The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lafont, V.
Right arrow Articles by Favero, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lafont, V.
Right arrow Articles by Favero, J.
The Journal of Immunology, 2003, 171: 5225-5232.
Copyright © 2003 by The American Association of Immunologists

Specific Signaling Pathways Triggered by IL-2 in Human V{gamma}9V{delta}2 T Cells: An Amalgamation of NK and {alpha}{beta} T Cell Signaling 1

Virginie Lafont2, Séverine Loisel, Janny Liautard, Sherri Dudal, Magali Sablé-teychené, Jean-Pierre Liautard and Jean Favero

Institut National de la Santé et de la Recherche Médicale Unité 431, Université Montpellier 2, Montpellier, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The global immune response can be simplified into two components: the innate and the acquired systems. The innate immune response comprises primarily macrophages and NK cells, while B and T cells orchestrate the acquired response. Human V{gamma}9V{delta}2 T cells represent a minor T cell subpopulation in blood (1–5%) that is activated via the TCR by small nonpeptidic molecules. Their percentage dramatically increases during the early phase of infection by intracellular pathogens, and they display many characteristics of NK cells, which places them at a unique position within the immune system. Our aim was to explore the behavior of these cells when they are activated by a receptor that is common to NK and {alpha}{beta} T cells, and to determine signaling pathways and biological responses induced in these cells through this receptor. Thus, we investigated whether V{gamma}9V{delta}2 T cells behave as NK cells or as {alpha}{beta} T cells. We demonstrated that IL-2 activates not only STAT3, STAT5, the phosphatidylinositol 3-kinase pathway, and extracellular signal-regulated kinase-2 pathway, but also STAT4 as in NK cells, and the p38 mitogen-activated protein kinase pathway as in {alpha}{beta} T cells. Moreover, IL-2 induces the production of IFN-{gamma} in V{gamma}9V{delta}2 T cells as observed in NK cells. Due to their double profiles, V{gamma}9V{delta}2 T cells are at the interface of the innate and the acquired immune response and may therefore not only modulate the activity of innate cells, but also influence Th1/Th2 differentiation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The global immune response results from two separate, but intimately interdependent, systems: the innate system and the acquired system. These two aspects of immunity are devoted to specific cell populations where mainly monocytes/macrophages and NK cells are involved in the innate response and T and B lymphocytes are implicated in the acquired response. In humans, {gamma}{delta} T cells represent a minor T cell population, representing 1–5% of the circulating T cells in the blood and in adults, the majority of {gamma}{delta} T cells express {gamma}9 and {delta}2 determinants (up to 90%) (1). In vivo, the percentage of the V{gamma}9V{delta}2 cell subset dramatically increases during the early phase of infection by intracellular pathogens of viral, bacterial, and parasitic origin (1). Furthermore, they display many characteristics which are normally specific for NK cells (2, 3). To date, the place and the specific role of V{gamma}9V{delta}2 T cells in the immune response and their impact on the development of the infectious process are still not well-understood and remain to be clarified.

Many studies have provided evidence that V{gamma}9V{delta}2 T cells are not a redundant T cell subset but possess their own properties and regulation mechanisms, particularly in the way they are activated through the TCR. They recognize, and are activated by Ags identified as small nonpeptidic molecules (4). These Ags were originally isolated from mycobacteria (5, 6) and were subsequently found in various other intracellular pathogens as metabolic products (7, 8, 9). The recognition of nonpeptidic Ag by V{gamma}9V{delta}2 T cells does not require Ag processing or presentation by MHC (10, 11). Moreover, we have previously shown that, contrary to {alpha}{beta} T cells, activation of V{gamma}9V{delta}2 T cells leading to biological responses does not require an additional signal (such as a cosignal via CD28) (12). Following stimulation by nonpeptidic Ags, V{gamma}9V{delta}2 T cells proliferate, release large amounts of cytokines (particularly IFN-{gamma} and TNF-{alpha}) (13, 14), and acquire cytotoxic activity against tumor cells (11, 15) or infected cells (16, 17).

Interestingly, V{gamma}9V{delta}2 T cells also phenotypically resemble NK cells. A large proportion of circulating V{gamma}9V{delta}2 T cells express NK receptors of the C-type lectin family, such as the CD94/NKG2 complex, a MHC class I receptor (18). The interaction between MHC class I molecules and CD94/NKG2 receptors down-modulates antigenic activation of {gamma}{delta} T cells by interfering with the TCR signaling cascade, thereby inhibiting {gamma}{delta} T cell proliferation and cytokine production in response to phosphorylated ligands (18, 19) and also controls their cytolytic activity against tumor and virus-infected cells (19, 20). In addition, we have shown that, following TCR activation, V{gamma}9V{delta}2 T cells express CD16, the low affinity receptor of the Fc portion of IgG (Fc{gamma}RIII) and its ligation triggers activation and production of TNF-{alpha} and IFN-{gamma} (21). More recently, Das et al. (22) showed that V{gamma}9V{delta}2 T cells also express NKG2D, and that its recruitment increases activation induced by the TCR and biological responses such as cytotoxic activity. In humans, one of the known ligands of NKG2D is MHC class I chain-related gene A/B (23), a MHC class I-like protein that is not expressed by most normal cells but is strongly up-regulated in many tumor cells, stressed cells, or infected cells (24, 25, 26). Taken together, these results demonstrate that V{gamma}9V{delta}2 T cells behave like T cells via their activation through the TCR/CD3 complex, and like NK cells, due to their activation by regulatory and stimulatory receptors. This double characteristic positions this cell subset at a unique place in the classical scheme of the immune response–at the interface between the innate and the acquired responses. So the question arises: are V{gamma}9V{delta}2 T cells primarily {alpha}{beta} T lymphocytes with characteristics of NK cells, or are they typically NK cells expressing a TCR?

It appears that the characteristics that link V{gamma}9V{delta}2 lymphocytes to either T cells or NK cells are based mostly on cell surface-expressed molecules or on functions directly related to specific surface molecules. Therefore, we explored the behavior of V{gamma}9V{delta}2 cells to determine when they are activated through a receptor that is common to {alpha}{beta} T cells and NK cells. To answer this question, we took advantage of the common expression of the IL-2R on the three types of cells, and its engagement which induces signaling pathways and biological responses that differ between NK and {alpha}{beta} T cells. Functional IL-2R is present on NK and activated T cells and is composed of three subunits: the {alpha}-chain (or CD25) responsible for IL-2 binding, and the {beta}- and {gamma}-chains responsible for transduction signals (reviewed in Refs.27, 28, 29). IL-2 stimulates the proliferation of both T cells and NK cells (29, 30). However, in NK cells, IL-2 has an additional effect of augmenting cytotoxic function and production of IFN-{gamma} (31, 32), and causing differences in the signaling pathways induced through IL-2R between NK and {alpha}{beta} T cells. The engagement of the IL-2R induces phosphorylation and activation of STAT3 and STAT5 in {alpha}{beta} T cells and NK cells (33, 34, 35), while phosphorylation/activation of STAT4 occurs only in NK cells (36). Concerning mitogen-activated protein (MAP) 3 kinases, extracellular signal-regulated kinase (ERK)-2 and p38 MAP kinase pathways are both activated in {alpha}{beta} T cells (reviewed in Refs. 27 and 37), whereas only the ERK2 pathway is triggered in NK cells (38). In this study, we have studied the signaling pathways triggered by the engagement of IL-2R in V{gamma}9V{delta}2 T cells, and have demonstrated that IL-2 not only activates STAT4, STAT3, and STAT5, as in NK cells, but also both the ERK2 and p38 MAP kinase pathways, as in {alpha}{beta} T cells. Finally, as observed in NK cells, IL-2 induces IFN-{gamma} production by V{gamma}9V{delta}2 T cells.

According to our results, it appears that V{gamma}9V{delta}2 T cells display characteristics of both NK and T cells, and thus confirms that they constitute a particular population located at the interface between the innate and the acquired immune response.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemicals and reagents

rIL-2 was purchased from Chiron (Emeryville, CA) and isopentenyl pyrophosphate (IPP) from Sigma-Aldrich (St. Louis, MO); anti-phospho-p42/44 MAP kinase Ab, anti-phospho-p38 MAP kinase Ab, anti-p38 MAP kinase Ab, anti-phospho-(Ser473) protein kinase B (PKB) Ab, and anti-PKB Ab were from Cell Signaling Technology (Beverly, MA). Anti-phosphotyrosine mAb (4G10) was from Upstate Biotechnology (New York, NY). Anti-ERK2 Ab, anti-Janus kinase 2 (Jak2), anti-tyrosine kinase 2 (Tyk2), and anti-STAT4 Ab were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-STAT1, anti-STAT3, and anti-STAT5 Abs were from BD Biosciences (San Jose, CA). Anti-phospho-STAT4 Ab was from Zymed Laboratories (South San Francisco, CA). Recombinant human IL-12 and IFN-{alpha} were from R&D Systems, (Minneapolis, MN). HRP-conjugated anti-mouse Ab and anti-rabbit Ab were from Amersham (Paris, France). UCHT1 (anti-CD3 mAb), anti-TCR V{gamma}9 mAb, and anti-pan TCR {alpha}{beta} mAb conjugated or not, were purchased from Beckman Coulter (Brea, CA).

Cell culture and stimulation

PBMC were isolated from the blood of healthy donors. Both {alpha}{beta} and V{gamma}9V{delta}2 T lymphocytes were purified by positive immunoselection using an anti-pan TCR {alpha}{beta} mAb or an anti-TCR V{delta}9 mAb, respectively, followed by the addition of magnetic beads coated with anti-mouse IgG (Dynal, Compiegne, France). NK cells were also purified from PBMC by positive immunoselection using magnetic beads coated with anti-CD56 Ab (Miltenyi Biotec, Paris, France). After this first step of purification, CD56+CD3+ cells were removed from CD56+ cells using an anti-CD3 Ab followed by the addition of magnetic beads coated with anti-mouse IgG. After purification, Cultured V{gamma}9V{delta}2 T cells, {alpha}{beta} T cells, and NK cells have a purity of >95%.

The high affinity receptor for IL-2 is not present on primary T cells and is only weakly present on NK cells. To induce the expression of CD25 and the formation of the high affinity receptor, T lymphocytes were activated through the TCR/CD3 complex by a treatment with anti-CD3 mAb (2 µg/ml) for {alpha}{beta} T cells and IPP (50 µM) for V{gamma}9V{delta}2 T cells in the presence of syngeneic monocytes. Although both activators are different, they activate T cells through the TCR/CD3 complex by the identical mechanisms. In a previous paper (21), we have shown that the signaling pathways induced by anti-CD3 Ab or IPP in V{gamma}9V{delta}2 T cells differ only in the delay and the length of signals not in biological responses that concern the expression of activation markers such as CD25 and CD69. To increase CD25 expression on NK cells, cells were treated with PMA (10 ng/ml) for 24 h. Then cells were maintained in RPMI 1640 supplemented with 5% FCS, 5% human AB serum, 2 mM glutamine, and rIL-2 (20 ng/ml) at 37°C in a 5% CO2 humidified atmosphere. Before stimulation, cells were quiesced by washing twice, and placed in RPMI 1640 with 10% FCS for 24 h in the absence of IL-2. Unless otherwise specified, cells (20 x 106/ml) were stimulated with either IL-2 (20 ng/ml), IL-12 (20 ng/ml), or IFN-{alpha} (103 U/ml) at indicated times.

Flow cytometry

The expression of CD25 was checked on different cell types. For this, 0.5 million cells were incubated with 10% human AB serum for 30 min to block nonspecific sites. Cells were then stained with 1 µg of FITC-conjugated anti-CD25 in PBS supplemented with 10% FCS, 0.02% NaN3, in a total volume of 50 µl. After incubating 30 min on ice, the cells were washed once, fixed in 1% paraformaldehyde, and analyzed on a FACSCalibur (BD Biosciences) with CellQuest software (BD Biosciences).

Total cell extract preparation and Western blot analysis

After stimulation, cells were lysed in 1 ml of lysis buffer containing 50 mM HEPES (pH 7.4), 150 mM NaCl, 10 mM NaF, 10 mM iodoacetamide, 1% Nonidet P-40 (NP40), 1 mM PMSF, 1 mM Na2VO3, and 1 µg/ml of each protease inhibitor (leupeptin, aprotinin, chymostatin). Proteins were concentrated by precipitation with 1.5 volumes of acetone. Proteins were separated by 7.5 or 10% SDS-PAGE depending on the proteins studied, then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA), and detected with the indicated Abs: anti-phospho-p38 MAP kinase Ab (1:1000), anti-p38 MAP kinase Ab (1:1000), anti-phospho-p42/44 MAP kinase Ab (1:1000), anti-ERK2 Ab (1:5000), anti-phospho-(Ser473) PKB Ab (1:1000), anti-PKB Ab (1:1000), anti-STAT4 (1:1000), anti-phospho-STAT4 (1:500), anti-STAT1 (1:1000), anti-STAT3 (1:1000), and anti-STAT5 (1:1000). Corresponding HRP-conjugated Abs were used and immunoreactive bands were visualized with the chemiluminescence Western blotting system (Amersham).

Affinity purification of DNA binding proteins

After activation, whole cell extracts were prepared by lysis of 20 x 106 cells/ml in a lysis buffer comprised of 50 mM Tris-HCl, pH 7.9, 1% NP40, 150 mM NaCl, 0.1 mM EDTA, 10 mM NaF, 1 mM Na2VO3, 1 mM PMSF, 1 mM DTT, 1 mg/ml aprotinin, 1 mg/ml leupeptin, 1 mg/ml chymostatin. The oligonucleotide sequences derived from the high affinity SIS-inducible element of the c-fos gene (SIEM67) GTCGACATTTCCCGTAAATC and the Fc{gamma}R-IFN-{gamma} activated sequence (GRR) GTATTTCCCAGAAAAGGAAC, were used to affinity purify DNA binding proteins. STAT3 and STAT5 are purified with the SIEM oligonucleotide, STAT4 with GRR and STAT1 with both SIEM and GRR. DNA binding proteins were isolated from whole cell extracts in the above buffer by incubation of cell lysates at 4°C for 1 h with 1 µg of double-stranded, 5' biotinylated oligonucleotide coupled to 30 µl of a 50% suspension of streptavidin agarose (Sigma-Aldrich). Complexes were washed twice in lysis buffer, and eluted by boiling in reducing sample buffer. Affinity purified proteins were further fractionated by SDS-PAGE, and transferred to PVDF membranes (Millipore). Western blot analysis was performed with Abs to STAT1 (1:2500), STAT3 (1:1000), STAT4 (1:1000), STAT5 (1:500), and corresponding HRP-conjugated Abs were used. Immunoreactive bands were visualized with the chemiluminescence Western blotting system (Amersham).

Immunoprecipitation of Jak2 and Tyk2

After stimulation, 20 x 106 cells were lysed in 1 ml of lysis buffer (see above). After cell lysis, Jak2 and Tyk2 were immunoprecipitated from clarified supernatants with 2 µg of anti-Jak2 Ab or Tyk2 Ab. Immune complexes were collected using protein A-Sepharose (Pharmacia, Uppsala, Sweden) and washed twice with lysing buffer before resuspending in 50 µl of reducing sample buffer. Purified proteins were further fractionated by SDS-PAGE, and transferred to PVDF membranes (Millipore). Western blot analysis was performed with 4G10 Ab (an anti-phosphotyrosine mAb) and corresponding HRP-conjugated Ab was used. Immunoreactive bands were visualized with the chemiluminescence Western blotting system (Amersham). To check the amount of immunoprecipitated Jak2 and Tyk2, membranes were stripped in 100 mM 2-ME, 2% SDS, 62.5 mM Tris (pH = 6.8) for 15 min at 50°C and then revealed with an anti-Jak2 Ab or anti-Tyk2 Ab.

Preparation of supernatants for measurement of IFN-{gamma} production

NK, {alpha}{beta}, and V{gamma}9V{delta}2 T cells (2 x 106 cells/ml) were cultured in 24-well tissue culture plates in RPMI 1640 supplemented with 10% FCS in a total volume of 0.5 ml per well. Cells were stimulated with rIL-2. At different times, supernatants were harvested and assayed for IFN-{gamma} using a human IFN-{gamma} kit (OptEIA set: human IFN-{gamma}; BD PharMingen, San Diego, CA) according to the manufacturer’s instructions.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of CD25 on V{gamma}9V{delta}2 T cells, {alpha}{beta} T cells, and NK cells

The high affinity IL-2R is composed of three subunits: the {alpha}-chain (or CD25) responsible for IL-2 binding and the {beta}- and {gamma}-chains responsible for transduction signals (reviewed in Refs.27, 28, 29). The high affinity IL-2R is not present on primary T cells and is only weakly present on NK cells because CD25 expression is low or absent. A strong expression of CD25 can be triggered after TCR/CD3 activation in T cells (39) and PMA treatment in NK cells (40). To explore the signaling pathways induced by IL-2 in V{gamma}9V{delta}2 T cells and to compare them with those of {alpha}{beta} T cells and NK cells, we used cells which express comparable levels of the high affinity chain of IL-2R. In Fig. 1, we have shown positive expression of CD25 in all three types of cells used in our experiments.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 1. Analysis of CD25 expression on V{gamma}9V{delta}2 T cells, {alpha}{beta} T cells, and NK cells. Different subsets of cells were stained with a FITC-conjugated anti-CD25 mAb and analyzed by flux cytometry. The analysis shown represents the data obtained for each subset of cells used in this study.

 
IL-2 triggers phosphorylation of STAT4 in V{gamma}9V{delta}2 T cells

Because it has been demonstrated that IL-2 signaling differs between NK cells and {alpha}{beta} T cells, particularly in STAT4 recruitment, we first analyzed the phosphorylation of STAT4 induced by IL-2 in CD25+V{gamma}9V{delta}2 T cells. Following incubation of the quiesced cells with IL-2, the phosphorylated form of STAT4 appeared on a SDS-PAGE gel as a band that exhibited slower migration compared with nonphosphorylated STAT4 protein, as seen in Fig. 2A. IL-12 was used as a positive control to induce STAT4 phosphorylation (41). To confirm that this slower migrating band corresponded to tyrosine phosphorylation of STAT4, we also used a phospho-STAT4 Ab that specifically recognizes the tyrosine phosphorylated form of STAT4 (Fig. 2B). IL-2 induced rapid (10 min) and sustained (30 min at least) phosphorylation of STAT4 in V{gamma}9V{delta}2 T cells, as has been previously described in NK cells (36).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 2. IL-2 triggers phosphorylation of STAT4 in V{gamma}9V{delta}2 T cells. V{gamma}9V{delta}2 T cells were activated by IL-2 or IL-12 at different times and then lysed. Total protein extracts were separated on a 7.5% SDS-PAGE and transferred to a PVDF membrane. An anti-STAT4 Ab (A) or an anti-phosphoSTAT4 Ab (B) was used for immunoblotting. Each experiment is representative of at least three experiments and each experiment was performed with cells from different donors.

 
IL-2 induced DNA binding of STAT4 in V{gamma}9V{delta}2 T cells and NK cells, but not in {alpha}{beta} T cells

Tyrosine phosphorylation, dimerization of phosphorylated forms, and nuclear translocation of STAT4 dimers are successive and obligatory steps required before binding to DNA and triggering transcriptional activity of STAT4. As we demonstrated that IL-2 induced tyrosine phosphorylation of STAT4, we also studied whether phosphorylation of STAT4 correlated with its potential transcriptional activity using DNA binding experiments. DNA binding of STAT4 was monitored by the use of biotinylated oligonucleotides comprising high affinity binding sites for STAT4 (GRR (GTATTTCCCAGAAAAGGAC)) to generate an affinity matrix to purify DNA binding STAT complexes from cell lysates. After activation of cells with IL-2 at the indicated times and lysing, GRR affinity purified proteins were fractionated by SDS-PAGE and subjected to Western blot analysis with a specific anti-STAT4 Ab. No STAT4 protein was detected in GRR complexes isolated from nonactivated cells of all three cell populations and IL-2-activated {alpha}{beta} T lymphocytes (Fig. 3). In contrast, an intense band was detected in complexes from all IL-12-activated cells (positive control) and IL-2-activated V{gamma}9V{delta}2 T and NK cells. The rapid (10 min) and sustained (60 min) phosphorylation and binding of STAT4 as well as the amount of STAT4 binding to DNA which is similar in IL-2- and IL-12-activated V{gamma}9V{delta}2 T cells, suggests that the activation of STAT4 might be a direct effect of IL-2, and not due to an indirect effect mediated through the autocrine secretion of STAT4-activating cytokines such as IL-12 or IFN-{alpha}.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 3. IL-2 induced DNA binding of STAT4 in V{gamma}9V{delta}2 T cells. Cells were activated, or not, by IL-2 or IL-12 at different times and then lysed. Affinity purification of DNA binding proteins was conducted with GRR oligonucleotides. Purified proteins were resolved on a 7.5% SDS-PAGE, transferred to a PVDF membrane, and observed by Western blot analysis using an anti-STAT4 Ab. This experiment is representative of three experiments and each experiment was performed with cells from different donors.

 
IL-2 activates Jak2, but not Tyk2, in V{gamma}9V{delta}2 T cells

Upon binding to their receptors, cytokines induce phosphorylation and activation of members of the Jak family, which leads to the recruitment and phosphorylation of STATs. Jak2 and/or Tyk2 are involved in the IL-12 and IFN-{alpha} signaling events that activate STAT4 in NK and {alpha}{beta} T cells (42) whereas only Jak2 is involved in STAT4 activation induced by IL-2 in NK cells (36). To investigate the role of Jak2 or Tyk2 in the activation of STAT4 in V{gamma}9V{delta}2 T cells, both kinases were immunoprecipitated from the lysates of cells that had been left untreated or treated with IL-2, IL-12, or IFN-{alpha}. The phosphorylation of Jak2 and Tyk2 was assayed by performing a Western blot with an anti-phosphotyrosine Ab (4G10). IL-2 induced an increase in phosphorylation of Jak2 (Fig. 4) but did not induce an increase in the basal phosphorylation of Tyk2 (Fig. 4). In contrast, IL-12 and IFN-{alpha} led to the activation of both Jak2 and Tyk2 kinases (Fig. 4). These data suggest that Jak2, but not Tyk2, may be involved in the activation of STAT4 in response to IL-2 in V{gamma}9V{delta}2 T cells. Moreover, as Tyk2 is activated by both IL-12 and IFN-{alpha} but not by IL-2, it allows us to exclude the possibility that IL-2 can trigger autocrine production of IL-12 or IFN-{alpha}, and therefore eliminates a potential role for both of these cytokines in IL-2-induced STAT4 activation.



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 4. IL-2 induces phosphorylation of Jak2, but not of Tyk2, in V{gamma}9V{delta}2 T cells. V{gamma}9V{delta}2 T cells were treated, or not, with the indicated cytokines at different times. Immunoprecipitation of Jak2 (upper panel) and Tyk2 (lower panel) was performed on whole cell extracts, and immunocomplexes were separated on a 7.5% SDS-PAGE, observed by Western blot analysis using an anti-phosphotyrosine Ab, and then stripped and blotted with anti-Jak2 Ab or anti-Tyk2 Ab to check the amount of loaded protein. Each experiment is representative of at least three experiments and each one was performed with cells from different donors.

 
Other STAT proteins activated by IL-2 in V{gamma}9V{delta}2 T cells

It was previously demonstrated that STAT proteins such as STAT3 and STAT5 are recruited and tyrosine phosphorylated upon IL-2 activation in both {alpha}{beta} cells and NK cells (33, 34, 35, 43). Phosphorylated forms of STAT3 and STAT5 can then dimerize, translocate to the nucleus, and bind DNA in the promoter region of STAT-regulated genes (44, 45). In a similar manner to that done for STAT4, we investigated DNA binding of STAT3 and STAT5 to biotinylated oligonucleotides comprising high affinity binding sites for STAT3 and STAT5 (SIEM) to generate an affinity matrix to purify DNA binding STAT complexes from cell lysates (46). Briefly, cells incubated with IL-2 for various times were SIEM affinity-purified, fractionated by SDS-PAGE, and analyzed by Western blot with a specific anti-STAT3 or anti-STAT5 Ab. No STAT3 or STAT5 proteins were detected in SIEM complexes isolated from nonactivated cells or IL-12-activated V{gamma}9V{delta}2 T lymphocytes (Fig. 5A). In contrast, an intense band was detected in complexes from IL-2-activated V{gamma}9V{delta}2 T cells at different time points. Previously published data concerning STAT1 recruitment upon IL-2 activation have yielded conflicting results. Some investigators have reported STAT1 activation in NK cells (47), but not in T cells (34, 48). In addition, in the cases where STAT1 activation was reported, it is very weak in comparison to that induced by IFN-{alpha}. The difference in the data could be explained by a difference in the sensitivity of experimental protocols and/or cells used. In our study, we have used an anti-phospho-STAT1 Ab that reacts specifically with the tyrosine phosphorylated forms of STAT1. Following incubation of cells at indicated times with IL-2, weak bands corresponding to the tyrosine phosphorylated form of STAT1 were observed by Western blot analysis in a few experiments (data not shown). In contrast, when we studied the DNA binding of STAT1 to specific biotinylated oligonucleotides, no STAT1 proteins were detected in either SIEM or GRR complexes isolated from nonactivated cells and IL-2-activated V{gamma}9V{delta}2 T lymphocytes (Fig. 5B). As a positive control for STAT1 tyrosine phosphorylation and DNA binding, STAT1 proteins were also isolated from V{gamma}9V{delta}2 T cells stimulated with IFN-{alpha}. To conclude, IL-2 activates STAT3 and STAT5 but not STAT1 in V{gamma}9V{delta}2 T cells.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. Other STAT proteins activated by IL-2 in V{gamma}9V{delta}2 T cells. V{gamma}9V{delta}2 T cells were activated, or not, by IL-2 at different times and then lysed. Affinity purification of DNA binding proteins was conducted with specific oligonucleotides (SIEM for STAT3 and STAT5, both GRR and SIEM for STAT1). Purified proteins were resolved on a 7.5% SDS-PAGE, transferred to a PVDF membrane, and observed by Western blot analysis using an anti-STAT3 Ab and an anti-STAT5 Ab (A) or anti-STAT1 (B). This experiment is representative of three experiments and each one was performed with cells from different donors.

 
Other signaling pathways triggered upon IL-2 activation in V{gamma}9V{delta}2 T cells

In addition to STAT activation, IL-2 also triggers activation of other signaling pathways such as the phosphatidylinositol 3-kinase (PI-3 kinase) or MAP kinase pathways (27, 37). Therefore, we analyzed these signaling pathways in response to IL-2 activation in {alpha}{beta} T lymphocytes, V{gamma}9V{delta}2 T lymphocytes, and NK cells. PI-3 kinase is an important kinase that can regulate survival responses through activation of PKB (also called Akt) in a variety of cell types, including lymphoid cells (49, 50). Also, it triggers the activation of S6-kinase, which then activates transcription factors that are involved in cell cycle control (51). To explore the activation of the PI-3 kinase pathway, we studied the phosphorylation of one of its substrates, PKB. After activation by IL-2, cells were lysed and proteins were resolved on SDS-PAGE and analyzed with an anti-phospho-PKB Ab that specifically recognizes the phosphorylated form of PKB. The Western blot analysis showed phosphorylation of PKB in all samples from IL-2-activated cells (Fig. 6A). Concerning MAP kinase pathways, it has been demonstrated that the ERK2 pathway is recruited by IL-2 in both NK and {alpha}{beta} T cells (38, 52). Using a specific Ab which recognizes the phosphorylated and active forms of ERK1 and ERK2, we confirmed that IL-2 activates this pathway in NK and {alpha}{beta} T cells and we demonstrated that it was also activated in V{gamma}9V{delta}2 T cells (Fig. 6B). More recently, it was shown that IL-2 activates the p38 kinase pathway in {alpha}{beta} T cells (53) but not in NK cells (38). Using a specific Ab which only interacts with the phosphorylated form of p38 kinase, we confirmed that IL-2 activates this pathway in {alpha}{beta} T cells and not in NK cells. Additionally, we showed that p38 can also be recruited and activated in V{gamma}9V{delta}2 T cells (Fig. 6C). Contrary to the results obtained with STAT4, IL-2-activated V{gamma}9V{delta}2 T cells behave like {alpha}{beta} T cells with regard to MAP kinase activation.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 6. Other signaling pathways induced by IL-2 in V{gamma}9V{delta}2 T cells. Cells were incubated, or not, with IL-2 at the times indicated and then lysed. Total protein extracts were separated on 10% SDS-PAGE, transferred to a PVDF membrane, and observed by Western blot analysis using an anti-phospho-PKB Ab followed by an anti-PKB Ab (A), an anti-phospho-p42/p44 MAP Ab followed by an anti-ERK2 Ab (B) or an anti-phospho p38 Ab followed by an anti-p38 Ab (C). Each experiment is representative of at least three experiments and each one was performed with cells from different donors.

 
IL-2 induces IFN-{gamma} production in V{gamma}9V{delta}2 T cells

IL-2 is a cytokine with pleiotropic effects and is required for proliferation and activation of many cell types, including T and NK cells (29, 30). However, in NK cells, IL-2 has the additional effect of augmenting cytotoxic function and IFN-{gamma} production as seen with IL-12 (31, 32). It was shown that STAT4 plays a role in IFN-{gamma} production by regulating multiple components of IFN-{gamma}-inducing signaling pathways. As STAT4 is activated by IL-2 in V{gamma}9V{delta}2 T cells, we wondered whether IFN-{gamma} production could be induced by IL-2 as is the case in NK cells. Therefore, we investigated the production of IFN-{gamma} triggered by IL-2 in NK cells, {alpha}{beta} T cells, and V{gamma}9V{delta}2 T cells. We observed that IL-2 alone induces IFN-{gamma} production in both V{gamma}9V{delta}2 T and NK cells but not in {alpha}{beta} T cells (Fig. 7). For {alpha}{beta} T cells, we demonstrated that a combination of anti-CD3 Ab and anti-CD28 Ab induces IFN-{gamma} production, which is potentiated by IL-2 (data not shown). Therefore, in terms of IFN-{gamma} production, V{gamma}9V{delta}2 T cells behave more like NK cells than like {alpha}{beta} T cells because they can produce IFN-{gamma} upon IL-2 activation without the requirement of a cosignal.



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 7. Measurements of IFN-{gamma} production in V{gamma}9V{delta}2 T cells. Cells (2 x 106/ml) were incubated with IL-2, or not, for 6 h and then IFN-{gamma} production was measured in the supernatants. This experiment is representative of two experiments that were performed with cells from different donors.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The aim of this study was to understand where V{gamma}9V{delta}2 T cells play a role in the immune system, and to answer the question: are V{gamma}9V{delta}2 T cells primarily T lymphocytes with characteristics of NK cells, or are they typical NK cells expressing a TCR?

To address this question we took advantage of: 1) the expression of the IL-2R on all three cell types following activation, and 2) the fact that engagement of the IL-2R by IL-2, can exert distinct effects on diverse cell populations, such as NK cells and {alpha}{beta} T cells. IL-2 can induce a variety of intracellular events in T cells and NK cells, some of which overlap (such as those controlling proliferation and survival) (29, 30), and some of which are distinct (such as those controlling cytotoxicity and cytokine production) (31, 32). In the present paper, we have studied IL-2-triggered signaling in V{gamma}9V{delta}2 T cells and have shown that in these cells, the pattern of IL-2-induced signaling is a combination of NK and {alpha}{beta} T cell profiles.

One of major signaling pathways triggered by cytokines or growth factors is the Jak/STAT pathway. The STAT family of transcription factors appear to play an important role in mediating gene activation by most hemopoietic and many nonhemopoietic cytokines, growth factors, and neurotrophic factors (44). Some members, such as STAT1, STAT3, and STAT5, are activated in numerous cell types by a wide variety of cytokines. These proteins may be involved in mediating more general types of signals, such as those for cell growth and survival. Others, including STAT4, are more restricted in their expression and are activated in response to a very small number of factors. This may reflect a more specialized role of these STATs. Notably, studies using STAT4-deficient mice have demonstrated that STAT4 is essential for IL-12 signaling and moreover, that Th1 development is severely impaired in these mice (54). More recently, Wang et al. (36) have shown that STAT4 is activated by IL-2 in NK cells and proposed that, in these cells, activation of STAT4 may control cytotoxic activity induced by IL-2. This cell type restriction of STAT activation is an attractive model for increasing the diversity of cellular responses induced by a given cytokine.

We showed that IL-2 induces tyrosine phosphorylation and DNA binding of STAT4 in V{gamma}9V{delta}2 T cells and in NK cells, but not in {alpha}{beta} T cells. To determine whether STAT4 activation is a major or marginal event induced by IL-2 in V{gamma}9V{delta}2 T cells, we included two well-characterized and potent stimulators of STAT4 in the experiments, IL-12 and IFN-{alpha} (55). The level of STAT4 activation induced by IL-2 appears similar to those induced by IL-12 (Fig. 3) or IFN-{alpha} activation (data not shown). Also, we checked the ability of STAT4 to be activated in the three cell types by comparing STAT4 activation induced by IL-12 and found that the level of STAT4 activation is similar in NK, {alpha}{beta} T, and V{gamma}9V{delta}2 T cells. Overall, we conclude that STAT4 activation is not a marginal, but is a major event triggered by IL-2 in V{gamma}9V{delta}2 T cells.

To determine the mechanism by which IL-2 induces STAT4 activation in V{gamma}9V{delta}2 T cells, we examined the activation of Jak family members in response to IL-2 in these cells. IL-2 is known to induce the activation of Jak1 and Jak3 in all responder cells (34, 37), while STAT4 activation has been shown to involve Jak2 and/or Tyk2, depending on the type of activation and cell type (36, 42). In V{gamma}9V{delta}2 T cells, we have shown that IL-2 induced phosphorylation and activation of Jak2, but not of Tyk2, whereas IL-12 and IFN-{alpha} activated both proteins in these T cells. Because Tyk2 is not activated by IL-2, we can exclude the hypothesis that the activation of STAT4 was the consequence of IL-12 and/or IFN-{alpha} production, which may be produced and released following IL-2 treatment.

These results appear inconsistent as IL-2 induces activation of Jak2 and STAT4 in NK cells and V{gamma}9V{delta}2 T cells, but not in {alpha}{beta} T cells even though both of these proteins are expressed in all three cell types. The mechanism by which activation of Jak2 and STAT4 occurs has not been determined. One hypothesis is that as CD25, the high affinity chain of IL-2, is localized in the microdomains of the plasma membrane (56), the proteins present or close to these structures, could be different depending on the cell types. These proteins present in the microdomains could be receptors or molecules responsible for signaling transduction. Particularly, other cytokine receptors, which share one or more chains with IL-2R, could be present and would allow IL-2 to trigger at least some of the signaling events induced by other cytokines (IL-12 and IFN-{alpha}). Also, there are other mechanisms responsible for the recruitment of Jak2 and/or STAT4 to IL-2R complexes. For example, a novel docking protein such as signal transducing adaptor molecule, whose expression is dependent on cell type, might allow the recruitment of these molecules to the IL-2R in NK and V{gamma}9V{delta}2 T cells, but not in {alpha}{beta} T cells. Therefore, the variations in Jak2 activation could be due to differences in the proteins found in the microdomains.

In regard to other STAT proteins, IL-2 has been reported to induce tyrosine phosphorylation and activation of STAT3 and STAT5 in both T cells and NK cells (36, 42). We confirmed that STAT3 and STAT5 are also activated by IL-2 in V{gamma}9V{delta}2 T cells. For STAT1, the results from different studies are conflicting. Generally, IL-2-triggered activation of STAT1 has not been reported in purified peripheral blood T cells nor in T cell lines (36, 42). More recently, Yu et al. (47) provided evidence that in preactivated primary NK cells and NK cell lines, IL-2 triggers phosphorylation and activation of STAT1. However, they showed that IL-2 predominantly activated STAT5, whereas STAT1 activation appeared as a minor phenomenon, and was primarily activated by IFN-{alpha}. In V{gamma}9V{delta}2 T cells, we demonstrated (using an anti-phopho-STAT1 Ab) that IL-2 induces a weak tyrosine phosphorylation of STAT1 in comparison to IFN-{alpha} (data not shown), but we could not detect any DNA binding and, therefore, no activation of STAT1. Our results and other reported data (36, 42, 47) suggest that even if STAT1 is phosphorylated and activated by IL-2, it represents a minor event. In regard to the IL-2-induced STAT pathway, our findings show that V{gamma}9V{delta}2 T cells resemble or behave as NK cells.

In addition to the Jak/STAT pathway activation, the recruitment of IL-2R triggers a series of intracellular signaling pathways including the PI-3 kinase and MAP kinase pathways. It has been reported that the activation of PI-3 kinase is necessary for the IL-2-induced growth and differentiation (27, 37). Also, it has been established that IL-2 activates PKB (also called Akt) by a PI-3 kinase-dependent pathway (57) and that PKB can regulate survival responses in a variety of cell types (49, 50). PI-3 kinase, through other effectors such as E2F, couples IL-2R to cell cycle regulation (51). In V{gamma}9V{delta}2 T cells, we have shown that IL-2 activates the PI-3 kinase pathway. Thus, the activation of this pathway may influence the regulation of cell cycle progression and survival in these cells.

In activated primary T cells and T cell lines, both ERK and p38 MAP kinase pathways are activated by IL-2 (27, 37). More recently, Yu et al. (38) have demonstrated that, in NK cells, IL-2 activates the ERK2 pathway but not the p38 kinase pathway. Considering that V{gamma}9V{delta}2 T cells resemble NK cells more than {alpha}{beta} T cells with regard to the IL-2-induced STAT pathway, we then studied how V{gamma}9V{delta}2 T cells behave in relation to MAP kinase activation. We demonstrated that both kinase pathways (p38 and ERK2) were triggered by IL-2 in V{gamma}9V{delta}2 T cells. These findings, and data from other published reports (38, 52, 58), suggest that the ERK2 pathway is activated in all types of IL-2 responder cells, but activation of the p38 pathway is limited to cells of the T cell lineage. The p38 pathway is involved in IL-2 induction of the TNF-{beta} gene in T cells (59), suggesting that the activation of p38 by IL-2 in V{gamma}9V{delta}2 T cells could be responsible for specific biological responses such as the production of cytokines. These results indicate that V{gamma}9V{delta}2 T cells resemble or behave as {alpha}{beta} T cells concerning the activation of MAP kinase pathways by IL-2. However, most of the reported results on IL-2 signaling in {alpha}{beta} T cells, and our own data, have been obtained with total {alpha}{beta} T cells without separation of the two subsets, CD4 and CD8. The IL-2 signaling pathways could be general mechanisms or they could reflect the signaling pathways of only one subset of {alpha}{beta} T cells. It is well-documented that there are signaling differences between CD4+ and CD8+ T cells, in particularly signaling mechanisms triggered through CD4 or CD8 molecules (60). In our experiments, the {alpha}{beta} T cell population has been purified from blood and represents a mixture of CD4+/CD8+ T cells that corresponds to the ratio found in the peripheral blood where the CD4+ population is higher than the CD8+ population. Our results and other studies (36) show that STAT4 activation is not induced by IL-2 in the total population of {alpha}{beta} T cells from which we can conclude that IL-2 does not activate STAT4 in CD4 nor in CD8 T cells. In contrast, as we have used a total population of {alpha}{beta} T cells, we cannot assume that p38 MAP kinase is activated by IL-2 in the both T cell subsets rather being activated primarily in one subset over another. Furthermore, to our knowledge, no studies have demonstrated differences in IL-2-induced signaling between CD4 and CD8 T cells.

The functions and biological responses of NK cells are regulated by the integration of signals from inhibitory and activating receptors. The receptors on resting NK cells can be constitutively expressed (CD16) (61), up-regulated (CD25) (40), or induced (CD69) (62) after activation. It has been demonstrated that depending on which activating receptor is recruited, the induced biological responses are different. For example, the recruitment of the KIR2DL4 receptor (CD158d) on resting T cells triggers IFN-{gamma} production but not cytotoxicity (63). The recruitment of CD69 to the surface of NK cells, triggers cytotoxic activity and cytokine production (40). The cross-linking of CD16 molecules on the NK cell surface, triggers Ab-dependent cellular cytotoxicity (ADCC) and cytokine production (64). The recruitment of IL-2R on NK cells, triggers IFN-{gamma} production, cytotoxic activity, and cell proliferation (31, 32). Therefore, IL-2 activation of NK cells does not only lead to the induction of regulatory processes but is also involved in NK cell activation of effector processes. Thus, NK cell activation by IL-2 may be different from activation by other NK cell stimuli. It has been suggested that the activation of STAT4 could be involved in these biological responses because in one regard, STAT4 regulates the expression of the perforin gene (65, 66) and in contrast, it regulates multiple components of signaling pathways resulting in the expression of the IFN-{gamma} gene (67). In this study, IL-2 induces activation of STAT4 and also triggers the production of IFN-{gamma} in V{gamma}9V{delta}2 T cells. This suggests that STAT4 activation may regulate the mechanisms leading to the production of IFN-{gamma} and cytotoxic activity. Thus, IL-2 might trigger biological responses other than proliferation via STAT4 activation which could regulate both anti-infectious and anti-tumoral activity of V{gamma}9V{delta}2 T cells. In the first phase of infection, nonpeptidic Ags such as IPP, which are produced by the metabolism of intracellular pathogens, recruit and activate V{gamma}9V{delta}2 T cells. This activation triggers a series of biological responses, such as the expression of surface molecules, CD25 and CD69 (68). Following this, CD25+V{gamma}9V{delta}2 T cells would then be stimulated by IL-2 to proliferate and produce IFN-{gamma}. This cytokine production would then influence the development of specific immunity to a Th1 response, favoring the elimination of intracellular pathogens. Interestingly, Ags present on tumoral cells are recognized and activate V{gamma}9V{delta}2 T cells that trigger biological responses and expression of surface molecules (CD25 and CD69). As previously described, CD25+V{gamma}9V{delta}2 T cells are recruited by IL-2 to produce cytokines and develop cytotoxic activity against tumoral cells. The direct activation of V{gamma}9V{delta}2 T cells by unprocessed and nonpresented Ag in addition to the ability of their effector functions to be induced by IL-2 alone, gives them a considerable advantage over {alpha}{beta} T cells. Thus, V{gamma}9V{delta}2 T cells respond early to stimuli leading to a broader range of functions whereas {alpha}{beta} T cells are activated later in immune response and have specific functions.

Moreover, recent data have shown that V{gamma}9V{delta}2 T cells not only influence the acquired response, but also directly play a part as an effector of this response (69). Many studies from different teams (3, 70) as well as our own results (21), have shown that V{gamma}9V{delta}2 T cells possess many specific characteristics of both NK cells and {alpha}{beta} T cells. Functionally, it is now clear that they play a role in both phases of the immune response (innate and acquired). With regard to their intimate IL-2-triggered mechanisms, V{gamma}9V{delta}2 T cells cumulate properties of NK cells and {alpha}{beta} T cells. Overall, these functional and mechanistic characteristics suggest that V{gamma}9V{delta}2 T cells might be prototypic T cells that have evolved and diverged into two distinct subsets of cells: NK and {alpha}{beta} T cells.


    Acknowledgments
 
We acknowledge Dr. Jane Oliaro for critical reading of the manuscript.


    Footnotes
 
1 This work was supported in part by European Commission Grant QLK2–1999-0014, Ecos-Anuies Program (Franco-Mexico) Grant PM990S01, and the Société de Secours des Amis des Sciences. Back

2 Address correspondence and reprint requests to Dr. Virginie Lafont, Microbiologie et Pathologie Cellulaire Infectieuse, Institut National de la Santé et de la Recherche Médicale Unité 431, Université de Montpellier II, Place Eugene Bataillon, CC 100, 34095 Montpellier Cedex 05, France. E-mail address: vlafont{at}crit.univ-montp2.fr Back

3 Abbreviations used in this paper: MAP, mitogen-activated protein; ERK, extracellular signal-regulated kinase; IPP, isopentenyl pyrophosphate; PKB, protein kinase B; Jak, Janus kinase; Tyk, tyrosine kinase; PVDF, polyvinylidene difluoride; PI-3 kinase, phosphatidylinositol 3-kinase. Back

Received for publication May 7, 2003. Accepted for publication September 12, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kabelitz, D., D. Wesch, T. Hinz. 1999. {gamma}{delta} T cells, their T cell receptor usage and role in human diseases. Springer Semin. Immunopathol. 21:55.[Medline]
  2. Battistini, L., G. Borsellino, G. Sawicki, F. Poccia, M. Salvetti, G. Ristori, C. F. Brosnan. 1997. Phenotypic and cytokine analysis of human peripheral blood {gamma}{delta} T cells expressing NK cell receptors. J. Immunol. 159:3723.[Abstract]
  3. De Libero, G.. 1999. Control of {gamma}{delta} T cells by NK receptors. Microbes Infect. 1:263.[Medline]
  4. Kabelitz, D., A. Glatzel, D. Wesch. 2000. Antigen recognition by human {gamma}{delta} T lymphocytes. Int. Arch. Allergy Immunol. 122:1.[Medline]
  5. Constant, P., F. Davodeau, M. A. Peyrat, Y. Poquet, G. Puzo, M. Bonneville, J. J. Fournie. 1994. Stimulation of human {gamma}{delta} T cells by nonpeptidic mycobacterial ligands. Science 264:267.[Abstract/Free Full Text]
  6. Tanaka, Y., S. Sano, E. Nieves, G. De Libero, D. Rosa, R. L. Modlin, M. B. Brenner, B. R. Bloom, C. T. Morita. 1994. Nonpeptide ligands for human {gamma}{delta} T cells. Proc. Natl. Acad. Sci. USA 91:8175.[Abstract/Free Full Text]
  7. Ottones, F., J. Liautard, A. Gross, F. Rabenoelina, J. P. Liautard, J. Favero. 2000. Activation of human V{gamma}9V{delta}2 T cells by a Brucella suis non-peptidic fraction impairs bacterial intracellular multiplication in monocytic infected cells. Immunology 100:252.[Medline]
  8. Feurle, J., E. Espinosa, S. Eckstein, F. Pont, V. Kunzmann, J. J. Fournie, M. Herderich, M. Wilhelm. 2002. Escherichia coli produces phosphoantigens activating human {gamma}{delta} T cells. J. Biol. Chem. 277:148.[Abstract/Free Full Text]
  9. Behr, C., R. Poupot, M. A. Peyrat, Y. Poquet, P. Constant, P. Dubois, M. Bonneville, J. J. Fournie. 1996. Plasmodium falciparum stimuli for human {gamma}{delta} T cells are related to phosphorylated antigens of mycobacteria. Infect. Immun. 64:2892.[Abstract]
  10. Tanaka, Y., C. T. Morita, E. Nieves, M. B. Brenner, B. R. Bloom. 1995. Natural and synthetic non-peptide antigens recognized by human {gamma}{delta} T cells. Nature 375:155.[Medline]
  11. Bukowski, J. F., C. T. Morita, Y. Tanaka, B. R. Bloom, M. B. Brenner, H. Band. 1995. V{gamma}2V{delta}2 TCR-dependent recognition of non-peptide antigens and Daudi cells analyzed by TCR gene transfer. J. Immunol. 154:998.[Abstract]
  12. Lafont, V., J. Liautard, A. Gross, J. P. Liautard, J. Favero. 2000. Tumor necrosis factor-{alpha} production is differently regulated in {gamma}{delta} and {alpha}{beta} human T lymphocytes. J. Biol. Chem. 275:19282.[Abstract/Free Full Text]
  13. Garcia, V. E., P. A. Sieling, J. Gong, P. F. Barnes, K. Uyemura, Y. Tanaka, B. R. Bloom, C. T. Morita, R. L. Modlin. 1997. Single-cell cytokine analysis of {gamma}{delta} T cell responses to nonpeptide mycobacterial antigens. J. Immunol. 159:1328.[Abstract]
  14. Lang, F., M. A. Peyrat, P. Constant, F. Davodeau, J. David-Ameline, Y. Poquet, H. Vie, J. J. Fournie, M. Bonneville. 1995. Early activation of human V{gamma}9V{delta}2 T cell broad cytotoxicity and TNF production by nonpeptidic mycobacterial ligands. J. Immunol. 154:5986.[Abstract]
  15. Sicard, H., T. Al Saati, G. Delsol, J. J. Fournie. 2001. Synthetic phosphoantigens enhance human V{gamma}9V{delta}2 T lymphocytes killing of non-Hodgkin’s B lymphoma. Mol. Med. 7:711.[Medline]
  16. Ottones, F., J. Dornand, A. Naroeni, J. P. Liautard, J. Favero. 2000. V{gamma}9V{delta}2 T cells impair intracellular multiplication of Brucella suis in autologous monocytes through soluble factor release and contact-dependent cytotoxic effect. J. Immunol. 165:7133.[Abstract/Free Full Text]
  17. Dieli, F., M. Troye-Blomberg, J. Ivanyi, J. J. Fournie, M. Bonneville, M. A. Peyrat, G. Sireci, A. Salerno. 2000. V{gamma}9/V{delta}2 T lymphocytes reduce the viability of intracellular Mycobacterium tuberculosis. Eur. J. Immunol. 30:1512.[Medline]
  18. Carena, I., A. Shamshiev, A. Donda, M. Colonna, G. D. Libero. 1997. Major histocompatibility complex class I molecules modulate activation threshold and early signaling of T cell antigen receptor-{gamma}/{delta} stimulated by nonpeptidic ligands. J. Exp. Med. 186:1769.[Abstract/Free Full Text]
  19. Halary, F., M. A. Peyrat, E. Champagne, M. Lopez-Botet, A. Moretta, L. Moretta, H. Vie, J. J. Fournie, M. Bonneville. 1997. Control of self-reactive cytotoxic T lymphocytes expressing {gamma}{delta} T cell receptors by natural killer inhibitory receptors. Eur. J. Immunol. 27:2812.[Medline]
  20. Poccia, F., B. Cipriani, S. Vendetti, V. Colizzi, Y. Poquet, L. Battistini, M. Lopez-Botet, J. J. Fournie, M. L. Gougeon. 1997. CD94/NKG2 inhibitory receptor complex modulates both anti-viral and anti-tumoral responses of polyclonal phosphoantigen-reactive V{gamma}9V{delta}2 T lymphocytes. J. Immunol. 159:6009.[Abstract]
  21. Lafont, V., J. Liautard, J. P. Liautard, J. Favero. 2001. Production of TNF-{alpha} by human V{gamma}9V{delta}2 T cells via engagement of Fc{gamma}RIIIA, the low affinity type 3 receptor for the Fc portion of IgG, expressed upon TCR activation by nonpeptidic antigen. J. Immunol. 166:7190.[Abstract/Free Full Text]
  22. Das, H., V. Groh, C. Kuijl, M. Sugita, C. T. Morita, T. Spies, J. F. Bukowski. 2001. MICA engagement by human V{gamma}2V{delta}2 T cells enhances their antigen-dependent effector function. Immunity 15:83.[Medline]
  23. Bauer, S., V. Groh, J. Wu, A. Steinle, J. H. Phillips, L. L. Lanier, T. Spies. 1999. Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science 285:727.[Abstract/Free Full Text]
  24. Groh, V., R. Rhinehart, H. Secrist, S. Bauer, K. H. Grabstein, T. Spies. 1999. Broad tumor-associated expression and recognition by tumor-derived {gamma}{delta} T cells of MICA and MICB. Proc. Natl. Acad. Sci. USA 96:6879.[Abstract/Free Full Text]
  25. Tieng, V., C. Le Bouguenec, L. du Merle, P. Bertheau, P. Desreumaux, A. Janin, D. Charron, A. Toubert. 2002. Binding of Escherichia coli adhesin AfaE to CD55 triggers cell-surface expression of the MHC class I-related molecule MICA. Proc. Natl. Acad. Sci. USA 99:2977.[Abstract/Free Full Text]
  26. Groh, V., R. Rhinehart, J. Randolph-Habecker, M. S. Topp, S. R. Riddell, T. Spies. 2001. Costimulation of CD8{alpha}{beta} T cells by NKG2D via engagement by MIC induced on virus-infected cells. Nat. Immunol. 2:255.[Medline]
  27. Ellery, J. M., P. J. Nicholls. 2002. Alternate signalling pathways from the interleukin-2 receptor. Cytokine Growth Factor Rev. 13:27.[Medline]
  28. Nelson, B. H., D. M. Willerford. 1998. Biology of the interleukin-2 receptor. Adv. Immunol. 70:1.[Medline]
  29. Theze, J., P. M. Alzari, J. Bertoglio. 1996. Interleukin 2 and its receptors: recent advances and new immunological functions. Immunol. Today 17:481.[Medline]
  30. Smith, K. A.. 1992. Interleukin-2. Curr. Opin. Immunol. 4:271.[Medline]
  31. Baume, D. M., M. J. Robertson, H. Levine, T. J. Manley, P. W. Schow, J. Ritz. 1992. Differential responses to interleukin 2 define functionally distinct subsets of human natural killer cells. Eur. J. Immunol. 22:1.[Medline]
  32. Bonnema, J. D., K. A. Rivlin, A. T. Ting, R. A. Schoon, R. T. Abraham, P. J. Leibson. 1994. Cytokine-enhanced NK cell-mediated cytotoxicity: positive modulatory effects of IL-2 and IL-12 on stimulus-dependent granule exocytosis. J. Immunol. 152:2098.[Abstract]
  33. Frank, D. A., M. J. Robertson, A. Bonni, J. Ritz, M. E. Greenberg. 1995. Interleukin 2 signaling involves the phosphorylation of Stat proteins. Proc. Natl. Acad. Sci. USA 92:7779.[Abstract/Free Full Text]
  34. Beadling, C., D. Guschin, B. A. Witthuhn, A. Ziemiecki, J. N. Ihle, I. M. Kerr, D. A. Cantrell. 1994. Activation of JAK kinases and STAT proteins by interleukin-2 and interferon {alpha}, but not the T cell antigen receptor, in human T lymphocytes. EMBO J. 13:5605.[Medline]
  35. Johnston, J. A., C. M. Bacon, D. S. Finbloom, R. C. Rees, D. Kaplan, K. Shibuya, J. R. Ortaldo, S. Gupta, Y. Q. Chen, J. D. Giri, et al 1995. Tyrosine phosphorylation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and 15. Proc. Natl. Acad. Sci. USA 92:8705.[Abstract/Free Full Text]
  36. Wang, K. S., J. Ritz, D. A. Frank. 1999. IL-2 induces STAT4 activation in primary NK cells and NK cell lines, but not in T cells. J. Immunol. 162:299.[Abstract/Free Full Text]
  37. Lin, J. X., W. J. Leonard. 1997. Signaling from the IL-2 receptor to the nucleus. Cytokine Growth Factor Rev. 8:313.[Medline]
  38. Yu, T. K., E. G. Caudell, C. Smid, E. A. Grimm. 2000. IL-2 activation of NK cells: involvement of MKK1/2/ERK but not p38 kinase pathway. J. Immunol. 164:6244.[Abstract/Free Full Text]
  39. Moire, N., C. F. Calvo, D. Metivier, J. Y. Perrot, C. Vaquero, M. Hatakeyama, A. Senik. 1990. Role of interleukin 2 receptor {beta} chain in initiating anti-CD3 and interleukin 2-induced proliferation of human resting T cells. Eur. J. Immunol. 20:1981.[Medline]
  40. Borrego, F., M. J. Robertson, J. Ritz, J. Pena, R. Solana. 1999. CD69 is a stimulatory receptor for natural killer cell and its cytotoxic effect is blocked by CD94 inhibitory receptor. Immunology 97:159.[Medline]
  41. Bacon, C. M., E. F. Petricoin, 3rd, J. R. Ortaldo, R. C. Rees, A. C. Larner, J. A. Johnston, J. J. O’Shea. 1995. Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes. Proc. Natl. Acad. Sci. USA 92:7307.[Abstract/Free Full Text]
  42. Bacon, C. M., D. W. McVicar, J. R. Ortaldo, R. C. Rees, J. J. O’Shea, J. A. Johnston. 1995. Interleukin 12 (IL-12) induces tyrosine phosphorylation of JAK2 and TYK2: differential use of Janus family tyrosine kinases by IL-2 and IL-12. J. Exp. Med. 181:399.[Abstract/Free Full Text]
  43. Hou, J., U. Schindler, W. J. Henzel, S. C. Wong, S. L. McKnight. 1995. Identification and purification of human Stat proteins activated in response to interleukin-2. Immunity 2:321.