The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, N.
Right arrow Articles by Geraghty, D. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, N.
Right arrow Articles by Geraghty, D. E.
The Journal of Immunology, 2003, 171: 5264-5271.
Copyright © 2003 by The American Association of Immunologists

HLA-F Surface Expression on B Cell and Monocyte Cell Lines Is Partially Independent from Tapasin and Completely Independent from TAP1

Ni Lee and Daniel E. Geraghty2

The Clinical Research Division, Fred Hutchinson Cancer Research Center, Seattle, WA 98109


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study we examined HLA-F expression in normal cells and cell lines, with a particular focus on identifying cells that express surface protein. While HLA-F protein was expressed in a number of diverse tissues and cell lines, including bladder, skin, and liver cell lines, no surface expression could be detected in the majority of them. However, surface expression was observed on EBV-transformed lymphoblastoid cell lines and on some monocyte cell lines. Expression on B lymphoblastoid cell lines was observed, while no surface expression on normal B cells or on any peripheral blood lymphocytes could be detected. Surface expression correlated with the presence of a limited amount of endoglycosidase H (Endo H)-resistant HLA-F. However, clearly not all surface-expressed HLA-F was fully glycosylated. We further examined the requirement of HLA-F surface expression for functional TAP and tapasin molecules and identified a clear departure from the dependence shown by other class I molecules on TAP. In contrast, of the two surface glycosylation forms expressed, an Endo H-sensitive form was tapasin independent, while an Endo H-resistant form was clearly tapasin dependent. Finally, we tested whether HLA-F could be stabilized for surface expression without peptide by using the classical cold treatment for surface stabilization of empty class I. Of several cell lines tested, only MHC deletion mutant 721.221 demonstrated a typical class I phenotype, indicating that control of surface stabilization may have a genetic basis resident in the MHC.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The MHC in humans encodes a number of class I genes that serve fundamental roles in the acquired and innate immune responses. The classical class I proteins, named HLA-A, -B, and -C, bind and present peptide to CTLs and interact with receptors on NK cells to inhibit lytic activity or cytokine production (1, 2, 3). Intracellular transport and cell surface expression of class I proteins are dependent on the availability of peptides within the endoplasmic reticulum (4, 5). Three additional class I genes, HLA-E, -F, and -G, commonly referred to as nonclasssical or class Ib genes, are all highly homologous to the transplantation Ag genes. These gene products similarly associate with {beta}2-microglobulin ({beta}2-m)3 and make up the remainder of the functional HLA class I gene family (6, 7, 8).

Polymorphism among HLA class I Ags has long been thought of as a hallmark of the functional diversity required of these molecules (9). While high levels of polymorphism in HLA class I have been maintained by overdominant selection (10), in contrast, the nonclassical class I molecules HLA-E, -F, and -G have been under a distinct selective pressure, exhibiting very low levels of allelic polymorphism. These low levels of allelic polymorphism are presumably reflected in their respective specialized functions. Indeed, HLA-G has long been thought to be restricted in allelic polymorphism due to its expression at the maternal-placental interface, possibly avoiding an alloresponse to paternal HLA-G. This restriction may limit the ability of HLA-G to bind peptide in the placenta and thus its ability to present Ag to T cells (11). In addition, HLA-G may assume a role interacting with NK inhibitory receptors (12, 13) and, alternatively or in addition, as a substitute to classical class I, acting through ILT2 or ILT4 to control inflammatory responses and cytotoxicity mediated by myelomonocytic cells (14, 15).

Progress understanding the biology of HLA-E has yielded definitive data about the function of this molecule. We previously showed that the availability of a nonamer peptide derived from certain HLA class I signal sequences is a necessary requirement for the stabilization of endogenous HLA-E expression on the surface of 721.221 cells (16). Knowing this, it was possible to implicate the CD94/NKG2A complex as an inhibitory receptor recognizing this class Ib molecule by using as target a .221 transfectant that selectively expressed surface HLA-E (17, 18). The crystal structure of HLA-E demonstrates that the specificity of leader peptide binding is a structurally defined intrinsic property of HLA-E (19). Of the two allelic forms of HLA-E, there were clear differences in the relative affinity for peptide of each heavy chain that correlated with and may be explained by differences between their thermal stabilities (20).

The function of HLA-F is unknown, but tissue- and cell-specific mRNA expression has been observed (21), and protein expression has largely correlated with that (22, 23). Two studies have reported that cell surface expression was not observed in any tissue or cell type studied, while a third demonstrated that HLA-F could be found on the surface of a subset of extravillous trophoblast cells that had invaded the maternal decidua (11). HLA-F may bind TAP, but unlike the classical human class I molecules, it was not detected at the cell surface regardless of the availability of TAP (22). Although no peptide or ligand binding to HLA-F has been described, through the use of HLA-F tetramer refolded with {beta}2-m, but without peptide ligand, an interaction with ILT2 and ILT4 was implicated (23). Whether this binding is indicative of a functional interaction with HLA-F is unclear, as similar binding has been observed with classical class I and HLA-G (14, 15).

In this study we used new mAbs reactive with HLA-F to study HLA-F expression in normal cells and cell lines. While HLA-F protein was expressed in a number of diverse tissues and cell lines, no surface expression was detected in the majority of them. However, surface expression was observed on EBV-transformed lymphoblastoid cell lines and on some, but not all, monocyte cell lines. This was true even though no surface expression on normal B cells or on any peripheral blood lymphocytes could be detected. Surface expression correlated with the presence of a limited amount of glycosylated HLA-F, although clearly not all the surface-expressed HLA-F was fully glycosylated. These studies further examined the requirement of HLA-F surface expression for functional TAP and tapasin molecules, identifying partial overlap and some clear departure from the dependence shown by other class I molecules. Finally, we tested one measure of the dependence of HLA-F to be stabilized for surface expression, finding further differences between HLA-F and other class I molecules in this regard. This latter feature may have a genetic basis resident in the MHC and independent of the HLA-F locus, as MHC deletion mutant cell line 721.221 demonstrated a more typical class I phenotype.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Monoclonal Ab production

HLA-F-specific Abs were generated by immunization of HLA-B27 transgenic mice with HLA-F inclusion body-derived heavy chain protein. The procedures used were essentially those described previously for anti-HLA-G and -E Abs (16, 24). Briefly, 100 µg of HLA-F protein in CFA was administrated in each immunization at 3-wk intervals. One month after the fifth immunization, there were three boosts every other day without adjuvant and mouse splenocytes that were fused with FOX-NY myeloma cells. Ab-secreting hybridomas were selected by ELISA against HLA-F, and cross-reactive Ab-producing hybridomas were eliminated by ELISA against recombinant HLA-E, -G, and -A2 proteins. Hybridomas from positive wells were subjected to two or three rounds of cloning by limited dilution. Cross-reactivity with other MHC class I was further examined by Western and FACS staining using .221 cells transfected with 12 distinct HLA-A, -B, and -C alleles. Subsequent Western and immunoprecipitation analysis from a variety of B lymphoblastoid cell lines (B-LCLs) (see below) further demonstrated specificity for HLA-F. In addition, PBL and LCL derived from the corresponding individual were obtained from the International Histocompatibility Working Group cell and gene bank (www.ihwg.org) and were tested in FACS and Western analyses for cross-reactivity with other HLA class I allotypes.

Cells and cell lines

Peripheral blood was obtained from healthy donors, and PBMC were isolated by Ficoll-Hypaque centrifugation. EBV transformation of PBMC was performed according to a standard protocol (25) using virus strain B95-8. The B-LCL lines 721.45.1, .134, .221, .221-B*27052, .221-C*0402, 2C2, .220, and .220+TPN (4, 16, 26, 27) were maintained in RPMI 1640 medium supplemented with 10% (v/v) FBS, 2 mM glutamine, and 1 mM sodium pyruvate. The amnion lines FL and WISH; bladder line J82; brain line Hs 683; colon line CCD-18 Co-5; intestine line HISM; kidney line 293; liver line Chang Liver; lymphoblast lines RPMI7666 and MOLT-3; lymphoma lines U937 and 8E5; leukemia line K562; lung line Calu; placenta lines JEG, BeWo, and 3A-SubE; skin lines BUD-8 and A-431; thymus line Hs67; pancreas line AsPC-1; and monocyte lines KMA, 90196B, and MD were all obtained from America Type Culture Collection (Manassas, VA) and cultured according to the product information sheet.

Expression of recombinant HLA-F protein

HLA-F plasmid was constructed, and recombinant protein was purified as described previously for the production of recombinant HLA-E (20). Briefly, the full-length of HLA-F cDNA was prepared from RNA using .221 cells by RT-PCR. DNA coding for a GlySer linker and a BirA substrate peptide (28) was fused to a cDNA encoding 276 aa of the HLA-F heavy chains (excluding the signal sequence) by PCR with the 5' primer CG CG CG AATTCAG G AG G AATTTAAAATG G G CTCCCACTCCTTG and the 3' primer GCGCAAGCTTTTAACGATGATTCCACACCATTTTCT GT GCAT CCAGAAT AT GAT GCAGGGAT CCCT GCT CCCAT CT CAGGATGAGGGGCTGG. The underlilnes contain EcoRI and HindIII restriction sites, respectively. PCR products were ligated into pHN1+ vector and expressed in Escherichia coli strain UBS. {beta}2-m in pHN1+ was provided by D. C. Wiley (Harvard University, Cambridge, MA) and expressed in E. coli strain XA90. Both heavy and light chain inclusion bodies were isolated from cell pellets and washed repeatedly in detergent, and the resulting protein was solubilized in urea.

Immunofluorescence staining and FACS analysis

mAbs 3D11, 4A11, and 3D12 were employed in indirect immunofluorescence staining as previously described (16). Briefly, cells were preincubated with saturating concentrations of primary Abs, followed by washing and labeling with FITC-conjugated goat F(ab')2 anti-mouse Ig (BioSource, Camarillo, CA). Samples were analyzed on a FACScan cytometer (BD Biosciences, Mountain View, CA).

Cell surface biotinylation, immunoprecipitation, and endoglycosidase H (Endo H) digestion

For cell surface labeling, PBS-washed cells were biotinylated with sulfo-NHS-LC-biotin (Pierce, Rockford, IL; 300 µg/ml) for 30 min at 4°C. After being washed twice with PBS, cells were treated with 50 mM glycine at 4°C for 5 min and washed extensively. Cells were lysed at 20 x 106 cells/ml of lysis buffer containing 10 mM Tris (pH 7.8), 140 mM NaCl, 1% Triton X-100, 200 µM PMSF, 10 µg/ml of papstatin, and 14 µg/ml of aprotinin. After incubation on ice for 1 h, the lysate was centrifuged at 11,000 x g for 20 min, and the supernatant was collected. Cell surface proteins were precipitated with 50% streptavidin-agarose (Pierce) overnight at 4°C. The streptavidin-agarose beads were separated from the cell lysate by centrifugation; washed five times in 10 mM Tris-HCl (pH 7.5), 0.05% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate, 0.1%SDS, and 300 mM NaCl and once in 0.5% Nonidet P-40 in PBS; resuspended in Endo H digestion buffer (100 mM sodium citrate/phosphate(pH 5.5), 0.1% SDS, and 50 mM 2-ME); and boiled for 5 min.

The remaining cell lysate was precleaned extensively with Ig control Ab and protein A-Sepharose. Following centrifugation, the supernatant was adjusted to 0.2% SDS and 1 µg/ml BSA, and W6/32 at 5 µg/ml (final concentration) was added. After continuous mixing at 4°C for 1 h, 50% protein A-Sepharose was added at 150 µl/ml and incubated at 4°C for 2 h. The immune complex was washed twice in PBS containing 0.1% SDS and 0.5% BSA; three times with buffer containing 10 mM Na2HPO4, 0.5% Nonidet P-40, 0.5% BSA, and 0.5 M NaCl; and once in 0.5% Nonidet P-40 in PBS; resuspended in Endo H digestion buffer as described above; and boiled for 5 min. Endo H (Glyko, Novato, CA) digestion was conducted according to the manufacturer’s suggestion. In some experiments cells were not surface biotinylated; instead, total cell lysate was immunoprecipitated with W6/32 and subsequently digested with Endo H as described above. Samples derived from 5 x 105 cells were separated in 11% SDS-PAGE gel and examined by Western blot analysis.

Western blotting and immunodetection

Cells were lysed, and total cell lysate was separated on a 10% SDS-PAGE gel as described previously (16). Briefly, cells were lysed in 10 mM Tris (pH 7.5), 140 mM NaCl, 1% Triton X-100, 0.1 mM PMSF, 10 µg/ml pepstatin, and 14 µg/ml aprotinin at 20 x 106/ml. Lysate from 45 x 104 cells was loaded onto each well, and proteins were transferred to nitrocellulose membrane (S and S; Schleicher & Schuell, Keene, NH). HLA-F protein was detected by mAb 3D11, followed by HRP-labeled goat anti-mouse Igs (BioSource) at 1/5000 dilution and visualized with an ECL system (Amersham Pharmacia Biotech, Arlington Heights, IL). For analysis of cell surface and internal proteins, HLA-E and -F proteins were detected by mAbs 7G3 and 3D11, respectively.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HLA-F Abs and protein expression

Arguably, the most effective strategy toward a complete analysis of the nonclassical Ags includes the development of specific mAbs. We had previously succeeded in developing monoclonals against HLA-E and -F and soluble and membrane-bound forms of HLA-G (11, 16, 24) and have continued that progress here. To obtain sufficient HLA-F Ag for immunization, we used recombinant HLA-F synthesized in E. coli as described in Materials and Methods. Our Ab screening method relied on an ELISA using W6/32 as capture Ab and refolded recombinant HLA-F as Ag. From this screening we were able to identify three reagents that showed specificity when tested in Western analysis and immunoprecipitation from LCL .221. These cells expressed only HLA-E and -F (29), and it was possible to distinguish the HLA-F IEF pattern given the known and characterized HLA-E pattern (16). The m.w. of HLA-F is lower than those of other classical class I and HLA-E due to the absence of exon 7 in the mature transcript (21), allowing HLA-F to be distinguished according to its m.w.. Specific reactivity with HLA-F was confirmed by isoelectric focusing and by m.w. in immunoprecipitation and Western analyses using normal LCL.

The specificity of these reagents for HLA-F and a definition of cross-reactivity with other class I was further tested in FACS experiments with B-LCLs and corresponding PBL derived from the same donor. In an examination of 20 individuals selected to represent a diverse collection of HLA class I allotypes, PBL showed no reactivity with Abs 3D11 or 5E8. Ab 4A11 did, however, appear to react with a subset of the HLA-Cw4 alleles (specifically with C*0401, C*0404, and C*0405, but not with C*0403). This cross-reactivity was confirmed using .221 transfected with HLA-C*0401. These cross-reactive Cw4 alleles share with HLA-F a glutamic acid residue at position 49 in the {alpha}1 domain not found in any other class I A, B, or C allele. In addition, Western analysis of these cell lines using 3D11 or 4A11 (5E8 did not work in Western analysis) corroborated the FACS results, as we were able to distinguish HLA-F from classical class I due to its lower m.w.. It should be noted that one of these Abs was used (3D11), and two were described (3D11 and 4A11) in a recent study (11), while 5E8 is first reported here.

In an attempt to gain an initial insight toward HLA-F protein expression in normal tissue, we first analyzed a collection of cells and cell lines obtained from American Type Culture Collection (Manassas, VA) and derived from a diverse set of tissues by Western blotting. Fig. 1 shows a representative view of this analysis, demonstrating tissue-specific protein expression essentially in line with that previously described for mRNA expression (21). Some of these cells were derived directly from the tissue of origin and constitute lines with a finite life span, while others represent tumor lines derived from the cited tissue (details provided in Materials and Methods and from American Type Culture Collection). Some differences from other studies were apparent, as exemplified by skin cells, which were found to be positive in our study (Fig. 1, lanes 20 and 21) (22). We do not have an explanation for these discrepancies, although they could be cell line specific. The cells that tested positive were all further examined for surface expression of HLA-F using FACS analysis with labeled Abs 3D11 and 4A11. HLA-F could not be detected on the surface of any of the cells analyzed in Fig. 1 regardless of the apparent level of protein detected via Western analysis, with the notable exception of B-LCL RPMI 7666, which showed positive staining in FACS analysis (data not shown).



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 1. HLA-F expression is detected in specific tissue-derived cell lines. Shown are results of Western blot analysis of cell lysates from representative human cell lines detected with anti-HLA-F reagent 3D11. The tissue from which the lines were originally derived is indicated above the lanes. The numbering above each lane corresponds to cell lines as designated by American Type Culture Collection as follows: 1) FL; 2) WISH; 3) J82 transitional cell carcinoma; 4) Hs 683 glioma; 5) CCD-18 Co-5; 6) HISM; 7) 293 transformed by Ad5; 8) Chang Liver; 9) CCD-11Lu; 10) RPMI 7666 transformed by EBV; 11) MOLT-3 T cell leukemia; 12) U937 T cell lymphoma; 13) 8E5 T lymphoblastoid; 14) K562 chronic myelogenous leukemia; 15) THP1 acute monocytic leukemia; 16) Calu adenocarcinoma; 17) JEG choriocarcinoma; 18) BeWo choriocarcinoma; 19) 3A-subE SV40 transformed; 20) BUD-8; 21) A-431 carcinoma; 22) Hs67; 23) AsPC-1 adenocarcinoma; and 24) positive control 721.221.

 
HLA-F is surface expressed on B cell and monocyte cell lines

It was reported that HLA-F, while expressed in B cells and B cell lines, was not surface expressed on either cell type (22, 23). However, because our initial survey of cells had shown positive FACS staining with a B-LCL, and since the previous studies had been performed using different Abs, we decided to carry out a comparison of normal peripheral B cells and EBV-transformed B cell lines derived from the same donor using the Abs developed in our laboratory. In this regard it is noteworthy that the two Abs used here (3D11 and 4A11) have distinct and nonoverlapping epitopes (data not shown), making the pair an effective combination toward confirming our results.

Our initial Western analysis demonstrated that both cell types expressed HLA-F, in agreement with the above-mentioned studies. However, while we did not find HLA-F expressed on the surface of peripheral B cells, we did find surface expression on all corresponding B-LCLs (Fig. 2). Although levels varied depending on the LCL examined, all B-LCL expressed detectable surface HLA-F at levels similar to HLA-E. To examine whether surface HLA-F was glycosylated in a manner similar to other class I, cells were lysed, class I protein was precipitated with pan class I reagent W6/32, and the resultant material was treated with Endo H (Fig. 2, lower panel). For MHC class I Endo H resistance is indicative of complex formation and transport through the Golgi to the cell surface (30). This analysis did indeed show a correlation between surface expression and the presence of some Endo H-resistant material consistent with that found for other class I, including HLA-E. This result was consistent with the FACS analysis, which demonstrated surface HLA-F expression. However, it should be noted that a substantial portion of HLA-F protein detected in this experiment was of the high mannose hybrid-type form (Endo H-sensitive). This was true both because this experiment examined total protein and because significant amounts of the Endo H-sensitive form are surface expressed (see below).



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 2. HLA-F surface expression is detected on EBV-transformed B cells, but not on peripheral B cells. A, FACS analysis of HLA-F expression in B-LCL cells (left column) and their counterpart peripheral B cells (right column) in pairs derived from each of four individuals was performed using the HLA-F-specific mAbs 4A11 (solid line) and 3D11 (dashed line). HLA-E expression was examined with 3D12 (dotted line). Shaded profiles were cells stained with isotype-matched control Ab. Initials identifying the individuals from which the cells were derived are present within the respective FACS profiles. B, Western blot analysis demonstrating that a portion of the HLA-F protein in normal B-LCLs, but not the class I-deficient line .221, is Endo H resistant. LCLs .221, TM, and DW LCLs were lysed; class I protein was precipitated with mAb W6/32, treated (+) or untreated (-) with Endo H; and SDS-PAGE was performed. The Western blot on the left was probed with anti-HLA-E mAb 7G3 as indicated to demonstrate the control for Endo H digestion, and on the right, material from the same LCLs was similarly examined for Endo H-resistant HLA-F material using anti-HLA-F mAb 3D11 as indicated beneath the blot. Undigested material at the far left and right lanes was added for local size comparison.

 
In a search for other cell types that might express surface HLA-F, we screened several lines using FACS analysis and anti-HLA-F reagents 3D11 and 4A11 in addition to those described above. This search yielded three cell lines, each of which had its origins as a monocyte-derived cell line and expressed surface HLA-F at levels similar to that seen for HLA-E (Fig. 3A). In these cells, surface HLA-F was examined separately from cytoplasmic HLA-F by cell surface biotinylation and immunoprecipitation with streptavidin, showing that some, but not all, surface HLA-F was in an Endo H-resistant form. This was in contrast to HLA-E protein, where essentially all surface protein was converted into an Endo H-resistant form, demonstrating the specificity of surface labeling (Fig. 3B). All the cytoplasmic HLA-F and HLA-E protein was in an Endo H-sensitive form, as expected for class I that has not transported through the Golgi (Fig. 3C).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 3. HLA-F is expressed on the cell surface of monocyte cell lines, and a portion of the surface complex is Endo H resistant. A, Monocyte cells were analyzed for surface expression of HLA-F by FACS analysis using mAb 4A11 (solid lines) and 3D11 (dashed lines). Shaded histograms show Ig isotype-matched control stainings. B and C, Cell surface proteins were biotinylated with sulfo-NHS-LC-biotin as described in Materials and Methods. Cells were then lysed and immunoprecipitated with streptavidin-agarose beads. The avidin-bound immunocomplexes (B) and the remaining lysates (C) were separated and subsequently treated (+) or untreated (-) with Endo H, separated in SDS-PAGE, and analyzed by Western blot analysis. HLA-E proteins were detected on a subset of the cell lines using mAb 7G3 (left) to demonstrate the control for Endo H digestion. HLA-F protein was detected using mAb 3D11 (right) on the same material.

 
HLA-F surface expression is independent of TAP, but partially dependent on tapasin

Given that HLA-F resembled other class I proteins with regard to surface expression and glycosylation, at least on B-LCL and monocyte cell lines, we undertook a comprehensive examination of HLA-F expression on the mutant cell lines that are deficient in normal TAP and tapasin function (4, 5). These cells expressed endogenous HLA-F, and therefore it was possible to examine them directly using the Abs described in this report. In addition, they expressed endogenous HLA-E and were used to examine HLA-E in previous studies (16), providing a useful control for the analysis of HLA-F. Whereas HLA-E showed the expected lack of surface expression in TAP and tapasin-negative cells, HLA-F surface expression was clearly unperturbed on the TAP-negative .134 mutant and was only moderately lowered in the tapasin mutant .220 (Fig. 4A). Indeed, there was no difference between HLA-F expression on parent line 45.1, line .134, or the TAP-restored line 2C2. It was further apparent that, as expected, all N-glycosylation of HLA-E in mutant cells was in the high mannose hybrid-type oligosaccharide (Fig. 4B), and the complexity of glycosylation was restored when TAP was restored in 2C2 cells. However, again in contrast, the glycosylation levels of HLA-F were unchanged in the TAP-negative line .134 regardless of whether total cellular protein or surface protein was examined (Fig. 4, B and C).



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 4. Cell surface expression of HLA-F on B-LCL is independent of the presence of a functional TAP protein and is partially independent of the tapasin molecule. A, FACS analysis of surface expression of HLA-F in the TAP-negative mutant .134 and LCL 2C2, the TAP-positive reconstitution of .134 (4 ), the tapasin-deficient cell line .220, and the tapasin-restored transfectant of .220 (.220+TPN) (27 ) using mAb 4A11 (solid lines). Parent LCL 45.1 (TAP and tapasin positive) is included for comparison. HLA-E surface expression, which is dependent on TAP and tapasin (16 ), was detected using mAb 3D12 (dotted lines) for comparison. Shaded histograms show staining of Ig isotype-matched control Ab. B, Western analysis of untreated (-) and Endo H-treated (+), W6/32-precipitated protein using anti-HLA-E reagent 7G3 and anti-HLA-F reagent 3D11. The same cell lines as in A were examined, with the addition of 721.221 to control for Endo H digestion of sensitive protein. C, Surface protein labeled with biotin and precipitated with avidin-coated beads was run untreated (-) or was subjected to Endo H (+) for each of the cell lines described in B and was detected with anti-HLA-F reagent 3D11 in Western analysis.

 
HLA-F expression did not appear to be independent of tapasin, because a difference in surface HLA-F was apparent when .220 was compared with the parent line 45.1, the TAP-negative line .134, or the TAP-restored line 2C2, and the reduced surface levels of HLA-F were restored in a tapasin transfectant of .220 (Fig. 4A). In this case the surface HLA-F lost was apparently all of the complex-type or Endo H-resistant glycosylation form. Further, this Endo H-resistant form was also restored in the tapasin transfectant of .220 (Fig. 4, B and C). All the material in .220 cells was sensitive to Endo H regardless of whether total protein or surface-labeled protein was examined (Fig. 4, B and C). However, despite the fact that all the HLA-F was the hybrid-type oligosaccharide, as found for HLA-E, it should be clearly noted that this phenotype was distinct from HLA-E, because some HLA-F protein was still expressed on the surface. This result raised the possibility that on the cell surface the Endo H-resistant form of HLA-F was associated with {beta}2m, while the sensitive form was not. It was not possible to distinguish the surface and intracellular forms of HLA-F in these cells; however, it may be noteworthy that the {beta}2m-negative B cell line Daudi was devoid of surface HLA-F, although Daudi transfected with {beta}2m was also lacking surface expression (data not shown).

Stabilization of HLA-F surface protein is distinct from other class I

One feature of class I protein that is related to its ability to bind peptide and a direct measure of its stability without bound ligand is the stabilization of surface MHC class I by lower temperature (30). When TAP-negative human or murine mutant cell lines are cultured at reduced temperature (19–33°C), assembly of heavy chain and {beta}2-m is promoted and results in a high level of cell surface expression of MHC heavy chain/{beta}2-m complexes that do not present endogenous Ags and are labile at 37°C. This feature is common to all class I proteing, including HLA-E, and therefore provides a useful point to compare HLA-F expression with other class I proteins. Further, this test is one measure of whether HLA-F is lacking peptide in cells that express endogenous protein that is not surface expressed. In the present study we grouped cell types into three classes that expressed HLA-F protein, lines J82 or A431 that expressed significant levels of HLA-F intracellularly, but not on the surface; monocyte-related cell lines; and normal B-LCLs, both of the latter expressing HLA-F on the surface. When these cells were examined by incubation at 26°C, so-called cold treatment, it was apparent that HLA-F expression was unaffected in every case (Fig. 5). In no case did the level of HLA-F surface protein increase, and indeed, in some cases there was a slight decrease in expression. This was true despite the fact that HLA-E could consistently be stabilized and surface expression levels increased on these cells in precisely the same experiment, demonstrating the effectiveness of the treatment to stabilize class I.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 5. HLA-F surface expression is down-regulated or unaffected by cold treatment in cells expressing the protein. Detection of HLA-F on the surface of cells by flow cytometric analysis was performed using mAbs 4A11 and 3D11. HLA-E was detected using specific mAb 3D12 for comparison and as a control for temperature treatment, as previous studies have shown increased surface expression of HLA-E upon cold treatment (16 18 ). Three types of cells were examined after normal growth conditions at 37°C and after treatment at 25°C for 24 h. A, Monocyte cell lines that express endogenous HLA-F but lacked surface expression (Fig. 1); B, monocyte cell lines that express surface HLA-F (Fig. 3); C, B-LCLs. Above and to the left of each quartet of FACS profiles is indicated the cell name, and within each profile is indicated the Ab used for staining. Cells incubated at 37°C (solid lines) and after treatment at 25°C for 24 h (dashed lines) were stained with the indicated mAbs. Overlapping gray profiles and dotted lines are the 37 and 25°C treated cells stained with Ig isotype-matched control mAbs, respectively.

 
During a survey of several cell types for HLA-F surface expression and stabilization, we found one exception that behaved consistently with other class I proteins. Deletion mutant line .221 showed a clear and relatively strong increase in surface HLA-F upon cold treatment, while the parent line .144 (hemizygous MHC and deficient in HLA-A and surrounding sequences) (31) and the grandparent line 45.1 (hemizygous MHC) showed no change upon similar treatment (Fig. 6). Again, an examination of HLA-E levels in the same experiment controlled for the effectiveness of the cold treatment. It is interesting to note that .221 is missing the same sequences surrounding HLA-A as .144, but is further missing, at the least, an extended portion of the MHC around and including theHLA-B and -C loci. Given transfectants of .221 that express the HLA-B and -C loci, we were able to rule out that this phenotype was not simply due to the absence of either of these two class I genes (as was the case with HLA-E) (16). No differences from .221 were observed when .221-B*27052 or .221-C*0402 transfectants were tested for surface stabilization of HLA-F (Fig. 6).



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 6. Class I deletion mutant LCL .221 shows exceptional expression of HLA-F after cold treatment. Detection of HLA-F on the surface of cells by flow cytometric analysis was performed using mAb 4A11. HLA-E was detected on the same cells using specific mAb 3D12 as a control for temperature treatment. The parent line LCL 45.1 is hemizygous for the MHC and primary offspring, and deletion mutant .144 (missing HLA-A and surrounding region) is a precursor of .221 (missing HLA-A, HLA-B, HLA-C, and some surrounding sequences). Class I transfectants of .221 expressing HLA-B*27052 and HLA-C*0402 were described previously (16 ). Cells incubated at 37°C (solid lines) and after treatment at 25°C for 24 h (dashed lines) were stained with the indicated mAbs. Overlapping gray profiles and dotted lines are the 37 and 25°C treated cells stained with Ig isotype-matched control mAbs, respectively.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have examined the expression of HLA-F protein with a particular focus on searching for surface expression and understanding the mechanisms regulating its cell surface expression. To accomplish this we generated mAbs that specifically react with HLA-F and that complement one another in their reactivity. In a survey of tissues and cell lines, we found that HLA-F was expressed intracellularly in a number of cell types, but was not transported to the surface in most of these. The two exceptions, EBV-transformed B cell lines and monocyte-derived cell lines, expressed HLA-F surface protein at levels comparable to HLA-E. Whereas none of the HLA-F protein expressed in deletion mutant LCL 721.221 was converted to the Endo H-resistant form, only a portion of the surface HLA-F on normal LCL was glycosylated in a manner typical of peptide-bound HLA class I. This was also true of the monocyte-derived cell lines, where some of the surface-expressed HLA-F was Endo H resistant, indicating a typical transport to the cell surface. These two cell types constituted the first examples of cell lines where HLA-F was surface expressed.

HLA-F mRNA expression was examined in the original descriptions of the gene (21, 32), and the results found here agree with those with respect to the differential expression of HLA-F in tissues and cells. In general, HLA-F was expressed in B cell lines and was not present in T cell lines. Our results were mostly consistent with two other studies that examined HLA-F protein expression (22, 23), but differed notably with respect to surface expression on B cell lines, while neither examined protein expression on the three monocyte-derived cell lines reported here. However, at least three lines of evidence are consistent with the findings of surface expression we report here. First, the three distinct anti-HLA-F Abs we used gave consistent results in FACS analysis, and two of these, 3D11 and 4A11, gave consistent results in Western analysis (the third was not useful in Western analysis). In addition, we know that 3D11 and 4A11 react with distinct epitopes on HLA-F (D. E. Geraghty, unpublished observations), further increasing the confidence in these results. A second line of evidence supporting our conclusions is the observation of Endo H-resistant HLA-F protein coincident with surface expression on B cell and monocyte cell lines, and that this glycosylated form was restricted to the cell surface (Figs. 3 and 4). The loss of Endo H-resistant material coincident with decreased relative surface levels on mutant line .220 compared with its parent lines presents a third piece of supporting evidence for surface expression of HLA-F on B cell lines.

While some HLA-F surface protein showed glycosylation patterns consistent with peptide loading and transport through the Golgi, in B-LCLs there was apparently no dependence on TAP for surface expression. No decrease in HLA-F surface expression was apparent in the TAP-negative LCL .134 compared with either the parent line 45.1 or the TAP-restored derivative line 2C2. Also, Endo H-resistant protein was present in all three lines essentially as observed in normal LCLs. It was shown that HLA-F associates physically with TAP, which indicated that it may depend on TAP for peptide binding (22, 23). This finding was surprising in light of the observation that residues 116 and 156 might play a role in MHC class I association with TAP (33), while both those residues are substantially altered in the HLA-F sequence (21). An explanation may be indicated by other evidence of one residue in the {alpha}2 domain of HLA-A2. Residues in the {alpha}3 domain have been shown to be involved in this association (34, 35, 36), and these positions are conserved in HLA-F. Regardless of which interpretation is relevant, the significance of TAP and HLA-F association is now in question, and the physical observation of this association may only rely on conserved residues and not be functionally relevant. There is no a priori reason to believe that association of class I with TAP necessarily indicates a corresponding dependence on TAP for peptide loading. Arguing from the logical contrary, soluble HLA-G does not associate with TAP, yet it depends on TAP for peptide loading (24).

While no dependence on TAP was observed at least in LCL, it was clear that there was some level of tapasin dependence for surface expression, as overall surface levels were reduced, and all Endo H-resistant material was absent in tapasin-negative .220. This could indicate that of the two forms of HLA-F on the surface, the Endo H-resistant form is peptide dependent in a manner typical of MHC class I. By analogy to other HLA class Ib proteins, there are two possibilities: 1) HLA-F binds a broad array of peptides similar to HLA-G (24); or 2) HLA-F binds a restricted set more in analogy to HLA-E (16). In our survey of a large number of cell lines for HLA-F surface expression, it was clear that while several cell types expressed HLA-F intracellularly, few expressed it on the surface. This could indicate that the specific peptide(s) required for HLA-F surface expression is restricted to a relatively small set of peptides. Such a restricted peptide-binding site has been proposed for HLA-F based on modeling the structure on other HLA class I (37).

Beyond the novel observation that HLA-F is surface expressed on certain cell types is the compelling question of whether this expression is dependent upon peptide or other ligand for complex stabilization as with other class I proteins. The fact that surface expression of HLA-F is TAP independent does not by itself contradict the potential for peptide binding. Several examples of the efficient assembly of class I and peptide in the absence of TAP have been described for peptides that are targeted into the endoplasmic reticulum in TAP-independent ways as long as tapasin is present (38, 39). There are many sources of TAP-independent peptides, and nonpeptide ligands are certainly not ruled out (39). Indeed, then, the ability of HLA-F to bind peptide is supported by the absence of complex-type HLA-F on tapasin-negative cells, so that at least this portion of the HLA-F surface protein might be complexed with peptide.

It was apparent that in both LCL and monocyte cell lines, two distinct forms of HLA-F were present on the surface: a high mannose hybrid-type form and a form with complex-type N-glycosylation. Although less common, examples of high mannose glycan-bearing proteins on the cell surface have been reported (e.g., CD2 (40) and the ME20 Ag (41)), and of the two glycosylation sites present on the HLA-DRA chain, one is high mannose and one is complex type on the surface protein (42). A rationalization for this difference is that the three-dimensional structure of the protein may dictate the accessibility of the high mannose sugars for further glycosylation (43). If this is true, then the finding of two distinct glycosylation forms of HLA-F might suggest that the protein is present in two distinct conformations. Since glycosylation is presumably stabilizing the glycoprotein structures (44), a consequence may be a differential in the half-life of the two forms of HLA-F.

Post-translational glycosylation is critical for the biological function of many proteins. The distinct HLA-F glycosylation patterns observed naturally raise the question of whether the two forms of HLA-F have distinct functions. Examples of both similar and dissimilar functions have been reported. High mannose structures on soluble CD154 compared with complex-type sCD154 glycoprotein showed no difference in complex formation, ligand binding, or function (45). However, changes in the glycosylation of CD44 did appear to have important regulatory effects on CD44 function (46), and the extent of glycosylation of the human prostacyclin receptor may be important for ligand binding and signal transduction (47). Glycosylation of MHC class I is not required for recognition by B or T cells, and at least for some of the inhibitory specificities examined, oligosaccharide is not necessary for activity of MHC class I and NK cell inhibitory receptors (48). However, intracellular trafficking appears to be significantly affected by changes in glycosylation or the lack thereof, as mutant class I heavy chains that lack glycosylation sites show inefficient transit to the cell surface. Possibly relevant to HLA-F, high mannose-type glycans, once phosphorylated, can interact with mannose-6-phosphate receptors to assist trafficking to the lysosomal compartment (49), speculatively in the example of HLA-F, for peptide loading there. In addition, CD1 days, an MHC complex class I-like protein, can be surface expressed in vivo in two forms, one Endo H-sensitive and one Endo H-resistant (50, 51). Further, CD1 days proceeds through both intrinsic and extrinsic pathways to complex with Ags, the former through the secretory pathway, and the latter where CD1 days is first targeted to the endosomes for Ag loading before traveling to the cell surface (52, 53).

A classic measure of the dependence of MHC class I for peptide is the ability to stabilize the surface molecule by incubation at lower temperatures (30). Therefore, the inability to stabilize empty HLA-F upon cold treatment of cells would argue against peptide binding being involved in stabilization of the complex. However, this latter caveat to peptide binding could be explained by the single exception that we found in the MHC deletion mutant .221. After testing an extensive panel of cells, we found that only LCL .221 showed up-regulation of HLA-F. Therefore, HLA-F expressed in this cell line behaved like other class I in being stabilized despite the fact that HLA-F expressed in parent deletion line .144 was not stabilized. The MHC defect of .144 includes the HLA-A gene and surrounding sequences and is shared by .221, while .221 has additional deletions of the HLA-B and HLA-C genes (29, 31), including some 150 kb of sequences flanking HLA-B (D. E. Geraghty, unpublished observations). Restoration of the HLA-B and -C genes into .221 did not alter the ability of HLA-F to be stabilized by cold treatment, ruling out a direct involvement of these genes in this phenotype. One model for HLA-F expression and regulation that might account for these cell-specific differences is that a negative inhibitory factor is encoded or regulated by a gene(s) found within the regions specifically deleted in .221. This factor is hypothesized to regulate HLA-F protein transport to the cell surface, possibly by binding HLA-F and acting as a retention factor.

It is possible that peptide is bound to one glycosylated HLA-F form and not the other, presumably the Endo H-resistant form binding peptide, and that one form is empty or expressed as a free heavy chain. Precedent for that has been observed in the HLA-B27 homodimer expressed coincidently with HLA-B27 complexed with peptide and {beta}2-m on some cells (54). However, the distinct forms may instead reflect different pathways in their progression to the cell surface, and both pathways could conceivably provide peptide or other ligand, as is the case with CD1d (52, 53). Given the cell lines expressing surface HLA-F and specific mAbs, these questions may now be more directly addressed.


    Acknowledgments
 
Yuki Moore and Akinori Miki provided helpful discussions and other assistance during the course of this work. The expert technical assistance of Scott Medley and Laura Braun is gratefully acknowledged. Thomas Spies generously provided Daudi-{beta}2m, TAP, and tapasin mutant and reconstituted cell lines. We thank Eileen Geraghty for critical reading of the manuscript.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants AI38508 and AI49213 (to D.E.G.). Back

2 Address correspondence and reprint requests to Dr. Daniel E. Geraghty, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue North, D4-100, Seattle, WA 98109-1024. E-mail address: geraghty{at}fhcrc.org Back

3 Abbreviations used in this paper: {beta}2-m, {beta}2-microglobulin; Endo H, endoglycosidase H; B-LCL, B lymphoblastoid cell line. Back

Received for publication October 29, 2002. Accepted for publication September 4, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Accolla, R. S., L. Adorini, S. Sartoris, F. Sinigaglia, J. Guardiola. 1995. MHC: orchestrating the immune response. Immunol. Today 16:8.[Medline]
  2. Lanier, L. L., J. H. Phillips. 1995. NK cell recognition of major histocompatibility complex class I molecules. Semin. Immunol. 7:75.[Medline]
  3. Colonna, M.. 1996. Natural killer cell receptors specific for MHC class I molecules. Curr. Opin. Immunol. 8:101.[Medline]
  4. Spies, T., R. DeMars. 1991. Restored expression of major histocompatibility class I molecules by gene transfer of a putative peptide transporter. Nature 351:323.[Medline]
  5. Spies, T., V. Cerundolo, M. Colonna, P. Cresswell, A. Townsend, R. DeMars. 1992. Presentation of viral antigen by MHC class I molecules is dependent on a putative peptide transporter heterodimer. Nature 355:644.[Medline]
  6. Geraghty, D. E., B. H. Koller, J. A. Hansen, H. T. Orr. 1992. The HLA class I gene family includes at least six genes and twelve pseudogenes and gene fragments. J. Immunol. 149:1934.[Abstract]
  7. Koller, B. H., D. Geraghty, H. T. Orr, Y. Shimizu, R. DeMars. 1987. Organization of the human class I major histocompatibility complex genes. Immunol. Res. 6:1.
  8. Geraghty, D. E.. 1993. Structure of the HLA class I region and expression of its resident genes. Curr. Opin. Immunol. 5:3.[Medline]
  9. Little, A. M., P. Parham. 1999. Polymorphism and evolution of HLA class I and II genes and molecules. Rev. Immunogenet. 1:105.[Medline]
  10. Hughes, A. L., M. Nei. 1988. Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection. Nature 335:167.[Medline]
  11. Ishitani, A., N. Sageshima, N. Lee, N. Dorofeeva, K. Hatake, H. Marquardt, D. E. Geraghty. 2003. Protein expression and peptide binding suggest unique and interacting functional roles for HLA-E, F, and G in maternal-placental immune recognition. J. Immunol. 171:1376.[Abstract/Free Full Text]
  12. Ponte, M., C. Cantoni, R. Biassoni, A. Tradori-Cappai, G. Bentivoglio, C. Vitale, S. Bertone, A. Moretta, L. Moretta, M. C. Mingari. 1999. Inhibitory receptors sensing HLA-G1 molecules in pregnancy: decidua-associated natural killer cells express LIR-1 and CD94/NKG2A and acquire p49, an HLA-G1-specific receptor. Proc. Natl. Acad. Sci. USA 96:5674.[Abstract/Free Full Text]
  13. Rajagopalan, S., E. O. Long. 1999. A human histocompatibility leukocyte antigen (HLA)-G-specific receptor expressed on all natural killer cells. J. Exp. Med. 189:1093.[Abstract/Free Full Text]
  14. Navarro, F., M. Llano, T. Bellon, M. Colonna, D. E. Geraghty, M. Lopez-Botet. 1999. The ILT2(LIR1) and CD94/NKG2A NK cell receptors respectively recognize HLA-G1 and HLA-E molecules co-expressed on target cells. Eur. J. Immunol. 29:277.[Medline]
  15. Colonna, M., J. Samaridis, M. Cella, L. Angman, R. L. Allen, C. A. O’Callaghan, R. Dunbar, G. S. Ogg, V. Cerundolo, A. Rolink. 1998. Human myelomonocytic cells express an inhibitory receptor for classical and nonclassical MHC class I molecules. J. Immunol. 160:3096.[Abstract/Free Full Text]
  16. Lee, N., D. R. Goodlett, A. Ishitani, H. Marquardt, D. E. Geraghty. 1998. HLA-E surface expression depends on binding of TAP-dependent peptides derived from certain HLA class I signal sequences. J. Immunol. 160:4951.[Abstract/Free Full Text]
  17. Braud, V. M., D. S. Allan, C. A. O’Callaghan, K. Soderstrom, A. D’Andrea, G. S. Ogg, S. Lazetic, N. T. Young, J. I. Bell, J. H. Phillips, et al 1998. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391:795.[Medline]
  18. Lee, N., M. Llano, M. Carretero, A. Ishitani, F. Navarro, M. Lopez-Botet, D. E. Geraghty. 1998. HLA-E is a major ligand for the natural killer inhibitory receptor CD94/NKG2A. Proc. Natl. Acad. Sci. USA 95:5199.[Abstract/Free Full Text]
  19. O’Callaghan, C. A., J. Tormo, B. E. Willcox, V. M. Braud, B. K. Jakobsen, D. I. Stuart, A. J. McMichael, J. I. Bell, E. Y. Jones. 1998. Structural features impose tight peptide binding specificity in the nonclassical MHC molecule HLA-E. Mol. Cell 1:531.[Medline]
  20. Strong, R. K., M. A. Holmes, P. Li, L. Braun, N. Lee, D. E. Geraghty. 2003. HLA-E allelic variants: correlating differential expression, peptide affinities, crystal structures and thermal stabilities. J. Biol. Chem. 278:5082.[Abstract/Free Full Text]
  21. Geraghty, D. E., X. H. Wei, H. T. Orr, B. H. Koller. 1990. Human leukocyte antigen F (HLA-F). An expressed HLA gene composed of a class I coding sequence linked to a novel transcribed repetitive element. J. Exp. Med. 171:1.[Abstract/Free Full Text]
  22. Wainwright, S. D., P. A. Biro, C. H. Holmes. 2000. HLA-F is a predominantly empty, intracellular, TAP-associated MHC class Ib protein with a restricted expression pattern. J. Immunol. 164:319.[Abstract/Free Full Text]
  23. Lepin, E. J., J. M. Bastin, D. S. Allan, G. Roncador, V. M. Braud, D. Y. Mason, P. A. van der Merwe, A. J. McMichael, J. I. Bell, S. H. Powis, et al 2000. Functional characterization of HLA-F and binding of HLA-F tetramers to ILT2 and ILT4 receptors. Eur. J. Immunol. 30:3552.[Medline]
  24. Lee, N., A. R. Malacko, A. Ishitani, M. C. Chen, J. Bajorath, H. Marquardt, D. E. Geraghty. 1995. The membrane-bound and soluble forms of HLA-G bind identical sets of endogenous peptides but differ with respect to TAP association. Immunity 3:591.[Medline]
  25. Spector, D. L., R. D. Goldman, L. A. Leinwand. 1988. Cells: A Laboratory Manual, Vol. 1: Culture and Biochemical Analysis of Cells 7.4. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
  26. Shimizu, Y., R. DeMars. 1989. Production of human cells expressing individual transferred HLA-A, -B, -C genes using an HLA-A, -B, -C null human cell line. J. Immunol. 142:3320.[Abstract]
  27. Grandea, A. G., III, M. J. Androlewicz, R. S. Athwal, D. E. Geraghty, T. Spies. 1995. Dependence of peptide binding by MHC class I molecules on their interaction with TAP. Science 270:105.[Abstract/Free Full Text]
  28. Schatz, P. J.. 1993. Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme: a 13 residue consensus peptide specifies biotinylation in Escherichia coli. Bio/Technology 11:1138.[Medline]
  29. Shimizu, Y., D. E. Geraghty, B. H. Koller, H. T. Orr, R. DeMars. 1988. Transfer and expression of three cloned human non-HLA-A, B, C class I major histocompatibility complex genes in mutant lymphoblastoid cells. Proc. Natl. Acad. Sci. USA 85:227.[Abstract/Free Full Text]
  30. Ljunggren, H. G., N. J. Stam, C. Ohlen, J. J. Neefjes, P. Hoglund, M. T. Heemels, J. Bastin, T. N. Schumacher, A. Townsend, K. Karre, et al 1990. Empty MHC class I molecules come out in the cold. Nature 346:476.[Medline]
  31. Shimizu, Y., B. Koller, D. Geraghty, H. Orr, S. Shaw, P. Kavathas, R. DeMars. 1986. Transfer of cloned human class I major histocompatibility complex genes into HLA mutant human lymphoblastoid cells. Mol. Cell. Biol. 6:1074.[Abstract/Free Full Text]
  32. Lury, D., H. Epstein, N. Holmes. 1990. The human class I MHC gene HLA-F is expressed in lymphocytes. Int. Immunol. 2:531.[Abstract/Free Full Text]
  33. Neisig, A., R. Wubbolts, X. Zang, C. Melief, J. Neefjes. 1996. Allele-specific differences in the interaction of MHC class I molecules with transporters associated with antigen processing. J. Immunol. 156:3196.[Abstract]
  34. Kulig, K., D. Nandi, I. Bacik, J. J. Monaco, S. Vukmanovic. 1998. Physical and functional association of the major histocompatibility complex class I heavy chain alpha3 domain with the transporter associated with antigen processing. J. Exp. Med. 187:865.[Abstract/Free Full Text]
  35. Peace-Brewer, A. L., L. G. Tussey, M. Matsui, G. Li, D. G. Quinn, J. A. Frelinger. 1996. A point mutation in HLA-A*0201 results in failure to bind the TAP complex and to present virus-derived peptides to CTL. Immunity 4:505.[Medline]
  36. Lewis, J. W., A. Neisig, J. Neefjes, T. Elliott. 1996. Point mutations in the alpha 2 domain of HLA-A2.1 define a functionally relevant interaction with TAP. Curr. Biol. 6:873.[Medline]
  37. O’Callaghan, C. A., J. I. Bell. 1998. Structure and function of the human MHC class Ib molecules HLA-E, HLA-F and HLA-G. Immunol. Rev. 163:129.[Medline]
  38. Momburg, F., G. J. Hammerling. 1998. Generation and TAP-mediated transport of peptides for major histocompatibility complex class I molecules. Adv. Immunol. 68:191.[Medline]
  39. Pamer, E., P. Cresswell. 1998. Mechanisms of MHC class I-restricted antigen processing. Annu. Rev. Immunol. 16:323.[Medline]
  40. Wyss, D. F., J. S. Choi, G. Wagner. 1995. Composition and sequence specific resonance assignments of the heterogeneous N-linked glycan in the 13.6 kDa adhesion domain of human CD2 as determined by NMR on the intact glycoprotein. Biochemistry 34:1622.[Medline]
  41. Maresh, G. A., W. C. Wang, K. S. Beam, A. R. Malacko, I. Hellstrom, K. E. Hellstrom, H. Marquardt. 1994. Differential processing and secretion of the melanoma-associated ME20 antigen. Arch. Biochem. Biophys. 311:95.[Medline]
  42. Shackelford, D. A., J. L. Strominger. 1983. Analysis of the oligosaccharides on the HLA-DR and DC1 B cell antigens. J. Immunol. 130:274.[Abstract]
  43. Wyss, D. F., J. S. Choi, J. Li, M. H. Knoppers, K. J. Willis, A. R. Arulanandam, A. Smolyar, E. L. Reinherz, G. Wagner. 1995. Conformation and function of the N-linked glycan in the adhesion domain of human CD2. Science 269:1273.[Abstract/Free Full Text]
  44. Wyss, D. F., G. Wagner. 1996. The structural role of sugars in glycoproteins. Curr. Opin. Biotechnol. 7:409.[Medline]
  45. Khandekar, S. S., C. Silverman, J. Wells-Marani, A. M. Bacon, H. Birrell, M. Brigham-Burke, D. J. DeMarini, Z. L. Jonak, P. Camilleri, J. Fishman-Lobell. 2001. Determination of carbohydrate structures N-linked to soluble CD154 and characterization of the interactions of CD40 with CD154 expressed in Pichia pastoris and Chinese hamster ovary cells. Protein Expression Purif. 23:301.[Medline]
  46. Bartolazzi, A., A. Nocks, A. Aruffo, F. Spring, I. Stamenkovic. 1996. Glycosylation of CD44 is implicated in CD44-mediated cell adhesion to hyaluronan. J. Cell Biol. 132:1199.[Abstract/Free Full Text]
  47. Zhang, Z., S. C. Austin, E. M. Smyth. 2001. Glycosylation of the human prostacyclin receptor: role in ligand binding and signal transduction. Mol. Pharmacol. 60:480.[Abstract/Free Full Text]
  48. Parham, P.. 1996. Functions for MHC class I carbohydrates inside and outside the cell. Trends Biochem. Sci. 21:427.[Medline]
  49. Kornfeld, S., I. Mellman. 1989. The biogenesis of lysosomes. Annu. Rev. Cell. Biol. 5:483.[Medline]
  50. Amano, M., N. Baumgarth, M. D. Dick, L. Brossay, M. Kronenberg, L. A. Herzenberg, S. Strober. 1998. CD1 expression defines subsets of follicular and marginal zone B cells in the spleen: {beta}2-microglobulin-dependent and independent forms. J. Immunol. 161:1710.[Abstract/Free Full Text]
  51. Kim, H. S., J. Garcia, M. Exley, K. W. Johnson, S. P. Balk, R. S. Blumberg. 1999. Biochemical characterization of CD1d expression in the absence of {beta}2-microglobulin. J. Biol. Chem. 274:9289.[Abstract/Free Full Text]
  52. Kang, S. J., P. Cresswell. 2002. Regulation of intracellular trafficking of human CD1d by association with MHC class II molecules. EMBO J. 21:1650.[Medline]
  53. Jayawardena-Wolf, J., K. Benlagha, Y. H. Chiu, R. Mehr, A. Bendelac. 2001. CD1d endosomal trafficking is independently regulated by an intrinsic CD1d-encoded tyrosine motif and by the invariant chain. Immunity 15:897.[Medline]
  54. Allen, R. L., C. A. O’Callaghan, A. J. McMichael, P. Bowness. 1999. Cutting edge: HLA-B27 can form a novel {beta}2-microglobulin-free heavy chain homodimer structure. J. Immunol. 162:5045.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
E. Lo Monaco, L. Sibilio, E. Melucci, E. Tremante, M. Suchanek, V. Horejsi, A. Martayan, and P. Giacomini
HLA-E: Strong Association with {beta}2-Microglobulin and Surface Expression in the Absence of HLA Class I Signal Sequence-Derived Peptides
J. Immunol., October 15, 2008; 181(8): 5442 - 5450.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Grasberger, X. De Deken, F. Miot, J. Pohlenz, and S. Refetoff
Missense Mutations of Dual Oxidase 2 (DUOX2) Implicated in Congenital Hypothyroidism Have Impaired Trafficking in Cells Reconstituted with DUOX2 Maturation Factor
Mol. Endocrinol., June 1, 2007; 21(6): 1408 - 1421.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. H. Boyle, A. K. Gillingham, S. Munro, and J. Trowsdale
Selective Export of HLA-F by Its Cytoplasmic Tail.
J. Immunol., June 1, 2006; 176(11): 6464 - 6472.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Feuerhake, J. L. Kutok, S. Monti, W. Chen, A. S. LaCasce, G. Cattoretti, P. Kurtin, G. S. Pinkus, L. de Leval, N. L. Harris, et al.
NF{kappa}B activity, function, and target-gene signatures in primary mediastinal large B-cell lymphoma and diffuse large B-cell lymphoma subtypes
Blood, August 15, 2005; 106(4): 1392 - 1399.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Li, B. A. Sullivan, C. J. Aldrich, M. J. Soloski, J. Forman, A. G. Grandea III, P. E. Jensen, and L. Van Kaer
Differential Requirement for Tapasin in the Presentation of Leader- and Insulin-Derived Peptide Antigens to Qa-1b-Restricted CTLs
J. Immunol., September 15, 2004; 173(6): 3707 - 3715.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, N.
Right arrow Articles by Geraghty, D. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, N.
Right arrow Articles by Geraghty, D. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS