The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Montalbano, A.
Right arrow Articles by Feeney, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Montalbano, A.
Right arrow Articles by Feeney, A. J.
The Journal of Immunology, 2003, 171: 5296-5304.
Copyright © 2003 by The American Association of Immunologists

V(D)J Recombination Frequencies Can Be Profoundly Affected by Changes in the Spacer Sequence1

Alina Montalbano2,*, Kisani M. Ogwaro2,*, Alan Tang2,*, Adam G. W. Matthews{dagger}, Mani Larijani{dagger}, Marjorie A. Oettinger{dagger} and Ann J. Feeney3,*

* Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037; and {dagger} Department of Molecular Biology, Massachusetts General Hospital, and Department of Genetics, Harvard Medical School, Boston, MA 02114


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Each V, D, and J gene segment is flanked by a recombination signal sequence (RSS), composed of a conserved heptamer and nonamer separated by a 12- or 23-bp spacer. Variations from consensus in the heptamer or nonamer at specific positions can dramatically affect recombination frequency, but until recently, it had been generally held that only the length of the spacer, but not its sequence, affects the efficacy of V(D)J recombination. In this study, we show several examples in which the spacer sequence can significantly affect recombination frequencies. We show that the difference in spacer sequence alone of two VHS107 genes affects recombination frequency in recombination substrates to a similar extent as the bias observed in vivo. We show that individual positions in the spacer can affect recombination frequency, and those positions can often be predicted by their frequency in a database of RSS. Importantly, we further show that a spacer sequence that has an infrequently observed nucleotide at each position is essentially unable to support recombination in an extrachromosmal substrate assay, despite being flanked by a consensus heptamer and nonamer. This infrequent spacer sequence RSS shows only a 2-fold reduction of binding of RAG proteins, but the in vitro cleavage of this RSS is ~9-fold reduced compared with a good RSS. These data demonstrate that the spacer sequence should be considered to play an important role in the recombination efficacy of an RSS, and that the effect of the spacer occurs primarily subsequent to RAG binding.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The vast repertoire of Igs and TCRs is accomplished in part by the combinatorial association of three gene segments (V, D, and J) for one chain, and two gene segments (V and J) for the second chain of these heterodimeric Ag receptors. Each of the many V, D, and J gene segments is flanked by a recombination signal sequence (RSS),4 which is recognized by RAG1 and RAG2 (1, 2). These enzymes catalyze the joining of V, D, and J gene segments into a continuous exon encoding a complete Ag-binding domain. The RSS is composed of a conserved heptamer (CACAGTG) and nonamer (ACAAAAACC), separated by a spacer of conserved length, either 12 or 23 bp (3, 4, 5). Genes flanked by 12-bp spacer RSS join to gene segments flanked by 23-bp spacer RSS (5). The first 3 bp of the heptamer are essential for RSS recognition, and changes in those positions preclude recombination (3, 4). The other four positions are 77–91% conserved. The nonamer is slightly less conserved, but a stretch of 5 As preceded by a C is highly conserved in 12-bp nonamers (6). The 23-bp spacers show similar consensus motifs, with the exception that the fourth base pair of the nonamer is much more variable (6).

Although variations in the length of the spacer from the conserved 12 or 23 bp were shown early on to be deleterious, it was initially thought that the sequence of the spacer did not affect recombination (3, 4, 5). However, subsequent analysis showed that there was moderate conservation of some positions in the spacers, and that variations in the spacer sequence could affect recombination frequency up to 6-fold (6, 7, 8, 9, 10). In addition, we showed that naturally occurring variation in spacer sequences could contribute to the nonrandom use of human V{kappa} genes observed in vivo, and that a randomly generated variant of a human V{kappa} spacer was significantly worse in recombination efficiency (8, 11). In this study, we show that single base pair changes in the spacer sequence can significantly affect recombination efficacy. Furthermore, we made an RSS spacer composed of the most infrequently used nucleotides at each position according to the large database of spacers compiled by Ramsden et al. (6). We show that this Infrequent spacer, positioned between a consensus heptamer and nonamer, leads to very poor V(D)J rearrangement in a recombination substrate. The Infrequent spacer RSS binds RAG proteins 2-fold less well than an RSS with a spacer sequence that is close to consensus, and cleavage of this Infrequent RSS in cell-free assays is reduced 9-fold. Moreover, the VHS107 spacer sequence itself reduces recombination frequency in transient recombination substrate assays sufficiently to suggest that the spacer difference is a major contributing factor to the different recombination frequencies of these two VH genes in bone marrow pro-B cells (12). Hence, the spacer sequence plays a much more important role in recombination frequency than previously appreciated.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recombination substrates

The construction of the competition recombination substrates was previously described (8, 13). New RSS fragments were cloned into existing substrates at the MluI/NotI sites for the external fragment, the NotI/SalI site for the internal fragment, or the SpeI/SacII sites for the downstream fragment. V{kappa} fragments contained ~100 bp 5' of the RSS, and 5–100 bp downstream of the RSS. VH constructs contained ~200 bp 5' of the RSS, and ~3–30 bp 3' of the RSS. Changes in the spacer or flanking DNA were introduced by either by PCR overlap, or by the use of a reverse PCR primer containing the desired mutation. The downstream 23-bp RSS was the same J{kappa}1 fragment previously used for all of the competition substrates containing two V{kappa} RSS (8). For the VH and V{beta} competition substrates, the J{kappa}1 fragment was replaced with a fragment containing the 12-bp RSS from DSP2.2.

The recombination assay is the same as previously described, except that lower concentrations of caffeine and chloramphenicol were used (8). Briefly, constructs were transiently transfected into 18.8 A-murine leukemia virus pre-B cell lines in the presence of 0.5–1 mM caffeine, and the recovered plasmids were transformed and plated on plates containing 1–3 µg/ml chloramphenicol. The colonies were screened by PCR, as previously described (8). The structure of the recombination substrate and the screening assay are shown in Fig. 1. For each substrate, several independent transfections were performed.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 1. A spacer composed of infrequently observed nucleotides at each position is extremely poor at rearrangement. A, Diagram of the recombination substrate, and of the PCR assay for screening the recombinants. B, The consensus 12-bp spacer sequence is shown, with the frequency of the indicated nucleotide in the database shown. For position 7, A and C are present in equal frequency, and we used A in our experiment. V{kappa}A2 spacer is shown for comparison, and again the frequency of each nucleotide that differs from the consensus is shown. The Infrequent spacer used in the construct is shown. For two positions, 2 and 9, the frequency with which the least frequent nucleotide was present in the database was 5% or below, so we used the next most infrequent nucleotide as indicated. C, Competition recombination substrates were made with the indicated spacers, and the percentage of colonies that rearranged to the external or the internal RSS is shown. Consensus-G1 has a G in the first position, but the remainder of the spacer is the consensus sequence.

 
RAG-binding assay

Double-stranded oligonucleotides were made, as previously described (14). A2, A27 mutant, and Infrequent have 14 bp of the coding end DNA found in the V{kappa}A2 gene. VDJ 100/101 has 16 bp of 5' flanking DNA, which is different from the other three (14). All four of these RSS have consensus heptamers and nonamers. The top strand sequences of each are: A2, ATACAGCTTCCTCCCACAGTGGTACAGACCAATACAAAAACCTCCCTGCTGGGGTGT; A27 mutant, ATACAGCTTCCTCCCACAGTGAGTCAGCTTCAAACAAAAACCTCCCTGCTGGGGTGT; Infrequent, ATACAGC T T CC T CCCACAG T GGGGA T C T AAGAGACAAAAACC T CCCGCTGGGGTGT; VDJ 100, GCTGCAGGTCGACCTGCACAGTGCTACAGACTGGAACAAAAACCCAGGTCTC

EMSAs to detect single RSS complexes (SC1 and SC2) were performed, as described (15), except that reactions were conducted in 1 mM CaCl2 with 20 fmol of 32P-labeled duplex oligonucleotide substrate included in each reaction. Reaction products were separated through 5% polyacrylamide-TBE gels (19:1 acrylamide-bisacrylamide, 22.5 mM Tris, 22.5 mM boric acid, 0.5 mM EDTA) containing 6% glycerol. Gels were visualized by autoradiography and quantified using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) with ImageQuant software.

Cleavage assay

Standard oligonucleotide cleavage assays were performed, as described (16), except that 20 fmol of 32P-labeled duplex oligonucleotide substrate and 2 pmol of unlabeled, duplex nonspecific oligonucleotide competitor DNA were included in each reaction, and samples were incubated for 2 h at 30°C.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The RSS heptamer and nonamer consensus sequences were first identified on the basis of the high degree of conservation of nucleotides flanking the coding sequence (17, 18). The absence of such obvious conservation in the sequence separating the conserved heptamer and nonamer led to the early conclusion that the length of the spacer, but not its nucleotide composition, was playing a role in RSS recognition (3). However, Ramsden et al. (6) compiled and analyzed a large database of Ig and TCR RSS, and showed that some positions in the 12- and 23-bp spacers did show some conservation. For example, the first five positions in the 12-bp spacer nearest the heptamer are moderately conserved (50–67%), while several of the other positions show much less conservation. Furthermore, we and others have reported that the sequence of the spacer can affect recombination frequency, with up to 6-fold reduction in recombination frequency apparently due to differences in the spacer sequence (6, 7, 8, 9, 10). In this study, we wished to determine which part of the spacer influences recombination most strongly by dissecting some of these examples, and also to determine the extent to which a poor spacer sequence can reduce recombination.

We assessed relative recombination efficiency in competition recombination substrates, in which two V gene fragments, each containing a 12-bp RSS, compete for rearrangement to a downstream 23-bp RSS (19). The relative frequency of rearrangement of the two competing RSS in the recombined plasmids is determined by a PCR screening assay of individual colonies, as shown in Fig. 1A. We have previously shown that the relative position of the RSS in the internal or external position does not bias the results (8, 19). By having both competing RSS in the same plasmid, this system provides a very sensitive assay for determining even small effects of changes in the RSS.

Single nucleotide changes in the spacer can affect recombination frequencies

The spacer sequence of the human V{kappa} gene A27 varies from the V{kappa}A2 spacer in 7 of 12 positions, and we previously showed that the A27 spacer was ~2-fold less efficient in promoting recombination than the V{kappa}A2 spacer (8). A randomly generated variant of the A27 spacer, which differed in only two positions from A27, was much worse, with only 14% of the rearrangement events occurring at this A27 mutant RSS as compared with the A2 spacer RSS (8). To analyze the basis for the decreased efficiency in the A27 mutant spacer, we compared the frequency of usage of G, A, T, and C in various positions from the large database of 12-bp RSS compiled by Ramsden et al. (6). We reasoned that positions in which all four nucleotides are observed with approximately equal frequency might not be very critical, while positions of skewed nucleotide usage might affect recombination frequency. We previously used this approach to accurately predict that a single base pair change in the heptamer might be deleterious to efficient recombination, and we use it in this study to analyze the effect of single nucleotide changes in the spacer sequence (19).

The A27 and A27 mutant RSS spacers differ in sequence at only two positions: the second position (T in A27; G in A27 mutant) and the tenth position (G in A27; C in A27 mutant). Because G is observed at position 2 in only 10% of the 12-bp spacers in the RSS database, while T is present in 56% (see Table I), we predicted that a T->G substitution at position 2 in the spacer would be likely to contribute to the inefficient rearrangement of the A27 mutant RSS. By the same reasoning, because C is observed at position 10 only slightly more frequently than G (28 vs 16%), a G->C substitution at spacer position 10 would be less likely to decrease recombination.


View this table:
[in this window]
[in a new window]
 
Table I. Single nucleotide changes in the spacer can affect recombination frequency

 
To test these hypotheses, we made competition substrates in which the second or the tenth position of the spacer was changed to a G, A, T, or C (Table I, C40 series). All RSS in this series of constructs had consensus heptamers and nonamers. In agreement with our prediction, a T in the second position of the spacer creates the most recombinogenic spacer (Table I, C40T). Conversely, an A in the second position (present in only 5% of the database sequences) supports the lowest frequency of rearrangement (C40A). The variant RSS with a G in the second position of the spacer is used in only 20% of the rearrangement events (C40G). Hence, the T->G substitution at the second position of the spacer contributes significantly to the poor rearrangement of the A27 mutant RSS. In contrast, changing only the tenth position of the spacer to G, A, T, or C had minimal effect on recombination frequency, consistent with the unbiased usage of all four nucleotides in the database of natural RSS at this position. Thus, a single nucleotide substitution at the second position of the spacer is primarily responsible for the ineffectiveness of the A27 mutant RSS.

To determine whether there are other examples in which the spacer sequence might affect recombination frequency in vivo, we compared the relative recombination potential of V{kappa} genes A18 and L11. The RSS of A18 is identical with that of A2, and it has the best natural spacer that we have observed to date. In vivo, A18 has an intrinsically higher rearrangement frequency than L11, as assessed in nonproductive sequences from bone marrow and peripheral blood (8, 20, 21). RSS of L11 varies from the A18/A2 RSS (hereafter referred to as A2) in only five positions in the spacer. To test whether the difference in recombination frequency observed in vivo could be due to the nucleotide variations in the spacer, we assessed the relative A2:L11 recombination frequencies in our competition assay. In this assay (Table II, C38), A2 was used 3 times as often as L11, a bias similar to that seen in vivo.


View this table:
[in this window]
[in a new window]
 
Table II. Effect of varying the spacer sequence

 
We further analyzed three of the positions in which the spacer sequences of A2 and L11 differ: positions 6, 11, and 12. In the sixth position, there is a G in the good A2 spacer (and in 38% of the database sequences), while C is present in the L11 spacer (and in 15% of the database sequences). Based on this skewed usage of nucleotides, it seemed likely that the G->C substitution alters recombination frequencies. However, there was no difference in recombination among the three sets of substrates with G or C in this position (C50 series) (Table II).

We next analyzed the 11th and 12th positions of the spacer. RSS with a G at position 11 rearranged only half as well as RSS containing an A at position 11 (C50D and C50F). Although this suggests that the A->G substitution observed at the 11th position of the L11 spacer may contribute to the decreased recombination efficiency, G is actually present slightly more often than A in the database (26 vs 19%). Thus, this result was not predicted based on the frequency of nucleotide usage in the database. RSS containing As at the 11th and 12th positions of the spacer support 40% less rearrangement than RSS containing an A at the 11th position and a T at the 12th position (C50C and C50G). Although this suggests that the T->A substitution observed at the 12th position of the L11 spacer might also contribute to the decreased recombination efficiency of L11, it is interesting to note that A is present slightly more often than T in the database (43 vs 27%).

In conclusion, we clearly demonstrate that individual nucleotide variations in the spacer can affect recombination frequency. As previously seen for multiple variations in heptamer and nonamer sequence (19), the combined effects of nucleotide changes in the spacer might be interdependent and/or synergistic, and therefore the rearrangement potential of RSS may require functional assessment.

A poor spacer sequence can dramatically reduce V(D)J recombination

We wished to determine how much of a negative influence a poor spacer sequence could have on recombination. Using the Ramsden et al. database (6), we created an RSS spacer with the least used nucleotide in each position, with the exception of two positions in which the most infrequent nucleotide was used in 5% or less of the sequences. In these two positions, we used the second-most infrequent nucleotide (Fig. 1B). We reasoned that this should be among the least favorable spacer sequences, and thus should reveal how much of a deleterious effect on recombination efficiency variation in the spacer might have.

We constructed competition recombination substrates containing the V{kappa}A2 spacer in competition with either the consensus or the Infrequent spacer (Fig. 1C). All spacers were flanked by consensus heptamers and nonamers and V{kappa}A2 coding and 3' flanking DNA. As can be seen in Fig. 1C, the A2 spacer is as efficient as the consensus spacer in promoting recombination. Because the A present in the first position of the consensus spacer is used in 50% of the sequences in the database, while the G used in the first position of A2 is used least frequently, we wondered whether the consensus spacer would be less good with an A->G substitution at the first position. We therefore constructed another substrate containing the A2 spacer in competition with a variant consensus spacer containing an A->G substitution at position 1; however, this change from A to G did not affect recombination levels at all (Fig. 1C). Thus, the naturally occurring V{kappa}A2 spacer is as effective as the consensus 12-bp spacer, despite having four changes at the 5' and 3' ends.

Most importantly, we made a construct in which we analyzed the Infrequent spacer. Strikingly, an RSS with the Infrequent spacer is hardly ever used when placed in competition with the A2 spacer (only 2% of the rearrangements). Hence, the 12-bp spacer sequence has the potential to dramatically affect recombination.

The 23-bp spacer sequences from VH genes also affect recombination frequency

The work above concerns 12-bp spacers. To test whether the same influence of spacer sequence would hold for 23-bp spacers, and to further study naturally occurring VH RSS and their influence on repertoire formation, we analyzed the rearrangement of additional murine VH genes. We previously showed that the three functional genes of the VHS107 family, V1, V11, and V13, have very different intrinsic rearrangement frequencies in vivo despite being flanked by RSS with identical heptamers and nonamers (12). V11 and V13 have identical spacers, but the V1 spacer differs at five positions (Fig. 2B). In bone marrow pro-B cells of µMT mice, V1 rearranges 5 times more often than V11, and 40 times more often than V13 (12). We therefore made a series of constructs to ask whether the nucleotide variations of the V1 spacer influenced its high rearrangement frequency in vivo.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 2. A, Competition recombination substrates with fragments of V1 and V11 show the effect of the spacer sequence on recombination. The substrates have the indicated portions of the construct composed of V1 (open bars), V11 (striped bars), or V13 (dotted bar). All of these VHS107 genes had the same consensus heptamer and same nonconsensus nonamer, which are indicated by filled boxes. The coding region of the V genes is on the left of the RSS, and the 3' flank is on the right of the RSS. B, The three spacer sequences are shown in comparison with the consensus 12-bp spacer sequence from Ramsden et al. (6 ). C, For the five positions that differ between V1 and V11/V13, the frequency in the database of the nucleotide present in V1 and in V11/V13 is indicated. Position 5 shows the biggest variation in frequency.

 
All competition recombination substrates in this series had 200 bp 5' of the VH RSS, and 3–20 bp 3' of the RSS, and all constructs had a DSP2.2 12-bp RSS fragment in place of the J{kappa} RSS. First, we made a construct with identical V1-competing segments (C88). This construct had a slight bias for the external fragment, which we never observed in our V{kappa}-containing competition constructs (Fig. 2A). The reason for this is unclear, but we made reciprocal constructs for many of the variants to control for any slight position effects.

In a competition between V1 and V11 (C56), rearrangement occurred to V1 in 80% of the recombinants assayed. The reciprocal competition construct (C108) demonstrated rearrangement to V1 in 75% of the recombinants (Fig. 2A). Because V1 rearranges 5 times more than V11 in vivo, these data from the recombination substrates indicate that the intrinsic potency of the V1 RSS and/or any of the V1-flanking DNA must be a major contributor to its higher rearrangement frequency. To dissect the parts of the V1 segment that are responsible for the increased recombination, we made a variety of recombinant constructs (Fig. 2A). As seen in C70 compared with C56, most of the difference in rearrangement frequency between V1 and V11 is due to the spacer and/or the 3' flanking DNA, but there is some deleterious effect of having the V11 coding region. To directly determine whether it is in fact the spacer that controls the differential rearrangement frequency of V1 and V11, we replaced the V1 spacer with that of V11, while retaining all the V1 flanking sequence on both sides of the RSS. For C129, which has the V11 spacer in the internal RSS, rearrangement occurs to the external V1 RSS 82% of the time, comparable to the 80% recombination to V1 in C56. In the reciprocal construct (C102), in which the V11 spacer was in the internal RSS, rearrangement occurred with the V1 spacer 64% of the time, which is slightly lower than the 75% present in C108. Together, these two constructs, in which the internal and external fragments differ only by the spacer sequence, indicate that the quality of the 23-bp spacer in V1 vs V11 is, in fact, primarily responsible for the biased rearrangement that we observed in vivo.

Another region that has been reported to affect recombination frequency is the coding end immediately flanking the heptamer of the RSS (14, 22, 23, 24, 25), and the results of C56 vs C70 indicated that there was some effect of the V11 coding region. To address this issue, we tested constructs with swapped coding ends. The coding ends of V1 and V11 are identical, except for the three nucleotides closest to the heptamer (Fig. 2B). Comparison of the results with C98 vs C88 and C108, and C128 vs C56, show that the coding end does have an effect upon recombination, but not nearly as much an influence as the spacer. We also analyzed V11 and V13, which share the identical RSS, yet rearrange at 7-fold different frequencies in vivo (12). They differ in coding sequence including the coding end, yet show similar recombination frequencies in our assay (Fig. 2, C57). Thus, for V13, other factors must contribute to its very low frequency of rearrangement in vivo.

We conclude that the spacer is primarily responsible for the differential recombination efficacy of the V1 and V11 gene segments, while the coding end also makes a small contribution to the favored rearrangement of V1. Together, these differences account for much of the differential rearrangement frequency of the V1 vs V11 gene segments in vivo.

Unequal rearrangement of the two V{beta}3 alleles in vivo is not due to intrinsic RSS differences

The human V{beta}3 gene has two alleles that recombine at very different frequencies in vivo. Individuals homozygous for V{beta}3.2 have 8.1% V{beta}3+ cells in their peripheral blood, while those homozygous for V{beta}3.1 have only 1.2% V{beta}3+ cells (7). The two alleles were sequenced, and the only difference in over 1 kb of DNA was the substitution of a T (in V{beta}3.2) for a C (in V{beta}3.1) in the spacer sequence (7). To see whether the change in the spacer affected the recombination frequency, we made a competition recombination substrate in which V{beta}3.1 was in competition with V{beta}3.2. Thus, the only change in this construct was the one nucleotide change in the spacer. As can be seen in Fig. 3, the spacer difference did not account for the difference in recombination observed in vivo.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 3. Unequal rearrangement of the two V{beta}3 alleles in vivo is not due to intrinsic RSS differences. A, The sequence of the spacer of the two V{beta}3 alleles is shown, along with the percentage of peripheral blood T cells that express V{beta}3 in V{beta}3.1 or V{beta}3.2 homozygotes, respectively. The data in A are from Ref. 7 . B, Recombination substrate with V{beta}3.2 in competition with V{beta}3.1.

 
RSS identification and scoring by computer modeling

Cowell et al. (26) have developed a computer program to identify potential RSS sequences, and to score them, with scores ranging from -{infty} (worst RSS) to 0 (best RSS). Of 201 Ig or TCR 12-bp RSS analyzed in their study, only 2 had scores less than -38.8, and the mean score for the Ig and TCR RSS was -18.5. We used this program to calculate the scores of the spacers studied in this investigation, all in the context of consensus heptamers and nonamers. The consensus spacer sequence based on the database of Ramsden et al. gave the best score (-7.7), and Infrequent gave a very poor score of -36.4, despite having a consensus heptamer and nonamer. However, RSS with spacers A2, A27, and A27 mutant all gave average scores (-15.2, -13.8, and -17.4, respectively), despite the fact that our recombination substrate assays showed that A2 was essentially as good as the consensus, A27 was 2-fold worse in recombination, and A27 mutant was 6 times less recombinogenic. Thus, this computational program to rate RSS did not give very precise predictive value as to the relative efficiency of recombination supported by these three spacers.

Poor spacer RSS display modestly decreased RAG binding

One hypothesis to explain why the spacer sequence affects the recombination efficiency is that the RAG proteins may bind an RSS containing a near-consensus spacer with higher affinity than an RSS that has a spacer that varies in several positions from the consensus. To test this hypothesis that RAG proteins may not bind well to RSS with poor spacers, we compared the binding of purified RAG1 and RAG2 proteins with the three labeled RSS (A2, A27 mutant, and Infrequent, all with consensus heptamers and nonamers) by EMSA. We used an additional duplex 12-bp RSS oligonucleotide, VDJ 100/101, as an unlabeled competitor. The spacer of VDJ 100/101 is very close to the consensus, as is the V{kappa}A2 spacer (Fig. 4A). Fig. 4B shows that RAG1 and RAG2 bound the A2 RSS ~2-fold better than either A27 mutant or Infrequent RSS (compare lane 1 with lanes 7 and 13). It can be seen that SC1 formation is more dramatically affected than is SC2 formation, but the reason for this is unclear.



View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 4. RSS with spacers that do not support efficient recombination show slightly reduced binding by RAG1 and RAG2. A, Sequence of the spacers used in RAG-binding assay. B, Binding to A2*/A2C, A27mut*/A27mutC, Infrequent*/InfrequentC, competed with 100/101. *, Indicates the labeled oligo, and C indicates complementary oligo used to create the dsRSS. Lanes 2–6, 8–12, and 14–18, Contain 2-, 5-, 10-, 50-, and 100-fold excess of unlabeled 100/101 competitor RSS. SC1 and SC2 both contain RAG1 and RAG2, and the different mobility is due to different numbers of RAG2 molecules bound (15 ). A film autoradiogram is shown in the figure. The percentage of the substrate bound is indicated below the gel. Quantitation was performed by PhosphorImager analysis.

 
We also assessed binding by comparing the ability of unlabeled A2, A27 mutant, or Infrequent RSS to compete for binding with the labeled and highly efficient RSS VDJ100/101. Binding was inhibited 50% with a 2-fold excess of cold A2, while 50% inhibition of binding to VDJ100/101 required ~7-fold excess of cold A27 mutant RSS or Infrequent RSS (Fig. 5). Thus, both of these approaches demonstrate that while RSS with poor spacers (A27 mutant and Infrequent) still bind the RAG proteins, they do so less efficiently than RSS with good spacers (A2). This 2- to 3-fold decrease in RAG binding to an individual RSS does not seem sufficient to explain the greatly reduced recombination efficiency of RSS containing these spacers.



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 5. Poor spacer RSS compete less well than the good spacer RSS for RAG binding. A, Binding to 100*/101, competed with increasing amounts of A2/A2C, A27mut/A27mutC, Infrequent/InfrequentC oligos. Lanes 2–6, 8–12, and 14–18, Contain 2-, 5-, 10-, 50-, and 100-fold excess of the indicated unlabeled competitor RSS. A film autoradiogram is shown in the figure. The percent inhibition of binding resulting from the presence of competitor DNA is indicated below the gel, and is graphed in B. Quantitation was performed by PhosphorImager analysis.

 
Cleavage of RSS is more dramatically affected by the spacer sequence

To determine whether the different spacer sequences affected the subsequent cleavage step more than they affected the initial RAG1/2 protein binding, single-site cleavage of various RSS was assessed in vitro in the presence of Mn2+. The same four RSS oligonucleotides were 32P labeled and incubated with RAG1 and RAG2 proteins. It can be seen that the Infrequent RSS substrate is cleaved ~9-fold less efficiently than the A2 RSS (Fig. 6, compare lanes 4 and 2), and A27 mutant is cleaved ~3-fold less well than A2 (compare lanes 3 and 2). Despite the differences in their spacer sequences, A2, A27 mutant, and Infrequent all exhibit an increased nick:hairpin ratio as compared with VDJ100/101. However, because the flanking coding DNA present in A2, A27 mutant, and Infrequent differs from the coding DNA present in VDJ100/101, and because coding end DNA is known to affect the efficiency of hairpin formation (14, 25), it seems likely that the altered nick:hairpin ratio observed for A2, A27 mutant, and Infrequent vs VDJ100/101 is attributable to the coding DNA sequence immediately flanking the RSS.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 6. Infrequent spacer RSS is cleaved inefficiently by RAG proteins. Cleavage of A2*/A2C, A27mut*/A27mutC, Infrequent*/InfrequentC. Lane 1, Contains VDJ 100*/101. Lane 2, Contains A2*/A2C. Lane 3, Contains A27mut*/A27mutC. Lane 4, Contains Infrequent*/InfrequentC. The percentage of the substrate cleaved is indicated below the gel. Quantitation was performed by PhosphorImager analysis. A film autoradiogram is shown in the figure, and some of the lanes of this gel have been omitted for clarity. HP denotes the hairpin.

 
Thus, there is a more dramatic effect of the spacer on cleavage than on binding of the RAG1/2 proteins to the RSS, although even this decrease may not completely account for the level of decreased efficiency of rearrangement seen in the competition substrates.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RSS spacer sequence differences can dramatically affect recombination frequency

Individual V, D, and J gene segments rearrange at different frequencies, and one of the reasons for this unequal rearrangement frequency in vivo is the naturally occurring variation in the sequences of the RSS flanking these gene segments (11). Few RSS have both consensus heptamers and nonamers, and we have previously used competition recombination substrates to show that several examples of nonrandom rearrangement in vivo can be explained by these differences (8, 13, 19). However, there is a large variation in the frequency of rearrangement for genes within a VH or V{kappa} family, and very often all family members share heptamers and nonamers, but diverge in the spacer sequence (12, 13, 20, 21, 27, 28, 29). Hence, our previous demonstration that the recombination frequency of naturally occurring RSS is affected, albeit mildly, by the sequence of the spacer had biologically significant implications for lymphocyte repertoire composition (8).

In this study, we investigate the extent of the influence of the spacer on recombination in vivo, and we present in vitro studies analyzing the mechanism of this influence. Much of this basis for this study comes from the large database of RSS made by Ramsden et al. (6). They showed that several positions in the spacer, particularly at the 5' half portion near the heptamer, were moderately well conserved. Because we had previously shown that infrequently observed nucleotides within the heptamer can produce less efficient RSS (19), we reasoned that conserved positions within the spacer might also contribute to RSS efficacy. This hypothesis correctly predicted that the decrease in efficiency of A27 mutant spacer, which varied from A27 by only two positions, was predominantly due to the change in the second position, while the change at the tenth position did not affect recombination.

However, a more complex situation was observed when we dissected the spacer difference between the V{kappa} genes A2 and L11 (Table II). In position 6, the G found in the good A2 spacer is present at over twice the frequency of the C found in the L11 spacer, but three pairs of recombination substrates showed that there was no difference in recombination efficacy at all of a C vs a G at that position. This is most likely due to the fact that this sixth position in the middle of the 12-bp spacer would be on the opposite side of the DNA helix from the surface to which the RAG proteins are binding. In contrast, the last two positions that abut the nonamer did have an effect. The worst option was having the spacer terminate with AA, despite the fact that A is found in position 12 in 43% of the spacers in the database. However, this deleterious effect may be because the last three nucleotides of the newly created spacer are now AAA, making the spacer-nonamer sequence .... ACAGACCAAA-ACAAAAACC, which inadvertently creates two partially overlapping nonamers. Binding of the RAG proteins to the wrong nonamer could prevent proper contact with the heptamer, disrupting overall binding and cleavage levels. In general, from these studies on the L11 spacer sequence, we find that although predictions of good vs bad RSS heptamer, spacer, or nonamer sequences can be made by comparing an individual RSS with the consensus database, there are certainly some exceptions, no doubt based on synergistic interactions within the surrounding sequence context when multiple deviations from consensus occur.

Spacer region sequences affect RAG binding and RSS cleavage

Our analysis of the infrequent RSS spacer substrate shows clearly that the spacer sequence can have a major impact upon recombination. This infrequent spacer RSS was essentially unable to support V(D)J recombination in transient assays with extrachromosomal substrates. How does the spacer influence the recombination efficacy of an RSS? Previously published studies have demonstrated that RAG1 protein as well as the RAG1/2 protein complex directly interact with the spacer (30, 31). Therefore, we first tested the hypothesis that RAG binding may be impaired by a poor spacer sequence.

We found that a nonconsensus spacer modestly decreases the efficiency of RAG1/2 binding. The RSS with the poor spacers, A27 mutant and Infrequent, were both ~2-fold less efficient than the near-consensus A2 RSS at inhibiting RAG binding to the near-consensus VDJ 100/101. Direct binding of RAG1 and RAG2 to Infrequent and A27 mutant RSS was also demonstrated, although again the binding was ~2-fold less efficient than binding to A2 RSS. For both A27 mutant and Infrequent, we observed a greater decrease in SC1 formation than SC2 formation. SC1 is the precursor of SC2, and SC2 is the precursor of the paired synaptic complex (15). SC2 and SC1 differ only in that SC2 contains twice as many RAG2 molecules as SC1 (15). Thus, it is possible that the spacer region plays a more significant role in the initial RAG-RSS interactions. The full complement of RAG proteins found in SC2 may help stabilize binding to the poor spacer RSS, whereas the SC1 complex might be more transient.

However, a more dramatic influence of the spacer sequence was seen when RAG-mediated cleavage was analyzed. We observed 3-fold less cleavage of A27 mutant RSS and ~9-fold less cleavage of infrequent RSS, as compared with cleavage of 100/101 or A2 RSS. However, even the observed decrease in single-site cleavage (Fig. 6) is not sufficient to explain the near inability of the infrequent RSS to recombine in competition recombination substrate assays. However, the RAG1/2 binding to the poor RSS may not be stably maintained through pairing of the two RSS into the synaptic complex, paired cleavage, processing of the hairpins, and joining of the two coding ends. We suggest that in the context of the recombination substrate, the weakened binding of RAG1 and RAG2 to infrequent RSS may cause such inefficient or short-lived synaptic complex formation and possibly also postcleavage complex formation that coding joint formation would be greatly impaired. Finding that rejoining of DNA is more strictly controlled than RSS cleavage has precedent in studies of RAG1 and RAG2 mutants and RSS heptamer and nonamer mutants in postcleavage joining events (32, 33, 34, 35, 36, 37). Overall, it appears that a poor RSS spacer region slightly impairs initial RAG binding, but more severely affects subsequent RAG-catalyzed RSS cleavage.

CpG methylation of the spacer may affect the recombination efficiency of an RSS

The first description of a difference in a single nucleotide in the spacer sequence being responsible for a 6-fold difference in frequency in vivo was that of the V{beta}3 alleles (7). However, in this study, we show that the two RSS are identical in their ability to undergo recombination as assessed in recombination substrates. These data then strongly point to an epigenetic effect for this particular spacer difference in vivo. The T to C substitution in the spacer of the infrequently rearranged V{beta}3.1 allele has created a CpG sequence. Thus, as suggested previously, our data support the proposal that in vivo methylation of this spacer could greatly reduce recombination frequency (7). It has been shown that methylation of a CpG sequence in the heptamer can preclude recombination (38), and our data are consistent with the hypothesis that methylation of the spacer might also preclude recombination.

RSS spacer sequence differences may affect V gene usage in vivo

How much of an impact do spacer differences have on actual V gene usage in vivo? Both V{kappa} genes A2 and L11 share the same nonconsensus nonamer, and the same consensus heptamer. A2 rearranges more than L11 in vivo, and the A2 gene fragment supports 3 times more recombination that the L11 fragment in our competition substrate. Thus, the difference in spacer sequence may be responsible for the difference in recombination in vivo. However, these genes are also from different V{kappa} families, and so their coding regions differ by ~30%, and even the coding ends are quite different. Thus, because we did not make constructs that varied only in the spacer, we cannot be certain that the difference in recombination frequency seen in C38 is due to the spacer alone. However, we did make a detailed analysis of two murine VHS107 genes that are very similar in coding sequence, and are identical with each other in heptamer and nonamer. In this case, we clearly showed that the spacer alone was the predominant factor accounting for the 4-fold difference in recombination seen in the competition substrates, with a more modest effect of the coding end also. Comparison of both of the spacer sequences to the database suggests that positions 5 and 21 of the V1 spacer are likely candidates to be primarily responsible for the differential recombination potency, because the nucleotides present in V1 spacer are far more frequent that the nucleotides that the V11 spacer has at those positions (Fig. 2C). Hence, we conclude that the spacer difference, and to a lesser extent the coding end difference, between V1 and V11 may well be responsible for the unequal rearrangement frequency of these two genes in vivo (12).

A potential caveat to our comparison of V{kappa} genes A2 vs L11 and VH genes V1 vs V11 is that for genes such as these, which are not alleles as were the A2a/A2b genes we previously analyzed (19), the chromosomal context of the genes may vary. Therefore, we cannot rule out the possibility that we are fortuitously observing the same relative frequency of recombination in the competition substrates as that which occurs in vivo. Proof that the spacer sequence was responsible for the difference in recombination frequency in vivo would require gene targeting of the spacer of one of the genes to convert it to the other sequence. We know that other factors do influence rearrangement frequency, as was shown in our analysis of the large VH7183 family, in which genes with identical RSS rearrange very differently (13). In this case, we showed that recombination frequency in vivo was more highly correlated with chromosomal location. Furthermore, within the VHS107 family, V11 and V13 have identical RSS, very similar coding regions, and are neighboring genes, yet they vary 7-fold in rearrangement frequency in vivo. Thus, the competition substrates clearly reveal the extent to which the RSS and/or coding end differences could contribute to nonrandom gene use in vivo. However, these recombination substrate studies also show that some of the in vivo recombination frequencies must be affected by other factors to account for the differences in rearrangement frequency in vivo for genes with equal recombination efficiency in the transient assays with the substrates.

Recently, it has been shown that the RSS can impose rearrangement biases, in that V{beta} genes do not rearrange to J{beta} genes in vivo despite the fact that they have 12- and 23-bp spacers, respectively, and thus should be permitted to rearrange. Gene targeting showed that the RSS was responsible for this bias, which was thus a preference beyond the 12–23 rule (39). This restriction could be due to a specific affinity of the appropriate RSS (i.e., V{beta} and 5' D{beta}, or 3' D{beta} and J{beta}) to synapse and rearrange to each other. Analysis of these RSS in competition recombination substrates recapitulated the restrictions observed in vivo (40, 41), and one study showed that for the V{beta}, it was the sequence of the spacer and the coding end that imposed this rearrangement bias (40). In vitro cleavage reactions showed that the RAG proteins are the only proteins required to enforce this bias (40). It is possible that our infrequent spacer RSS does not compete well with the V{kappa}A2 spacer to the natural partner of A2 in vivo, the J{kappa} RSS, just as the V{beta} RSS due to its spacer does not rearrange to J{beta} RSS, due to the mechanistically unknown basis of beyond 12–23 rule. However, it was shown in another study that a V{beta} RSS rearranged much better to a 12-bp V{kappa} RSS, which is close to consensus, than to its in vivo rearrangement partner, the 5' D{beta} RSS, and likewise substitution of the V{beta} RSS with the consensus J{kappa}1 RSS still showed almost exclusive rearrangement to the 5' D{beta} rather than the J{beta} RSS (41). Hence, the basis for the inability of the V{beta} and J{beta} RSS to recombine together in vivo or in substrate assays may be greatly influenced by the fact that both of these nonconsensus RSS have efficiencies well below that of a consensus RSS, and thus may not rise above some threshold affinity required for high frequency rearrangement.

Spacer region sequences affect the postbinding steps of V(D)J recombination, and influence T and B cell repertoire formation

Our data showing that RAGs do bind the infrequent spacer RSS, albeit somewhat less efficiently, demonstrate that there are steps subsequent to RAG binding that control rearrangement frequency in vivo. Because the RSS spacer region affects RSS cleavage more severely than it affects RAG binding, RSS cleavage appears to be one of the postbinding steps that is affected by the spacer region. Because RAG1 and RAG2 have been shown to play additional roles subsequent to RSS cleavage (34, 35, 36, 37), and because RSS with poor heptamers and nonamers can result in postcleavage defects in joining (33), perhaps the spacer region not only affects initial RAG binding and RSS cleavage, but also affects the postcleavage RSS-RAG interactions necessary to maintain the integrity of the postcleavage complex during subsequent coding joint formation. Overall, these data clearly demonstrate that RSS spacer sequence differences can potentially play a major role in determining the rearrangement frequency of a given gene segment, and should be considered to be one of the influences leading to nonrandom gene segment use in the primary T and B cell repertoires.


    Acknowledgments
 
We gratefully acknowledge valuable comments on this work by Dr. Bertrand Nadel and Dr. Norman Klinman. We also thank Drs. Christoph Weber and Lindsay Cowell for assistance in the computer analysis.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants R01 AI29672 and AI37098 (to A.J.F.), and R01 GM48026 (to M.A.O.). A.M. and K.M.O. were supported by Training Grant T32 GM08303. A.G.W.M. is a Howard Hughes Medical Institute Predoctoral Fellow. M.L. was supported by a Canadian Institutes of Health research grant to G.W. The Scripps General Clinical Research Center, which provided the human peripheral blood DNA for PCR, is supported by National Institutes of Health Grant M01 RR00833. This is manuscript 15683-IMM from The Scripps Research Institute. Back

2 A.M., K.M.O., and A.T. contributed equally to this study. Back

3 Address correspondence and reprint requests to Dr. Ann Feeney, Department of Immunology, IMM-22, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. E-mail address: feeney{at}scripps.edu Back

4 Abbreviations used in this paper: RSS, recombination signal sequence; SC, single RSS complex. Back

Received for publication April 3, 2003. Accepted for publication September 15, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Oettinger, M. A., D. G. Schatz, C. Gorka, D. Baltimore. 1990. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 248:1517.[Abstract/Free Full Text]
  2. McBlane, J. F., D. C. van Gent, D. A. Ramsden, C. Romeo, C. A. Cuomo, M. Gellert, M. A. Oettinger. 1995. Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps. Cell 83:387.[Medline]
  3. Hesse, J. E., M. R. Lieber, K. Mizuuchi, M. Gellert. 1989. V(D)J recombination: a functional definition of the joining signals. Genes Dev. 3:1053.[Abstract/Free Full Text]
  4. Akamatsu, Y., N. Tsurushita, F. Nagawa, M. Matsuoka, K. Okazaki, M. Imai, H. Sakano. 1994. Essential residues in V(D)J recombination signals. J. Immunol. 153:4520.[Abstract]
  5. Akira, S., K. Okazaki, H. Sakano. 1987. Two pairs of recombination signals are sufficient to cause immunoglobulin V-(D)-J joining. Science 238:1134.[Abstract/Free Full Text]
  6. Ramsden, D. A., K. Baetz, G. E. Wu. 1994. Conservation of sequence in recombination signal sequence spacers. Nucleic Acids Res. 22:1785.[Abstract/Free Full Text]
  7. Posnett, D. N., C. S. Vissinga, C. Pambuccian, S. Wei, M. A. Robinson, D. Kostyu, P. Cancannon. 1994. Level of human TCRBV3S1 (V{beta}3) expression correlates with allelic polymorphism in the spacer region of the recombination signal sequence. J. Exp. Med. 179:1707.[Abstract/Free Full Text]
  8. Nadel, B., A. Tang, G. Escuro, G. Lugo, A. J. Feeney. 1998. Sequence of the spacer in the recombination signal sequence affects V(D)J rearrangement frequency and correlates with non-random V{kappa} usage in vivo. J. Exp. Med. 187:1495.[Abstract/Free Full Text]
  9. Fanning, L., A. Connor, K. Baetz, D. Ramsden, G. E. Wu. 1996. Mouse RSS spacer sequences affect the rate of V(D)J recombination. Immunogenetics 44:146.[Medline]
  10. Larijani, M., C. C. K. Yu, R. Golub, Q. L. K. Lam, G. E. Wu. 1999. The role of components of recombination signal sequences in immunoglobulin gene segment usage: a V81x model. Nucleic Acids Res. 27:2304.[Abstract/Free Full Text]
  11. Feeney, A. J., A. Tang, K. M. Ogwaro. 2000. B-cell repertoire formation: role of the recombination signal sequence in non-random V segment utilization. Immunol. Rev. 175:59.[Medline]
  12. Love, V. A., G. Lugo, D. Merz, A. J. Feeney. 2000. Individual promoters vary in strength, but the frequency of rearrangement of those VH genes does not correlate with promoter strength nor enhancer independence. Mol. Immunol. 37:29.[Medline]
  13. Williams, G. W., A. Martinez, A. Montalbano, A. Tang, A. Mauhar, K. M. Ogwaro, D. Merz, C. Chevillard, R. Riblet, A. J. Feeney. 2001. Unequal VH gene rearrangement frequency within the large VH7183 gene family is not due to RSS variation, and mapping of the genes shows a bias of rearrangement based on chromosomal location. J. Immunol. 167:257.[Abstract/Free Full Text]
  14. Cuomo, C. A., C. L. Mundy, M. A. Oettinger. 1996. DNA sequence and structure requirements for cleavage of V(D)J recombination signal sequences. Mol. Cell. Biol. 16:5683.[Abstract/Free Full Text]
  15. Mundy, C. L., N. Patenge, A. G. W. Matthews, M. A. Oettinger. 2002. Assembly of the RAG1/RAG2 synaptic complex. Mol. Cell. Biol. 22:69.[Abstract/Free Full Text]
  16. Kim, D. R., M. A. Oettinger. 1998. Functional analysis of coordinated cleavage in V(D)J recombination. Mol. Cell. Biol. 18:4679.[Abstract/Free Full Text]
  17. Sakano, H., Y. Kurosawa, M. Weigert, S. Tonegawa. 1981. Identification and nucleotide sequence of a diversity DNA segment (D) of immunoglobulin heavy-chain genes. Nature 290:562.[Medline]
  18. Sakano, H., R. Maki, Y. Kurosawa, W. Roeder, S. Tonegawa. 1980. Two types of somatic recombination are necessary for the generation of complete immunoglobulin heavy chain genes. Nature 286:676.[Medline]
  19. Nadel, B., A. Tang, G. Lugo, V. Love, G. Escuro, A. J. Feeney. 1998. Decreased frequency of rearrangement due to the synergistic effect of nucleotide changes in the heptamer and nonamer of the recombination signal sequence of the V{kappa} gene A2b, which is associated with increased susceptibility of Navajos to Haemophilus influenzae type B disease. J. Immunol. 161:6068.[Abstract/Free Full Text]
  20. Feeney, A. J., G. Lugo, G. Escuro. 1997. Human cord blood {kappa} repertoire. J. Immunol. 158:3761.[Abstract]
  21. Foster, S. F., H.-P. Brezinschek, R. I. Brezinschek, P. E. Lipsky. 1997. Molecular mechanisms and selective influences that shape the {kappa} gene repertoire of IgM+ cells. J. Clin. Invest. 99:1614.[Medline]
  22. Gerstein, R. M., M. R. Lieber. 1993. Coding end sequence can markedly affect the initiation of V(D)J recombination. Genes Dev. 7:1459.[Abstract/Free Full Text]
  23. Ezekiel, U. R., T. Sun, G. Bozek, U. Storb. 1997. The composition of coding joints formed in V(D)J recombination is strongly affected by the nucleotide sequence of the coding ends and their relationship to the recombination signal sequences. Mol. Cell. Biol. 17:4191.[Abstract/Free Full Text]
  24. Boubnov, N. V., Z. P. Wills, D. T. Weaver. 1993. V(D)J recombination coding junction formation without DNA homology: processing of coding termini. Mol. Cell. Biol. 13:6957.[Abstract/Free Full Text]
  25. Ramsden, D. A., J. F. McBlane, D. C. van Gent, M. Gellert. 1996. Distinct DNA sequence and structure requirements for the two steps of V(D)J recombination signal cleavage. EMBO J. 15:3197.[Medline]
  26. Cowell, L. G., M. Davila, T. B. Kepler, G. Kelsoe. 2002. Identification and utilization of arbitrary correlations in models of recombination signal sequences. Genome Biol. 3:1.
  27. Kraj, P., S. P. Rao, A. M. Glas, R. R. Hardy, E. C. B. Milner, L. E. Silberstein. 1997. The human heavy chain Ig V region gene repertoire is biased at all stages of B cell ontogeny, including early pre-B cells. J. Immunol. 158:5824.[Abstract]
  28. Yu, K., A. Taghva, M. R. Lieber. 2002. The cleavage efficiency of the human immunoglobulin heavy chain VH elements by the RAG complex: implications for the immune repertoire. J. Biol. Chem. 15:5040.
  29. Livak, F., D. B. Burtrum, L. Rowen, D. G. Schatz, H. T. Petrie. 2000. Genetic modulation of T cell receptor gene segment usage during somatic recombination. J. Exp. Med. 192:1191.[Abstract/Free Full Text]
  30. Nagawa, F., K.-I. Ishiguro, A. Tsuboi, T. Yoshida, A. Ishikawa, T. Takemori, A. J. Otsuka, H. Sakano. 1998. Footprint analysis of the RAG protein recombination signal sequence complex for V(D)J recombination. Mol. Cell. Biol. 18:655.[Abstract/Free Full Text]
  31. Swanson, P. C., S. Desiderio. 1998. V(D)J recombination signal recognition: distinct, overlapping DNA-protein contacts in complexes containing RAG1 with and without RAG2. Immunity 9:115.[Medline]
  32. Hempel, W. M., P. Stanhope-Baker, N. Mathieu, F. Huang, M. S. Schlissel, P. Ferrier. 1998. Enhancer control of V(D)J recombination at the TCR{beta} locus: differential effects on DNA cleavage and joining. Genes Dev. 12:2305.[Abstract/Free Full Text]
  33. Agard, E. A., S. M. Lewis. 2000. Postcleavage sequence specificity in V(D)J recombination. Mol. Cell. Biol. 20:5032.[Abstract/Free Full Text]
  34. Tsai, C.-L., A. H. Drejer, D. G. Schatz. 2002. Evidence of a critical architectural function for the RAG proteins in end processing, protection, and joining in V(D)J recombination. Genes Dev. 16:1934.[Abstract/Free Full Text]
  35. Yarnell Schultz, H., M. A. Landree, Y.-X. Qiu, S. B. Kale, D. B. Roth. 2001. Joining-deficient RAG1 mutants block V(D)J recombination in vivo and hairpin opening in vitro. Mol. Cell 7:65.[Medline]
  36. Qiu, J.-X., S. B. Kale, H. Y. Schultz, D. B. Roth. 2001. Separation-of-function mutants reveal critical roles for RAG2 in both the cleavage and joining steps of V(D)J recombination. Mol. Cell 7:77.[Medline]
  37. Huye, L. E., M. M. Purugganan, M. M. Jiang, D. B. Roth. 2002. Mutational analysis of all conserved basic amino acids in RAG-1 reveals catalytic, step arrest, and joining-deficient mutants in the V(D)J recombinase. Mol. Cell. Biol. 22:3460.[Abstract/Free Full Text]
  38. Whitehurst, C. E., M. S. Schlissel, J. Chen. 2000. Deletion of germline promoter PD {beta}1 from the TCR {beta} locus causes hypermethylation that impairs D {beta}1 recombination by multiple mechanisms. Immunity 13:703.[Medline]
  39. Bassing, C. H., F. W. Alt, M. M. Hughes, M. D’Auteull, T. D. Wehrfy, B. B. Woodman, F. Gartner, J. M. White, L. Davidson, B. P. Sleckman. 2000. Recombination signal sequences restrict chromosomal V(D)J recombination beyond the 12/23 rule. Nature 405:583.[Medline]
  40. Jung, D., C. H. Bassing, S. D. Fugmann, H.-L. Cheng, D. G. Schatz, F. W. Alt. 2003. Extrachromosomal recombination substrates recapitulate beyond 12/23 restricted V(D)J recombination in nonlymphoid cells. Immunity 18:65.[Medline]
  41. Tillman, R. E., A. L. Wooley, B. Khor, T. D. Wehrly, C. A. Little, B. P. Sleckman. 2003. Cutting Edge: Targeting of V{beta} to D{beta} rearrangement by RSSs can be mediated by the V(D)J recombinase in the absence of additional lymphoid-specific factors. J. Immunol. 170:5.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
M. Larijani and A. Martin
Single-Stranded DNA Structure and Positional Context of the Target Cytidine Determine the Enzymatic Efficiency of AID
Mol. Cell. Biol., December 1, 2007; 27(23): 8038 - 8048.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. S. Rahman, L. J. Godderz, S. J. Stray, J. D. Capra, and K. K. Rodgers
DNA Cleavage of a Cryptic Recombination Signal Sequence by RAG1 and RAG2: IMPLICATIONS FOR PARTIAL VH GENE REPLACEMENT
J. Biol. Chem., May 5, 2006; 281(18): 12370 - 12380.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Johnston, A. L. Wood, D. J. Bolland, and A. E. Corcoran
Complete Sequence Assembly and Characterization of the C57BL/6 Mouse Ig Heavy Chain V Region
J. Immunol., April 1, 2006; 176(7): 4221 - 4234.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. R. Espinoza and A. J. Feeney
The Extent of Histone Acetylation Correlates with the Differential Rearrangement Frequency of Individual VH Genes in Pro-B Cells
J. Immunol., November 15, 2005; 175(10): 6668 - 6675.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. R. Talukder, D. D. Dudley, F. W. Alt, Y. Takahama, and Y. Akamatsu
Increased frequency of aberrant V(D)J recombination products in core RAG-expressing mice
Nucleic Acids Res., August 24, 2004; 32(15): 4539 - 4549.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Montalbano, A.
Right arrow Articles by Feeney, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Montalbano, A.
Right arrow Articles by Feeney, A. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS