|
|
||||||||


* Department of Pathology and Laboratory Medicine, Weill Medical College of Cornell University, New York, NY 10021;
Department of Microbiology and Immunology and Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC 27599; and
Center for Immunology, University of California, Irvine, CA 92697
| Abstract |
|---|
|
|
|---|
, C
, and C
genes through latent membrane protein 1 (LMP1), a CD40-like viral protein that signals in a ligand-independent fashion. LMP1-induced CSR is associated with transcriptional activation of germline C
, C
, and C
genes and triggers the up-regulation of activation-induced cytidine deaminase, a crucial component of the CSR machinery. In addition, LMP1 induces B cells to express B cell-activating factor of the TNF family and a proliferation-inducing ligand, two molecules that mediate B cell survival and T cell-independent Ab production. B cell-activating factor of the TNF family and a proliferation-inducing ligand cooperate with LMP1 to induce Ig class switching because their neutralization by appropriate soluble decoy receptors attenuates CSR in LMP1-expressing B cells. By showing that LMP1 triggers T cell-independent CSR, our findings suggest that EBV could play an important role in the pathogenesis of disorders with aberrant IgG, IgA, and/or IgE production. | Introduction |
|---|
|
|
|---|
, S
, or S
region 5' of C
, C
, and C
, respectively (2). Most Ags, including complex viral and bacterial proteins, induce CSR by up-regulating CD40 ligand (CD40L) on CD4+ T cells (3). Engagement of CD40 on IgD+ naive B cells by CD40L triggers NF-
B-dependent transcriptional activation of IH gene promoters that are located 5' of each S region and encompass a noncoding IH exon (2). The resulting germline IH-CH transcription increases the accessibility of the targeted S region to the CSR machinery. This enzymatic complex includes activation-induced cytidine deaminase (AID), a B cell-specific and CD40-inducible enzyme that induces CSR through an as-yet-elusive mechanism (2, 4).
T cell-dependent (TD) Ags trigger CD40-dependent CSR in B cells located within the germinal center (GC) of secondary lymphoid follicles (5, 6). These GC B cells subsequently differentiate to long-lived IgD- memory B cells or Ab-secreting plasma cells (7, 8). T cell-independent (TI) Ags, such as viral glycoproteins and bacterial polysaccharides, elicit CD40-independent CSR and Ab production in extrafollicular marginal zone and intestinal B cells (9, 10, 11). This process requires B cell-activating factor of the TNF family (BAFF; also known as B lymphocyte stimulator) and a proliferation-inducing ligand (APRIL) (12, 13, 14, 15, 16), two CD40L-related molecules produced by myeloid cells (17, 18, 19). BAFF binds to three receptors specifically expressed on B cells, including transmembrane activator and calcium modulator and cyclophylin ligand interactor (TACI), B cell maturation Ag (BCMA), and BAFF-R (also known as BR3) (20, 21, 22). In addition to favoring Ab production, BAFF-R delivers survival signals that are crucial for the conservation of the peripheral B cell repertoire (23, 24). Unlike BAFF, APRIL binds to TACI and BCMA, but not BAFF-R (25, 26). Similarly to CD40 (3), TACI, BCMA, and BAFF-R signal by recruiting TNFR-associated factors (TRAFs) to their cytoplasmic tails (24). By activating I
B kinase, TRAFs induce phosphorylation-dependent degradation of I
B, a cytoplasmic inhibitor of NF-
B (27, 28). The subsequent nuclear translocation of NF-
B transcriptionally activates genes involved in B cell proliferation, differentiation, and survival (29).
Dysregulated switching to IgG and IgA is central to the pathogenesis of autoimmune disorders such as systemic lupus erythematosus (SLE) (30), whereas aberrant switching to IgE underlies the pathogenesis of atopic disorders such as allergic asthma and atopic dermatitis (31). Both autoimmunity and atopy can be triggered or exacerbated by viral infections, including EBV infection (32, 33, 34). EBV is a B lymphotropic herpes virus that infects >90% of the human population during the first years of life (35). EBV infection is usually asymptomatic, because most EBV-containing B cells are eliminated by CD8+ CTLs (36). However, a few latently infected B cells persist for the lifetime (36). In some predisposed subjects, latent EBV infection would favor production of IgG and IgA autoantibodies (37, 38). Abnormal switching to IgG, IgA, and IgE can be also observed in adolescents with infectious mononucleosis, a self-limiting lymphoproliferative disorder secondary to acute EBV infection (34), as well as in immunocompromised subjects with EBV-associated B cell lymphoproliferative disorders (39, 40, 41). It is unclear how EBV dysregulates the Ab response.
In the initial phase of the infection, EBV drives tonsillar IgD+ naive B cells to undergo extrafollicular activation and proliferation through three latent membrane proteins (LMP1, -2A, and -2B) and six EBV-encoded nuclear Ags (EBNA1 to -6) (42, 43). This growth program, also known as latency III, allows the expansion of the viral episome in the B cell compartment until a strong antiviral T cell response is established (44). Later on, EBV induces infected IgD+ blasts to switch to a default program, also known as latency II, which entails only EBNA-1, LMP1, and LMP2A, and allows infected B cells to differentiate to class-switched IgD- memory B cells (42, 43, 45). By further down-regulating LMP1 and LMP2A, memory B cells acquire a latency program, also known as latency I, which includes only EBNA1 and allows the persistence of EBV in a transcriptionally quiescent state (43, 46). Periodic reactivation of LMP1 and LMP2A in the tonsillar microenvironment would generate growth and survival signals that enable latently infected memory B cells to persist for the lifetime (36). The mechanisms by which EBV-infected IgD+ blasts differentiate to class-switched IgD- memory B cells remain elusive.
Among EBV-encoded proteins, LMP1 is essential to induce B cell activation, proliferation, survival (35, 47), as well as in vitro B cell transformation (48). The LMP1 cytoplasmic tail has extensive functional homology with CD40 and, like CD40, induces I
B
degradation and NF-
B nuclear translocation by recruiting TRAFs and I
B kinase (49, 50, 51). Unlike CD40, which delivers transient signals upon engagement by CD40L (3), LMP1 constitutively signals in a ligand-independent fashion (52). This observation prompted us to hypothesize that EBV might dysregulate IgG, IgA, and IgE production by delivering CD40-like signals to B cells.
In this study, we show that B cell infection by EBV actively induces CSR from Cµ to multiple C
, C
, and C
genes through LMP1. This viral protein further dysregulates CSR by triggering aberrant BAFF and APRIL expression in B cells. Our findings suggest that neutralization of BAFF and APRIL by soluble TACI and BCMA decoy receptors may attenuate dysregulated IgG, IgA, and IgE production in certain patients with latent or active EBV infection.
| Materials and Methods |
|---|
|
|
|---|
IARC, BL16, Bjab, and HL-60 cell lines (from American Type Culture Collection (Manassas, VA) and R. Dalla-Favera (Columbia University, New York, NY)) were cultured in RPMI 1640 medium (Invitrogen, Carslbad, CA). IgD+ B cells and monocytes were obtained from PBMCs as described (53). IgD+ B cells were incubated with EBV (B95-8 strain) for 2 h at 37°C. After virus removal, B cells were incubated for 3 wk at a density of 106 cells/ml. All cultures were conducted in RPMI 1640 medium supplemented with 10% FCS, antibiotics, and glutamine. Ramos subclones expressing EBV proteins (from R. Harris and M. Neuberger (Medical Research Council Laboratory of Molecular Biology, Cambridge, U.K.)) were cultured in medium supplemented with 1 µg/ml puromycine (Sigma-Aldrich, St. Louis, MO). tet-LMP1 Bjab cells (from N. Lam and B. Sugden (University of Wisconsin-Madison, Madison, WI)) were cultured with medium supplemented with 1 µg/ml puromycine and 200 µg/ml geneticin (Invitrogen), and with or without 1 ng/ml doxycycline (Sigma-Aldrich). Control MOPC-21 (Sigma-Aldrich), TACI-Ig), BCMA-Ig (Alexis Biochemicals, San Diego, CA), and CD40-Ig (Ancell, Bayport, MN) were used at 30 µg/ml.
Flow cytometry
CD3, CD14, CD19, CD23 (BD PharMingen, San Diego, CA), IgM, IgG, and IgA (Southern Biotechnologies Associates, Birmingham, AL) were detected with PE- or FITC-conjugated Abs. Mouse BAFF (mBAFF) was labeled with a mouse Ab to BAFF (Alexis Biochemicals) and a PE-conjugated anti-mouse Ab (BD PharMingen). BAFF-Rs were labeled with a CD8-BAFF fusion protein (Ancell) and a PE-conjugated Ab to CD8 (BD PharMingen). Cells were acquired using a FACSCalibur analyzer (BD Immunocytometry Systems, San Jose, CA).
Genomic PCRs and RT-PCRs
DNA and RNA extractions were preceded by removal of dead B cells through Ficoll. Genomic DNA was extracted from 10 x 106 viable B cells by using the QIAmp DNA mini kit (Qiagen, Valencia, CA). Switch circles (SCs) were amplified from 500 ng of genomic DNA (13). Total RNA was extracted from 5 x 106 viable B cells by using the RNeasy total RNA kit (Qiagen). cDNA was reverse transcribed from 3 µg of total RNA (13). PCRs were made semiquantitative by varying the number of cycles and performing dilutional analysis so that there was a linear relationship between the amount of cDNA used and the intensity of the PCR product. Germline IH-CH transcripts, mature VDJ-CH transcripts, AID, BAFF, APRIL, and
-actin were amplified as described (13). TACI, BCMA, BAFF-R, and LMP1 were amplified by using the following primer pairs: TACI, forward, 5'-AAGAAGAGGGGGGATCCCTGC-3', and reverse, 5'-TTATGCACCTGGGCCCCC-3'; BCMA, forward, 5'-CTAAGGAAGATAAACTCTGAACCA-3', and reverse, 5'-TTACCTAGCAGAAATTGATTTCTC-3'; BAFF-R, forward, 5'-GTGAGCTGGAGGCGGCGACAG-3', and reverse, 5'-CTATTGTGCTCAGGGCCGGC-3'; and LMP1, forward, 5'-CTTCAGAAGAGACCTTCTCT-3', and reverse, 5'-ACAATGCCTGTCCGTGCAAA-3'. The conditions were as follows: denaturation for 1 min at 94°C, annealing for 1 min at 60°C, and extension for 1 min at 72°C.
Southern blots
PCR products were fractionated onto agarose gels, transferred overnight to nylon membranes, and hybridized with radiolabeled probes as described (13). SCs were hybridized with a probe recognizing the recombined Sµ region; circle transcripts (CTs) and mature VDJ-Cµ transcripts were hybridized with a probe encompassing nt 1250 of the first Cµ exon; and mature VDJ-C
transcripts were hybridized with a 5'-CAGGGGGAAGACCGATGG-3' oligoprobe recognizing a consensus C
sequence.
Vectors
-449/+265 and -291/+131 genomic DNA fragments encompassing the I
3 and I
promoters were inserted into a promoterless pGL3-Basic vector (Promega, Madison, WI) containing a luciferase (LUC) reporter gene (54, 55). Wild-type (wt) LMP1 and mutant LMP1, including DEL 187351 LMP1, 187-STOP LMP1, and 231-STOP LMP1, were cloned into a pcDNA3 expression vector (Invitrogen) (56). The
B(2X)-LUC reporter vector is driven by an NF-
B-responsive minimal promoter with two NF-
B-binding
B sites.
B(2X)-LUC and the I
B
-pcDNA3 expression vector were provided by E. Cesarman (Weill Medical College of Cornell University, New York, NY). The -839/+232 genomic DNA segment encompassing the BAFF promoter was PCR amplified from placental genomic DNA by using sense 5'-CACAGGTCCACCAAGTCAACAACAGA-3' and antisense 5'-ATCACTACTTGAACTTTGAAGGTTGG-3' primers with 5' overhangs containing KpnI (sense) and XhoI (antisense) restriction sites. The resulting DNA segment was sequenced and then cloned into the pGL3-Basic reporter vector. The MatInspector software (Genomatix Software, Munchen, Germany) was used to identify putative NF-
B-binding
B motifs.
Primer extension gene analysis
A Primer Extension System-Avian Myeloblastosis Virus Reverse Transcriptase (Promega) was used to identify the BAFF gene transcription initiation site. Briefly, total RNA from HL-60 or BL16 cells was reversed transcribed with an avian myeloblastosis virus reverse transcriptase and an end-labeled 5'-CAGTAGGTTTGCTGGCATTTACCCTC-3' antisense primer recognizing a sequence immediately upstream of the first BAFF exon. The resulting cDNA was analyzed on a denaturing polyacrylamide gel to identify the number of bases between the labeled oligonucleotide and the 5' end of the targeted RNA.
Luciferase reporter assays
Cells (20 x 106/ml) were transfected with 40 µl of plasmid DNA-Tris-EDTA solution containing 20 µg of pGL3-Basic vector and 200 ng of pRL-TK control vector (Promega). pGL3 or
B(2X)-LUC reporter vectors were cotransfected with 2 µg/ml pcDNA3.1 expression vectors containing wt or mutated LMP1. Electroporation was performed at 625 V/cm (HL-60 and BL16) or 525 V/cm (Bjab) and 950 µF using a Gene Pulser II apparatus (Bio-Rad Laboratories, Hercules, CA). Transfected cells (1 x 106/ml) were cultured for 48 h. The luciferase activity was measured with the Dual-Luciferase Assay System (Promega).
Immunoblots
Total proteins were fractionated onto a 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Bio-Rad). After blocking, membranes were probed with Abs to BAFF (Upstate Biotechnology, Lake Placid, NY), APRIL, TACI, BCMA, actin (Santa Cruz Biotechnology, Santa Cruz, CA), and LMP1 (DAKO, Carpinteria, CA). Proteins were detected with an ECL detection system (Amersham, Little Chalfont, U.K.).
EMSAs
Cells (5 x 106) were lysed to extract nuclear proteins as reported (54). A double-stranded oligonucleotide probe overlapping the
B3 site (residues -236 to -216, GTGTCTGGACTCCCCCTCGCC) of the I
3 promoter (54) was end labeled with [
-32P]ATP by T4 kinase and used at
30,000 cpm in each EMSA reaction. Reaction mixtures (20 µl) contained 1 ng of DNA probe, 4 µg of nuclear proteins, 2 µg of poly(dI-dC) (Sigma-Aldrich), and 2 µl of binding buffer (12.5 mM HEPES (pH 7.9), 5 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, and 0.05% Nonidet P-40). Reaction samples were incubated at room temperature for 15 min and then electrophoresed through a 6% nondenaturing polyacrylamide gel in 0.25x Tris-borate EDTA buffer at 150 V.
| Results |
|---|
|
|
|---|
, C
, and C
upon infection by EBV
CSR from Cµ to a downstream C
3, C
1, C
1, C
2, C
4, C
2, or C
gene is preceded by the transcription of that gene in the form of a noncoding germline IH-CH transcript that includes the IH exon 5' of the targeted S region and CH (1). CSR also requires the up-regulation of the B cell-specific enzyme AID (2). By inducing looping-out deletion of the IgH DNA between Sµ and the targeted downstream S region, CSR generates a single-copy extrachromosomal reciprocal DNA recombination product, also known as SC (57). Because CSR does not target a consensus sequence within the S region (58), actively class-switching B cells generate multiple SCs with different sizes. After excision from the IgH locus, SCs transcribe short-lived chimeric I-Cµ CTs that include the promoter upstream of the targeted IH exon, the IH exon, and Cµ (58). These CTs often undergo posttranscriptional remodeling, thereby generating more than one band after PCR amplification (58). Together with AID and germline IH-CH transcripts, SCs and CTs constitute specific markers of ongoing CSR and, in healthy individuals, are usually detected only in IgD- GC B cells (59). Ongoing CSR was analyzed in noninfected (EBV-) normal peripheral blood (PB) IgD+ naive B cells, which display S regions in an unrearranged configuration (13, 59) as well as in monoclonal IARC549 and IARC100 lymphoblastoid cell lines (LCLs) obtained by transforming normal polyclonal PB B cells with EBV in vitro. CSR was also studied in monoclonal BL16 cells, a neoplastic Burkitts lymphoma (BL) B cell line that, like IARC549 and IARC100, expresses surface IgD on most of its elements and harbors a type-III EBV gene latency program.
Noninfected IgD+ B cells from healthy subjects lacked total S
-Sµ and S
-Sµ SCs (Fig. 1A), expressed no or low germline I
1-C
1, I
3-C
3, and I
1-C
1 transcripts, and lacked I
1/2-Cµ, I
3-Cµ, and I
1/2-Cµ CTs as well as AID transcripts (B). In contrast, lymphoblastoid and EBV+ BL16 B cells contained total S
-Sµ and S
-Sµ SCs, expressed large amounts of germline I
1-C
1, I
3-C
3, and I
1-C
1 transcripts, and contained I
1/2-Cµ, I
3-Cµ, and I
1/2-Cµ CTs, and AID transcripts. In both lymphoblastoid and EBV+ BL16 cells, 515% of the clonal elements expressed surface IgG or IgA, but not surface IgD and IgM (not shown), further suggesting ongoing CSR. Additional experiments were performed to verify whether infection of normal IgD+ B cells by EBV induces CSR. Compared with noninfected IgD+ B cells (Fig. 1A), EBV-infected IgD+ B cells up-regulated AID transcripts and contained extrachromosomal S
1/2-Sµ, S
3-Sµ, S
4-Sµ, S
1/2-Sµ, and S
-Sµ SCs (C), which reflect ongoing CSR from Cµ to C
1/C
2, C
3, C
4, C
1/C
2, and C
, respectively. These findings indicate that B cells undergo CD40-independent CSR from Cµ to multiple downstream C
, C
, and C
genes upon infection by EBV.
|
To evaluate the mechanism by which EBV induces CSR, we took advantage of IgM+ subclones established from the EBV- BL cell line Ramos and stably expressing LMP1, LMP2A, EBNA1, EBNA2, or EBNA-LP expression vectors. Compared with control subclones transfected with empty expression vectors, B cell subclones expressing LMP1 contained I
1/2-Cµ and I
3-Cµ CTs as well as mature VHDJH-C
1 and VHDJH-C
3 transcripts (Fig. 2), the end product of CSR from Cµ to C
1 and C
3. B cell subclones expressing LMP2A contained lower amounts of I
3-Cµ CTs and VHDJH-C
3 transcripts, but lacked I
1/2-Cµ and VHDJH-C
1 transcripts. In contrast, B cell subclones expressing EBNA1, EBNA2, or EBNA-LP lacked I
1/2-Cµ and I
3-Cµ CTs as well as mature VHDJH-C
1 and VHDJH-C
3 transcripts. Finally, all B cell subclones expressed
-actin transcripts as well as mature VHDJH-Cµ transcripts. These findings suggest that LMP1 and, to a lesser extent, LMP2A trigger CD40-independent CSR.
|
3 gene promoter (I
3-LUC), the I
gene promoter (I
-LUC), or
B(2X)-LUC upon incubation with doxycycline for 2 days (Fig. 3A). Overexpression of the NF-
B inhibitor I
B
inhibited doxycycline-induced activation of I
3-LUC, I
-LUC, and
B(2X)-LUC. In addition to activating the I
3 and I
promoters, doxycycline up-regulated the expression of germline I
1-C
1, I
3-C
3, I
1-C
1, and I
-C
transcripts (Fig. 3B). Furthermore, Bjab-tet-LMP1 B cells exposed to doxycycline for 4 days up-regulated AID transcripts and induced I
1/2-Cµ, I
3-Cµ, I
1/2-Cµ, and I
-Cµ CTs (Fig. 3C), which reflect ongoing CSR from Cµ to C
1/C
2, C
3, C
1/C
2, and C
, respectively. The induction of CSR by doxycycline was associated with up-regulation of surface IgG and IgA and down-regulation of surface IgM (Fig. 3D). These findings indicate that B cells undergo NF-
B-dependent germline IH-CH transcription and CSR upon activation by LMP1.
|
We have recently found that dendritic cells up-regulate BAFF and APRIL, two inducers of TI CSR, upon engagement of CD40 by CD40L (13). Given its ability to mimic CD40 signaling, LMP1 might up-regulate BAFF and APRIL in B cells as CD40 does in dendritic cells. Compared with control subclones, Ramos B cell subclones expressing LMP1 or, to a lesser extent, LMP2A contained more BAFF and APRIL transcripts and proteins (Fig. 4A). In contrast, Ramos B cell subclones expressing EBNA1, EBNA2, or EBNA-LP contained BAFF and APRIL transcripts and proteins in amounts comparable with those detected in control subclones. Additional experiments evaluated the expression of BAFF and APRIL in Bjab-tet-LMP1 B cells. When exposed to tet, Bjab-tet-LMP1 B cells up-regulated LMP1 as well as BAFF and APRIL transcripts and proteins (Fig. 4B). tet also up-regulated surface CD23, a canonical LMP1-inducible B cell-activation protein, BAFF, as well as the total BAFF-binding activity (Fig. 4C), which reflects the surface density of TACI, BCMA, and BAFF-R receptors. In contrast, tet did not up-regulate CD3, a T cell-restricted component of the TCR complex, or CD19, a component of the B cell receptor complex expressed by all mature B cells. These findings indicate that LMP1 up-regulates BAFF and APRIL in B cells.
|
B
NF-
B is crucial for the activation of B cells by LMP1 (35, 51). We took advantage of Bjab-tet-LMP1 B cells to verify whether LMP1 up-regulates BAFF through NF-
B. DNA sequence analysis showed that the BAFF gene promoter contains at least six NF-
B-binding
B sites (Fig. 5A). Bjab-tet-LMP1 B cells activated a luciferase reporter vector carrying the BAFF gene promoter (BAFF-LUC) as well as
B(2X)-LUC upon incubation with doxycycline for 2 days. Overexpression of I
B
inhibited the induction of BAFF-LUC and
B(2X)-LUC by doxycycline (Fig. 5B), suggesting that NF-
B is critical to up-regulate BAFF. Because LMP1 recruits TRAFs and activates NF-
B through C-terminal activation region (CTAR)-1 and CTAR-2 (49, 56), we verified whether disruption of one or both CTARs affects the up-regulation of BAFF by LMP1. wt Bjab B cells activated BAFF-LUC as well as
B(2X)-LUC upon transfection with wt LMP1, which contains both CTAR-1 and CTAR-2. In contrast, 187-STOP LMP1, which lacks both CTAR-1 and CTAR-2, failed to activate BAFF-LUC as well as control
B(2X)-LUC. Furthermore, both BAFF-LUC and
B(2X)-LUC were activated by DEL 187351 LMP1, which lacks only CTAR-1, or 231-STOP LMP1, which lacks only CTAR-2. These findings suggest that the up-regulation of BAFF by LMP1 requires the integrity of at least one CTAR domain. Finally, transfection of Bjab B cells with graded amounts of I
B
progressively inhibited the activation of BAFF-LUC and
B(2X)-LUC by wt LMP1, further indicating that NF-
B is crucial for the up-regulation of BAFF by LMP1.
|
Additional experiments were performed to verify whether purified B cells up-regulate BAFF and APRIL upon EBV infection. Purified noninfected IgD+ B cells lacked BAFF and APRIL transcripts (Fig. 6A) as well as BAFF and APRIL proteins (B). Similar normal B cells expressed CD19, but most of them lacked the EBV (LMP1)-inducible Ag CD23 as well as mBAFF and the myeloid Ag CD14 (Fig. 6C). In contrast, purified EBV-infected IgD+ B cells contained BAFF and APRIL transcripts and proteins and coexpressed CD19, CD23, and mBAFF on the surface. Similar EBV-infected normal B cells lacked CD14, indicating a lack of contaminating monocytes and macrophages. The expression of BAFF and APRIL was also measured in B cell lines harboring a type-III EBV latency gene program. IARC504 lymphoblastoid B cells and neoplastic EBV+ BL16 B cells expressed BAFF and APRIL transcripts and proteins in amounts comparable with those expressed in myeloid cells, including HL60 AML cells. Moreover, lymphoblastoid and malignant BL16 B cells, which contain LMP1 (Fig. 6, A and B), expressed more BAFF and APRIL transcripts than Akata and Mutu I (not shown), two EBV+ BL B cell lines that, unlike LCLs and BL16, express a type-I EBV latency gene program and therefore lack LMP1. Finally, all B cell types under study but not HL60 AML cells expressed TACI, BCMA, and BAFF-R transcripts (Fig. 6A) and proteins (B). These findings indicate that B cells express TACI, BCMA, and BAFF-R, and aberrantly up-regulate BAFF and APRIL upon infection by EBV.
|
The above findings prompted us to hypothesize that engagement of TACI, BCMA, and/or BAFF-R by autocrine BAFF and APRIL enhances LMP1-induced CSR in EBV-infected B cells. To verify this, we took advantage of soluble TACI-Ig and BCMA-Ig decoy receptors, which prevent the binding of BAFF and APRIL to cell-bound TACI, BCMA, and BAFF-R. Lymphoblastoid IARC549 B cells down-regulated total S
-Sµ and S
-Sµ SCs (Fig. 7A), I
1/2-Cµ, I
3-Cµ, and I
1/2-Cµ CTs, as well as AID transcripts upon exposure to soluble TACI-Ig and BCMA-Ig decoy receptors for 2 days (B). This down-regulation was specific, as similar lymphoblastoid B cells did not attenuate CSR upon exposure to a control Ig or CD40-Ig, which blocks CD40L-CD40 interaction. These findings suggest that EBV triggers CD40-independent CSR not only through LMP1 but also through endogenous (LMP1-induced) BAFF and APRIL.
|
B activation and germline IH-CH transcription in EBV-infected B cells
Additional experiments were set up to assess whether BAFF and APRIL released by EBV-infected LMP1-expressing B cells activate NF-
B. Exposure of lymphoblastoid IARC549 B cells to BCMA-Ig but not control Ig or CD40-Ig down-regulated the binding of nuclear NF-
B to an oligonucleotide encompassing a DNA sequence crucial for the activation of the human I
3 promoter by CD40 (Fig. 7C). As expected, this effect was associated with down-regulated expression of germline I
3-C
3 transcripts (Fig. 7D). In contrast, the expression of germline I
3-C
3 transcripts was not affected by control Ig or CD40-Ig. These results indicate that engagement of TACI, BCMA, and/or BAFF-R by autocrine BAFF and APRIL activates NF-
B and enhances the expression of germline IH-CH transcripts in EBV-infected LMP1-expressing B cells.
| Discussion |
|---|
|
|
|---|
, C
, and C
genes in B cells. This induction is associated with NF-
B-dependent activation of downstream CH gene promoters and up-regulation of germline IH-CH transcripts and AID transcripts. LMP1 up-regulates also BAFF and APRIL through an NF-
B-dependent mechanism that requires at least one CTAR domain. By engaging TACI, BCMA, and BAFF-R on B cells, BAFF and APRIL activate NF-
B and further enhance CSR. These findings suggest that EBV could play an important role in the pathogenesis of disorders associated with aberrant IgG, IgA, and/or IgE production. EBV is thought to initially infect naive IgD+ B cells in the mantle zone of lymphoid follicles located beneath the tonsillar epithelium (44). By expressing a full set of EBNA and LMP proteins, EBV induces IgD+ B cells to become blasts, which proliferate outside the GC (43). Subsequent down-regulation of most EBV proteins but EBNA1, LMP1, and LMP2A would enable infected IgD+ blasts to enter the GC and differentiate to class-switched IgD- memory B cells (43, 45). After further down-regulation of LMP1 and, to a lesser extent, LMP2A, latently infected memory B cells would leave the tonsil and enter the circulation (43, 46). It remains unclear whether IgD+ blasts undergo IgH class switching upon stimulation by viral proteins or as a result of CD40-dependent progression through the GC in response to a TD Ag. By showing that EBV induces CD40-independent CSR, our data suggest that at least some infected IgD+ B cells rapidly undergo TI class switching to IgG, IgA, or IgE outside the GC.
Viruses induce CD40-independent IgH class switching through mechanisms that remain largely unknown (60, 61, 62). Our data indicate that EBV transcriptionally activates downstream germline CH gene promoters, including C
3 and C
, through LMP1. This CD40-like viral protein would transactivate C
3 and C
genes through an NF-
B-dependent mechanism. Consistent with this, overexpression of the NF-
B inhibitor I
B
or (not shown) disruption of both NF-
B-activating CTAR domains within the LMP1 cytoplasmic tail impairs the induction of germline IH-CH transcription by LMP1. In LMP1-expressing B cells, germline IH-CH transcription is associated with up-regulation of AID transcripts and induction of CSR from Cµ to multiple downstream C
, C
, and C
genes. These findings provide a mechanistic explanation for previous studies showing that enforced LMP1 expression restores TD IgG, IgA, and IgE production in CD40-deficient mice (63), which otherwise show severely impaired TD IgH class switching (64). Whereas CD40 transmits transient ligand-dependent signals (3), LMP1 continuously signals in a ligand-independent fashion (52). This implies that LMP1-induced CSR is subject to less regulatory constraints than CD40-induced CSR. By showing that EBV-infected LMP1-expressing IgD+ B cells constitutively express high levels of IH-CH transcripts and AID and continuously undergo CSR, our data extend recent findings indicating that artificial Sµ and S
3 DNA substrates undergo spontaneous recombination in lymphoblastoid B cells (65). By triggering unrestrained CSR, LMP1 may play a key role in the pathogenesis of dysregulated IgG, IgA, and IgE production occurring in certain EBV-infected individuals, including immunocompromised HIV-infected subjects and transplant recipients (39, 40, 41).
In normal B cells, switching from IgM to IgG, IgA, or IgE requires two signals, one delivered by CD40L and the other delivered by a cytokine (1, 2). Among cytokines, IL-4 induces switching to IgG and IgE (66, 67, 68, 69), IL-10 to IgG and IgA (13, 66, 70, 71), and TGF-
to IgA (71, 72, 73). In EBV-infected LMP1-expressing B cells, CSR to C
and C
occurs in the absence of exogenous cytokines. This does not imply that cytokines do not play any role in EBV-induced CSR, because EBV induces B cells to produce large amounts of autocrine IL-10 through LMP1 (74) as well as small nonpolyadenylated viral RNAs, also referred to as EBER1 and EBER2 (75). Consistent with this, neutralization of IL-10 by a specific blocking Ab partially inhibits switching to IgG and IgA in LMP1-expressing B cells (not shown). In addition to up-regulating endogenous IL-10, EBV produces an IL-10-like protein through a viral gene known as BCRF1 (76). Furthermore, EBV-infected B cells produce IL-13 (77), which, like IL-4, activates switching from IgM to IgG4 and IgE (78, 79). This might explain our finding that EBV-infected LMP1-expressing B cells actively switch to C
4 and C
in the absence of external IL-4.
Unlike CD40, which mediates CSR in GC B cells (3, 5), LMP1 elicits IgG and IgA production outside the GC of secondary lymphoid follicles (63). This extrafollicular pattern is also associated with B cell responses to TI Ags with repetitive structure, including envelope glycoproteins from viruses and capsular polysaccharides from bacteria (10, 60, 80). By showing that LMP1 up-regulates BAFF and APRIL, two mediators of TI Ab production (13, 14, 15, 16), our data suggest that EBV exploits an otherwise physiological TI pathway to maximize CSR in infected IgD+ B cells. Engagement of TACI, BCMA, and BAFF-R by LMP1-induced BAFF and APRIL would enhance CSR from Cµ to a targeted downstream CH gene by activating the germline transcription of that gene through NF-
B. Consistent with this, neutralization of autocrine BAFF and APRIL by soluble TACI-Ig and BCMA-Ig decoy receptors attenuates NF-
B activation and down-regulates the expression of downstream germline IH-CH transcripts in LMP1-expressing B cells. In similar cells, TACI-Ig and BCMA-Ig decoy receptors down-regulate AID and impair CSR. Thus, autocrine BAFF and APRIL would cooperate with LMP1 to trigger NF-
B-dependent germline IH-CH transcription and CSR.
In addition to transactivating downstream CH genes, NF-
B would play an important role in the LMP1-mediated up-regulation of BAFF. Consistent with this, overexpression of the NF-
B inhibitor I
B
interferes with the transcriptional activation of the BAFF gene promoter in LMP1-activated B cells. Furthermore, disruption of the two NF-
B-activating CTARs within the LMP1 cytoplasmic tail severely impairs the activation of the BAFF gene promoter by LMP1. Although playing a key role, NF-
B may not be the only transcription factor involved in LMP1-mediated up-regulation of BAFF. Consistent with this, the BAFF gene promoter includes several putative STAT-binding
-IFN-activated sequences (not shown), which could be activated by STAT proteins induced by LMP1 (81). STAT proteins could be also induced by IL-10 (82), an LMP1-inducible cytokine that up-regulates BAFF in myeloid cells (74, 83). Thus, LMP1-induced NF-
B and STAT transcription factors might synergistically activate the BAFF gene promoter upon binding to cooperative
B and
-IFN-activated sequence sites.
LMP1 is not the only CSR-inducing viral protein, because LMP2A triggers CSR from Cµ to C
3 and up-regulates BAFF and APRIL, although to a lesser extent than LMP1. Unlike LMP1, LMP2A activates B cells by mimicking signaling through the B cell Ag receptor (BCR) (36). Consistent with this, the cytoplasmic tail of LMP2A encompasses immunoreceptor tyrosine-based activation motifs similar to those found in the Ig
and Ig
signal-transducing subunits of the BCR complex (36). In addition to modulating B cell proliferation and survival (84), signals emanating from BCR modulate IgH class switching. For instance, BCR engagement by certain TI Ags induces CD40-independent switching to IgG3 both in vivo and in vitro (80, 85). In addition, BCR engagement cooperates with BAFF and APRIL to induce CD40-independent IgG production (13, 19, 25). Thus, it is conceivable that LMP2A triggers TI CSR to C
3 through a BCR-like pathway. This pathway would cooperate with LMP1 as well as endogenous BAFF and APRIL to optimize IgH class switching in EBV-infected B cells.
Our findings raise the possibility that IgH class switching confers a specific functional advantage to EBV. When engaged by Ag, surface IgM and IgD (i.e., BCR) deliver proliferation and survival signals through the Ig
-Ig
heterodimer (84). These signals are negatively regulated by CD22, an inhibitory coreceptor that contains typical immunoreceptor tyrosine-based inhibitory motifs (86). Recent studies indicate that B cells become resistant to CD22-mediated inhibitory signals upon switching from IgM and IgD to IgG (87). In this fashion, IgG+ (IgD-) memory B cells become more sensitive to BCR-driven proliferation and survival signals upon exposure to Ag. It is tempting to speculate that EBV triggers TI CSR in extrafollicular IgD+ B cells to rapidly generate a pool of IgD- B cells expressing protective BCRs, such as IgG. Due to their lower sensitivity to CD22-mediated inhibitory signals, these de novo class-switched B cells would facilitate the initial expansion of the viral episome.
In addition to inducing TI CSR, LMP1 and LMP2A deliver signals that are essential for the survival of infected B cells (36). Our findings imply that these signals might be greatly amplified by autocrine BAFF, a powerful inducer of B cell survival (24). BAFF exerts most of its prosurvival activity through BAFF-R (21, 23), which is expressed in large amounts by both EBV-infected and noninfected B cells. By engaging BAFF-R on bystander self-reactive B cells, BAFF expressed on and released by latently infected tonsillar B cells might facilitate the onset of autoimmune disorders, including SLE (33, 34, 37). Consistent with this, SLE patients display increased levels of circulating soluble BAFF (24), and mice overexpressing BAFF develop an SLE-like syndrome with kidney deposition of IgG and IgA autoantibodies (22). Finally, BAFF and APRIL might also be implicated in the pathogenesis of autoimmune and IgE-mediated atopic disorders arising in certain HIV-infected subjects and transplant recipients with EBV-associated B cell lymphoproliferative disorders (35, 40, 41, 88). In these immune-compromised individuals, neutralization of BAFF and APRIL by soluble decoy receptors or blocking Abs might attenuate production of self-reactive IgG and IgA, dysregulated switching to IgE, and aberrant B cell accumulation.
| Acknowledgments |
|---|
B(2X)-LUC and I
B
-pcDNA3. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Andrea Cerutti, Department of Pathology and Laboratory Medicine, Weill Medical College of Cornell University, 1300 York Avenue, New York, NY 10021. E-mail address: acerutti{at}med.cornell.edu ![]()
3 Abbreviations used in this paper: CSR, class switch DNA recombination; S, IgH switch region; CD40L, CD40 ligand; AID, activation-induced cytidine deaminase; TD, T cell dependent; TI, T cell independent; GC, germinal center; BAFF, B cell-activating factor of the TNF family; APRIL, a proliferation-inducing ligand; TACI, transmembrane activator and calcium modulator and cyclophylin ligand interactor; BCMA, B cell maturation Ag; TRAF, TNFR-associated factor; SLE, systemic lupus erythematosus; LMP, latent membrane protein; EBNA, EBV-encoded nuclear Ag; mBAFF, mouse BAFF; SC, switch circle; LUC, luciferase reporter plasmid; wt, wild type; CT, circle transcript; PB, peripheral blood; LCL, lymphoblastoid B cell line; BL, Burkitts lymphoma; tet, tetracycline; CTAR, C-terminal activation region; BCR, B cell Ag receptor. ![]()
Received for publication June 19, 2003. Accepted for publication September 12, 2003.
| References |
|---|
|
|
|---|
B kinase. Cell 90:373.[Medline]
B kinase complex (IKK) contains two kinase subunits, IKK
and IKK
, necessary for I
B phosphorylation and NF-
B activation. Cell 91:243.[Medline]
B transcription factors: key mediators of B-cell activation. Immunol. Rev. 176:134.[Medline]
and its effects on post-transplant lymphoproliferative disorders. Springer Semin. Immunopathol. 20:425.[Medline]
B activation. Mol. Cell. Biol. 16:7098.[Abstract]
B through a pathway that includes the NF-
B-inducing kinase and the I
B kinases IKK
and IKK
. Proc. Natl. Acad. Sci. USA 95:10106.
3 region is a functional promoter: synergistic activation by CD40 ligand and IL-4 via cooperative NF-
B and STAT-6 binding sites. J. Immunol. 162:5327.
germline promoter. J. Immunol. 158:5874.[Abstract]
B activation. J. Virol. 71:586.[Abstract]
and
and prostaglandin E2. Proc. Natl. Acad. Sci. USA 85:6880.
1 and
promoters by IL-4 and CD40. J. Immunol. 167:1522.
1 immunoglobulin heavy-chain transcripts in resting B cells: induction by interleukin 4 and inhibition by interferon
. Proc. Natl. Acad. Sci. USA 86:2829.
cooperate to induce anti-CD40-activated naive human B cells to secrete immunoglobulin A. J. Exp. Med. 175:671.
: evidence for TGF-
-dependent but not IL-10-dependent direct Sµ
S
and sequential Sµ
S
, S
S
DNA recombination. J. Immunol. 161:5217.
germline transcripts in the B lymphoma I.29 µ: transforming growth factor-
activates transcription of the unrearranged C
gene. J. Immunol. 147:4374.[Abstract]
Related articles in The JI:
This article has been cited by other articles:
![]() |
G. Brady, H. J. Whiteman, L. C. Spender, and P. J. Farrell Downregulation of RUNX1 by RUNX3 Requires the RUNX3 VWRPY Sequence and Is Essential for Epstein-Barr Virus-Driven B-Cell Proliferation J. Virol., July 1, 2009; 83(13): 6909 - 6916. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. Kimberley, L. van Bostelen, K. Cameron, G. Hardenberg, J. A. Marquart, M. Hahne, and J. P. Medema The proteoglycan (heparan sulfate proteoglycan) binding domain of APRIL serves as a platform for ligand multimerization and cross-linking FASEB J, May 1, 2009; 23(5): 1584 - 1595. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Roughan and D. A. Thorley-Lawson The Intersection of Epstein-Barr Virus with the Germinal Center J. Virol., April 15, 2009; 83(8): 3968 - 3976. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kanswal, N. Katsenelson, A. Selvapandiyan, R. J. Bram, and M. Akkoyunlu Deficient TACI Expression on B Lymphocytes of Newborn Mice Leads to Defective Ig Secretion in Response to BAFF or APRIL J. Immunol., July 15, 2008; 181(2): 976 - 990. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xu, P. A. Santini, A. J. Matthews, A. Chiu, A. Plebani, B. He, K. Chen, and A. Cerutti Viral Double-Stranded RNA Triggers Ig Class Switching by Activating Upper Respiratory Mucosa B Cells through an Innate TLR3 Pathway Involving BAFF J. Immunol., July 1, 2008; 181(1): 276 - 287. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-A Kim, S.-H. Jeon, G.-Y. Seo, J.-B. Park, and P.-H. Kim TGF-{beta}1 and IFN-{gamma} stimulate mouse macrophages to express BAFF via different signaling pathways J. Leukoc. Biol., June 1, 2008; 83(6): 1431 - 1439. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rastelli, C. Homig-Holzel, J. Seagal, W. Muller, A. C. Hermann, K. Rajewsky, and U. Zimber-Strobl LMP1 signaling can replace CD40 signaling in B cells in vivo and has unique features of inducing class-switch recombination to IgG1 Blood, February 1, 2008; 111(3): 1448 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Perez-Duran, V. G. de Yebenes, and A. R. Ramiro Oncogenic events triggered by AID, the adverse effect of antibody diversification Carcinogenesis, December 1, 2007; 28(12): 2427 - 2433. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Serafini, B. Rosicarelli, D. Franciotta, R. Magliozzi, R. Reynolds, P. Cinque, L. Andreoni, P. Trivedi, M. Salvetti, A. Faggioni, et al. Dysregulated Epstein-Barr virus infection in the multiple sclerosis brain J. Exp. Med., November 26, 2007; 204(12): 2899 - 2912. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Souza, B. D. Stollar, J. L. Sullivan, K. Luzuriaga, and D. A. Thorley-Lawson Influence of EBV on the Peripheral Blood Memory B Cell Compartment J. Immunol., September 1, 2007; 179(5): 3153 - 3160. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. MacArthur, A. D. Wilson, M. A. Birchall, and A. J. Morgan Primary CD4+ T-Cell Responses Provide both Helper and Cytotoxic Functions during Epstein-Barr Virus Infection and Transformation of Fetal Cord Blood B Cells J. Virol., May 1, 2007; 81(9): 4766 - 4775. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Darce, B. K. Arendt, S. K. Chang, and D. F. Jelinek Divergent Effects of BAFF on Human Memory B Cell Differentiation into Ig-Secreting Cells J. Immunol., May 1, 2007; 178(9): 5612 - 5622. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Gourzi, T. Leonova, and F. N. Papavasiliou Viral induction of AID is independent of the interferon and the Toll-like receptor signaling pathways but requires NF-{kappa}B J. Exp. Med., February 19, 2007; 204(2): 259 - 265. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-C. Lu, H.-T. Huang, J.-T. Wang, G. Slupphaug, T.-K. Li, M.-C. Wu, Y.-C. Chen, C.-P. Lee, and M.-R. Chen Characterization of the Uracil-DNA Glycosylase Activity of Epstein-Barr Virus BKRF3 and Its Role in Lytic Viral DNA Replication J. Virol., February 1, 2007; 81(3): 1195 - 1208. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kothlow, I. Morgenroth, Y. Graef, K. Schneider, I. Riehl, P. Staeheli, P. Schneider, and B. Kaspers Unique and conserved functions of B cell-activating factor of the TNF family (BAFF) in the chicken Int. Immunol., February 1, 2007; 19(2): 203 - 215. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kotani, N. Kakazu, T. Tsuruyama, I.-m. Okazaki, M. Muramatsu, K. Kinoshita, H. Nagaoka, D. Yabe, and T. Honjo Activation-induced cytidine deaminase (AID) promotes B cell lymphomagenesis in Emu-cmyc transgenic mice PNAS, January 30, 2007; 104(5): 1616 - 1620. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chiu, W. Xu, B. He, S. R. Dillon, J. A. Gross, E. Sievers, X. Qiao, P. Santini, E. Hyjek, J.-w. Lee, et al. Hodgkin lymphoma cells express TACI and BCMA receptors and generate survival and proliferation signals in response to BAFF and APRIL Blood, January 15, 2007; 109(2): 729 - 739. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rovedo and R. Longnecker Epstein-Barr Virus Latent Membrane Protein 2B (LMP2B) Modulates LMP2A Activity J. Virol., January 1, 2007; 81(1): 84 - 94. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fabris, L. Quartuccio, S. Sacco, G. De Marchi, G. Pozzato, C. Mazzaro, G. Ferraccioli, T. S. Migone, and S. De Vita B-Lymphocyte stimulator (BLyS) up-regulation in mixed cryoglobulinaemia syndrome and hepatitis-C virus infection Rheumatology, January 1, 2007; 46(1): 37 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Schwaller, P. Schneider, P. Mhawech-Fauceglia, T. McKee, S. Myit, T. Matthes, J. Tschopp, O. Donze, F.-A. Le Gal, and B. Huard Neutrophil-derived APRIL concentrated in tumor lesions by proteoglycans correlates with human B-cell lymphoma aggressiveness Blood, January 1, 2007; 109(1): 331 - 338. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bergqvist, E. Gardby, A. Stensson, M. Bemark, and N. Y. Lycke Gut IgA Class Switch Recombination in the Absence of CD40 Does Not Occur in the Lamina Propria and Is Independent of Germinal Centers J. Immunol., December 1, 2006; 177(11): 7772 - 7783. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tobollik, L. Meyer, M. Buettner, S. Klemmer, B. Kempkes, E. Kremmer, G. Niedobitek, and B. Jungnickel Epstein-Barr virus nuclear antigen 2 inhibits AID expression during EBV-driven B-cell growth Blood, December 1, 2006; 108(12): 3859 - 3864. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. O. Jacob, L. Pricop, C. Putterman, M. N. Koss, Y. Liu, M. Kollaros, S. A. Bixler, C. M. Ambrose, M. L. Scott, and W. Stohl Paucity of Clinical Disease despite Serological Autoimmunity and Kidney Pathology in Lupus-Prone New Zealand Mixed 2328 Mice Deficient in BAFF J. Immunol., August 15, 2006; 177(4): 2671 - 2680. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-T. Tai, X.-F. Li, I. Breitkreutz, W. Song, P. Neri, L. Catley, K. Podar, T. Hideshima, D. Chauhan, N. Raje, et al. Role of B-Cell-Activating Factor in Adhesion and Growth of Human Multiple Myeloma Cells in the Bone Marrow Microenvironment. Cancer Res., July 1, 2006; 66(13): 6675 - 6682. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fu, Y.-C. Lin-Lee, L. V. Pham, A. Tamayo, L. Yoshimura, and R. J. Ford Constitutive NF-{kappa}B and NFAT activation leads to stimulation of the BLyS survival pathway in aggressive B-cell lymphomas Blood, June 1, 2006; 107(11): 4540 - 4548. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. He, X. Qiao, P. J. Klasse, A. Chiu, A. Chadburn, D. M. Knowles, J. P. Moore, and A. Cerutti HIV-1 Envelope Triggers Polyclonal Ig Class Switch Recombination through a CD40-Independent Mechanism Involving BAFF and C-Type Lectin Receptors J. Immunol., April 1, 2006; 176(7): 3931 - 3941. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Potter, C. I. Mockridge, L. Neville, I. Wheatley, M. Schenk, J. Orchard, A. S. Duncombe, G. Packham, and F. K. Stevenson Structural and Functional Features of the B-Cell Receptor in IgG-Positive Chronic Lymphocytic Leukemia. Clin. Cancer Res., March 15, 2006; 12(6): 1672 - 1679. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Souza, B. D. Stollar, J. L. Sullivan, K. Luzuriaga, and D. A. Thorley-Lawson Peripheral B cells latently infected with Epstein-Barr virus display molecular hallmarks of classical antigen-selected memory B cells PNAS, December 13, 2005; 102(50): 18093 - 18098. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chiu, X. Qiao, B. He, E. Hyjjek, J. Lee, E. Cesarman, A. Chadburn, D. M. Knowles, and A. Cerutti The TNF Family Members BAFF and APRIL Play an Important Role in Hodgkin Lymphoma. Blood (ASH Annual Meeting Abstracts), November 16, 2005; 106(11): 22 - 22. [Abstract] |
||||
![]() |
B. He, X. Qiao, and A. Cerutti CpG DNA Induces IgG Class Switch DNA Recombination by Activating Human B Cells through an Innate Pathway That Requires TLR9 and Cooperates with IL-10 J. Immunol., October 1, 2004; 173(7): 4479 - 4491. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. He, A. Chadburn, E. Jou, E. J. Schattner, D. M. Knowles, and A. Cerutti Lymphoma B Cells Evade Apoptosis through the TNF Family Members BAFF/BLyS and APRIL J. Immunol., March 1, 2004; 172(5): 3268 - 3279. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Meyer, R. F. Ambinder, and S. Stroobants Hodgkin's Lymphoma: Evolving Concepts with Implications for Practice Hematology, January 1, 2004; 2004(1): 184 - 202. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |