreased atherosclerotic lesion formation in CX3CR1/apolipoprotein E double knockout mice. Circulation 107:1009.[Abstract/Free Full Text]
  34. Lesnik, P., C. A. Haskell, I. F. Charo. 2003. Decreased atherosclerosis in CX3CR1-/- mice reveals a role for fractalkine in atherogenesis. J. Clin. Invest. 111:333.[Medline]
  35. Rucker, J., A. L. Edinger, M. Sharron, M. Samson, B. Lee, J. F. Berson, Y. Yi, B. Margulies, R. G. Collman, B. J. Doranz, et al 1997. Utilization of chemokine receptors, orphan receptors, and herpesvirus-encoded receptors by diverse human and simian immunodeficiency viruses. J. Virol. 71:8999.[Abstract]
  36. Reeves, J. D., A. McKnight, S. Potempa, G. Simmons, P. W. Gray, C. A. Power, T. Wells, R. A. Weiss, S. J. Talbot. 1997. CD4-independent infection by HIV-2 (ROD/B): use of the 7-transmembrane receptors CXCR-4, CCR-3, and V28 for entry. Virology 231:130.[Medline]
  37. Combadiere, C., K. Salzwedel, E. D. Smith, H. L. Tiffany, E. A. Berger, P. M. Murphy. 1998. Identification of CX3CR1: a chemotactic receptor for the human CX3C chemokine fractalkine and a fusion coreceptor for HIV-1. J. Biol. Chem. 273:23799.[Abstract/Free Full Text]
  38. McDermott, D. H., J. S. Colla, C. A. Kleeberger, M. Plankey, P. S. Rosenberg, E. D. Smith, P. A. Zimmerman, C. Combadiere, S. F. Leitman, R. A. Kaslow, et al 2000. Genetic polymorphism in CX3CR1 and risk of HIV disease. Science 290:2031.
  39. Hendel, H., C. Winkler, P. An, E. Roemer-Binns, G. Nelson, P. Haumont, S. O’Brien, K. Khalilli, D. Zagury, J. Rappaport, et al 2001. Validation of genetic case-control studies in AIDS and application to the CX3CR1 polymorphism. J. Acquired Immune Defic. Syndr. 26:507.
  40. Porzio, M. A., A. M. Pearson. 1977. Improved resolution of myofibrillar proteins with sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Biochim. Biophys. Acta 490:27.[Medline]
  41. Grynkiewicz, G., M. Poenie, R. Y. Tsien. 1985. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J. Biol. Chem. 260:3440.[Abstract/Free Full Text]
  42. Sol, N., F. Ferchal, J. Braun, O. Pleskoff, C. Treboute, I. Ansart, M. Alizon. 1997. Usage of the coreceptors CCR-5, CCR-3, and CXCR-4 by primary and cell line-adapted human immunodeficiency virus type 2. J. Virol. 71:8237.[Abstract]
  43. Garin, A., P. Pellet, P. Deterre, P. Debre, C. Combadiere. 2002. Cloning and functional characterization of the human fractalkine receptor promoter regions. Biochem. J. 368:753.[Medline]
  44. Kozak, M.. 1997. Recognition of AUG and alternative initiator codons is augmented by G in position +4 but is not generally affected by the nucleotides in positions +5 and +6. EMBO J. 16:2482.[Medline]
  45. Bannert, N., S. Craig, M. Farzan, D. Sogah, N. V. Santo, H. Choe, J. Sodroski. 2001. Sialylated O-glycans and sulfated tyrosines in the NH2-terminal domain of CC chemokine receptor 5 contribute to high affinity binding of chemokines. J. Exp. Med. 194:1661.[Abstract/Free Full Text]
  46. Kozak, M.. 1996. Interpreting cDNA sequences: some insights from studies on translation. Mamm. Genome. 7:563.[Medline]
  47. Fong, A. M., S. M. Alam, T. Imai, B. Haribabu, D. D. Patel. 2002. CX3CR1 tyrosine sulfation enhances fractalkine-induced cell adhesion. J. Biol. Chem. 277:19418.[Abstract/Free Full Text]
  48. Moore, J. P.. 1997. Coreceptors: implications for HIV pathogenesis and therapy. Science 276:51.[Free Full Text]
  49. Farzan, M., T. Mirzabekov, P. Kolchinsky, R. Wyatt, M. Cayabyab, N. P. Gerard, C. Gerard, J. Sodroski, H. Choe. 1999. Tyrosine sulfation of the amino terminus of CCR5 facilitates HIV-1 entry. Cell 96:667.[Medline]



This article has been cited by other articles:


Home page
Circ. Res.Home page
X. P. Yang, S. Mattagajasingh, S. Su, G. Chen, Z. Cai, K. Fox-Talbot, K. Irani, and L. C. Becker
Fractalkine Upregulates Intercellular Adhesion Molecule-1 in Endothelial Cells Through CX3CR1 and the Jak Stat5 Pathway
Circ. Res., November 9, 2007; 101(10): 1001 - 1008.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
F. Perros, P. Dorfmuller, R. Souza, I. Durand-Gasselin, V. Godot, F. Capel, S. Adnot, S. Eddahibi, M. Mazmanian, E. Fadel, et al.
Fractalkine-induced smooth muscle cell proliferation in pulmonary hypertension
Eur. Respir. J., May 1, 2007; 29(5): 937 - 943.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garin, A.
Right arrow Articles by Combadiere, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garin, A.
Right arrow Articles by Combadiere, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS