The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schirmbeck, R.
Right arrow Articles by Reimann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schirmbeck, R.
Right arrow Articles by Reimann, J.
The Journal of Immunology, 2003, 171: 5198-5207.
Copyright © 2003 by The American Association of Immunologists

Antigenic Epitopes Fused to Cationic Peptide Bound to Oligonucleotides Facilitate Toll-Like Receptor 9-Dependent, but CD4+ T Cell Help-Independent, Priming of CD8+ T Cells1

Reinhold Schirmbeck2,*, Petra Riedl*, Rinaldo Zurbriggen{dagger}, Shizuo Akira{ddagger} and Jörg Reimann*

* Department of Medical Microbiology and Immunology, University of Ulm, Ulm, Germany; {dagger} Pevion Biotech, Bern, Switzerland; and {ddagger} Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A priority in current vaccine research is the development of adjuvants that support the efficient priming of long-lasting, CD4+ T cell help-independent CD8+ T cell immunity. Oligodeoxynucleotides (ODN) with immune-stimulating sequences (ISS) containing CpG motifs facilitate the priming of MHC class I-restricted CD8+ T cell responses to proteins or peptides. We show that the adjuvant effect of ISS+ ODN on CD8+ T cell priming to large, recombinant Ag is enhanced by binding them to short, cationic (arginine-rich) peptides that themselves have no adjuvant activity in CD8+ T cell priming. Fusing antigenic epitopes to cationic (8- to 10-mer) peptides bound to immune-stimulating ISS+ ODN or nonstimulating NSS+ ODN (without CpG-containing sequences) generated immunogens that efficiently primed long-lasting, specific CD8+ T cell immunity of high magnitude. Different MHC class I-binding epitopes fused to short cationic peptides of different origins showed this adjuvant activity. Quantitative ODN binding to cationic peptides strikingly reduced the toxicity of the latter, suggesting that it improves the safety profile of the adjuvant. CD8+ T cell priming supported by this adjuvant was Toll-like receptor 9 dependent, but required no CD4+ T cell help. ODN (with or without CpG-containing sequences) are thus potent Th1-promoting adjuvants when bound to cationic peptides covalently linked to antigenic epitopes, a mode of Ag delivery prevailing in many viral nucleocapsids.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Unmethylated CpG motifs prevalent in bacterial genomic DNAs stimulate innate host defense mechanisms by generating Toll-like receptor 9 (TLR9)3 signals that trigger the production of Th1-like proinflammatory cytokines, IFNs, and chemokines (reviewed in Ref. 1). Oligodeoxynucleotides (ODN) are potent adjuvants that facilitate the priming of specific Th1 immune responses against a wide variety of pathogens. ODN-based adjuvants have been effective in the specific immunotherapy of cancer and allergy in preclinical models. CpG-containing ODN are thus attractive adjuvants for the formulation of Th1-stimulating vaccines that exploit the response of key cells of the innate or specific immune system to a danger signal. Polyribonucleotides and possibly deoxyribonucleotides without CpG motifs are also immunostimulatory, but seem to mediate signals through receptors other than TLR9.

DNAs and ODNs bind hydrophilic, cationic peptides with positively charged arginine (R) or lysine (K) side groups. Cationic, R-rich peptides interact with their guanidino head groups through H bonds with the negatively charged phosphate backbone of RNA or DNA molecules. Many viral and eukaryotic proteins contain such cationic domains. These include the HIV tat and rev proteins, the antennapedia protein of Drosophila, and the core Ags of hepatitis B and C viruses. These cationic peptide motifs are described as protein translocation domains or cell-penetrating peptides, because these R-rich domains translocate proteins through membranes (reviewed in Refs. 2, 3, 4). Linear or branched synthetic peptides with no specific primary or secondary structure that contain either L- or D-amino acids translocate through cell membranes (5). Peptides with a length of six to nine R residues translocate optimally through membranes, and peptides containing R residues translocate more efficiently than peptides containing K residues. These cationic peptides efficiently deliver large, 20- to 200-kDa proteins (2, 4, 6), liposomes, radioisotopes, or antisense oligonucleotides (7, 8, 9, 10, 11) into cells. They thus represent a novel, potentially universal delivery system for proteins or nucleotides into the cytosol in bioactive form. The mechanism of receptor-independent internalization of cationic peptides is undefined; it is energy independent and does not involve endocytosis. Translocation of cationic peptides is one-way (into the cell, not out of the cell), and the peptide is degraded within the cells. Cationic peptides are cytotoxic, and their toxicity depends on the length and particular sequence of the peptide. It is not known whether peptide-bound ODNs or DNAs potentiate immune responses. Sequence-independent binding of CpG-containing ODN to lactoferrin decreases their cellular uptake and inhibits their immune stimulation (12), indicating that peptide-binding can suppress host responses driven by these potent adjuvants. Similarly, the histidine-rich glycoprotein, an abundant serum protein, binds DNA of apoptotic cells and the Fc{gamma}RI on monocytes, thereby contributing to the anti-inflammatory apoptotic cell clearance by macrophages (13). These findings suggest that peptide binding of nucleotides can attenuate their adjuvant activity.

Immune activation by ODN with at least some of the known CpG-containing motifs is TLR9-dependent (14). It is not clear whether all ODNs with CpG motifs mediate immune stimulation only through this pattern recognition receptor (1). Uptake of ODN by cells is temperature and energy dependent, competable, saturable, and sequence independent and involves receptor-mediated endocytosis. The internalized ODNs seem to localize to endosomes in which acidification and recognition by TLR9 trigger NF-{kappa}B activation through a cascade of adaptor proteins of the TLR/IL-1R signaling pathway involving MyD88 and mitogen-activated protein kinases. It is not known whether immune-stimulatory ODN that penetrate the cells by other routes can trigger TLR9 signaling in subcellular compartments other than the endosomes.

ODNs with (but not without) CpG motifs enhance the priming of murine, MHC class I-restricted CD8+ CTL responses (15, 16, 17, 18, 19, 20) that are CD4+ T cell help independent (21). Immunostimulatory ODN promote protective Th1 immunity in many systems through induction of IL-12 and IFN-{gamma} (22, 23, 24). The magnitude and longevity of the CD8+ T cell immunity established in ODN-facilitated priming seem to be superior to those of many alternative adjuvants, but the optimal delivery of ODN as an adjuvant and many molecular and cellular mechanisms of its action as an adjuvant remain to be elucidated.

The objective of the study was to test whether the adjuvant effect of ODN can be enhanced by binding them to short, R-rich peptides which themselves have no adjuvant activity in CD8+ T cell priming. We generated potent immunogens by loading ODNs (with or without CpG motifs) to short, synthetic peptides in which a CD8+ T cell-stimulating epitope was fused to a cationic (8- to 11-mer) domain. These immunogens efficiently primed TLR9-dependent, but CD4+ T cell help-independent, CD8+ T cell responses. The effect of ODN as Th1-promoting adjuvants can thus be enhanced by binding them to R-rich peptides fused with antigenic epitopes.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

C57BL/6JBom (B6) mice (H-2b), TLR-9-/- knockout (KO) mice (14), and A{beta}-/- mice (25) were bred and kept under standard pathogen-free conditions in the animal colony of Ulm University (Ulm, Germany). Male female mice were used at 12–16 wk of age.

Cells

The H-2b (B6-derived) T lymphoma cell line RBL5 was obtained from Dr. H.-U. Weltzien (Freiburg, Germany). Hepatitis B surface Ag (HBsAg) expressing RBL5/S were stably transfected with HBsAg-encoding BMG/Sneo as described previously (26).

Recombinant HBsAg particles

HBsAg particles were obtained from Dr. K. Melber (Rhein Biotech, Dusseldorf, Germany). HBsAg was produced in the Hansenula polymorpha host strain RB10 (27). HBsAg particles were purified from crude yeast extracts by adsorption to silica gel, column chromatography, and isopycnic ultracentrifugation.

Preparation of cationic peptide/ODN vaccines

CpG containing ODN-1826 (TCCATGACGTTTCCTGACGTT; immune-stimulating (CpG-containing) sequence (ISS)-1826) and its control ODN-1982 (TCCAGGACTTCTCTCAGGTT; nonstimulating (without CpG) sequence (NSS)-1982) (28), and CpG-containing ODN-DC19 (GGtgcatcgatgcaGGGGGg; ISS-D19) and its control ODN-D (GGtgcatgcatgcaGGGGGg; NSS-D) (29, 30) were obtained from MWG (Ebersberg, Germany). Capital and lowercase letters indicate bases with phosphorothioate- and phosphodiester-modified backbones, respectively, and underlining marks CpG motifs within ODN. The non-CpG-containing ODN NSS-amp (TCATTGGAAAAGGTTCTTGGGGGGG) described previously (31) was provided by Dr. L. Deml (University of Regensburg, Regensburg, Germany). Poly (I/C) was obtained from Sigma-Aldrich (catalogue no. P-1530; St. Louis, MO). ODN were dissolved in water as a 10 mg/ml stock solution. The synthetic peptides used in the present work were obtained from Jerini BioTools (Berlin, Germany). Peptides were dissolved in water or DMSO at a concentration of 10 mg/ml. Where indicated, ODN were incubated for 30 min with peptides in PBS, pH 7.4. We injected 50 µl of PBS i.m. into each tibialis anterior muscle (or 100 µl s.c. into the base of the tail) as previously described (32, 33).

Determination of splenic CD8+ T cell frequencies

Spleen cells (1 x 107/ml) were incubated for 1 h in RPMI 1640 medium with 1 µg/ml of the indicated Ag-specific or nonspecific control peptides. Thereafter, 5 µg/ml brefeldin A (catalogue no. 15870; Sigma-Aldrich) was added, and the cultures were incubated for an additional 4 h. Cells were harvested and surface-stained with PE-conjugated anti-CD8 mAb (catalogue no. 01045B; BD PharMingen, San Diego, CA). Surface-stained cells were fixed with 2% paraformaldehyde in PBS before intracellular staining for IFN-{gamma}. Fixed cells were resuspended in permeabilization buffer (HBSS, 0.5% BSA, 0.5% saponin, and 0.05% sodium azide), incubated with FITC-conjugated anti-IFN-{gamma} mAb (catalogue no. 55441; BD PharMingen) for 30 min at room temperature, and washed twice in permeabilization buffer. Stained cells were resuspended in PBS supplemented with 0.3% (w/v) BSA and 0.1% (w/v) sodium azide. We determined the number of CD8+ IFN-{gamma}+ T cells per 105 splenic CD8+ T cells by flow cytometric analyses.

Statistical analyses

Data were analyzed using PRISM software (version 3.0; GraphPad, San Diego, CA). Values are presented as the mean ± SD. The statistical significance of differences in the mean CD8+ T cell frequencies between groups was calculated using Student’s two-tailed t test for two groups or one-way ANOVA, followed by Kruskal-Wallis test for more than three groups. A value of p < 0.05 was considered significantly different.

Determination of cytotoxicity of cationic peptides

51Cr-labeled cells (5 x 104 RBL5 cells) suspended in 250 µl of serum-free medium were incubated with the indicated amounts of peptides or peptide/ODN complexes (prepared as described above) for 30 min at room temperature. Cells were washed and cultured (2 x 103 cells/well) for 2 h in 200-µl, round-bottom wells at 37°C. Thereafter, 50 µl of supernatant was collected for gamma radiation counting (experimental release). Supernatants from untreated cells were collected for determination of spontaneous release; spontaneously released counts were always <10% of the total counts. Total release was determined by resuspending cells and measuring 50-µl cell suspensions. The mean values of six individual wells per group were always determined. The cytotoxicity was calculated as: (experimental release - spontaneous release)/(total release - spontaneous release).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Priming Kb-restricted CD8+ T cell responses to recombinant HBsAg particles is facilitated by codelivery of low doses of nucleotides bound to cationic peptides

CpG-containing ISS+ ODN facilitate priming of CD8+ T lymphocytes to exogenous protein Ags (reviewed in Ref. 1). C57BL/6 (H-2b) mice injected with HBsAg particles did not generate class I-restricted CD8+ T cell responses (19, 34). In contrast, HBsAg-specific CD8+ T cells were efficiently primed when HBsAg particles were codelivered with high doses of CpG-containing, immune-stimulating ISS+ ODN-1826 (Fig. 1A). When HBsAg was codelivered with suboptimal doses of ISS+ ODN-1826, HBsAg (S190–197)-specific, Kb-restricted CD8+ T cells were inefficiently primed (Fig. 1B, group 3). This response was detected by restimulating primed splenic CD8+ T cells ex vivo for 4 h with the HBsAg-specific, Kb-binding S190–197 peptide (Fig. 1) (35). A comparable response was detected by restimulating primed splenic CD8+ T cells ex vivo for 4 h with the naturally processed peptide (presented by RBL5/S transfectants; data not shown) (35). Primed CD8+ T cells did not respond to unspecific control peptides, and spleen cells from nonimmunized mice did not respond to this S190–197 epitope (Fig. 1). These analyses showed that the determined frequencies of IFN-{gamma}+ CD8+ T cells are specific. Mixing HBsAg with ODN without immune-stimulating CpG motifs (e.g., NSS+ ODN-1982; Fig. 1B; group 6) or with the cationic HIV-tat-derived tat49–57 9-mer peptide RKKRRQRRR did not facilitate CD8+ T cell priming to HBsAg (group 5). Mixing HBsAg particles with 35 nmol tat peptide bound to (0.5 nmol/mouse) ISS+ ODN-1826 efficiently primed CD8+ T cells (group 4). The adjuvant effect of ISS+ ODN for priming HBsAg-specific CD8+ T cell responses was reproducibly enhanced by binding low amounts of ODN-1826 to cationic tat peptides (by Student’s two-tailed t test, p < 0.05). Similar findings were observed using the HBcAg-derived cationic peptides RRRDRGRS (HBc150–157) or SPRRRRSQSPRRRRSQ (HBc164–179) (36, 37). Cationic peptide bound to NSS+ ODN-1982 had no adjuvant effect detectable in this readout (group 7) (19, 34). Hence, the Th1-promoting adjuvant effect of ISS+ ODN on priming CD8+ T cell responses to exogenous protein Ags is enhanced when these nucleotides are bound to cationic peptides.



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 1. Cationic HIV tat-derived peptide bound to CpG-containing ODN facilitates priming of CD8+ T cell responses to codelivered HBsAg particles. A, B6 mice were immunized i.m. with 3 µg/mouse HBsAg, either alone (group 1) or codelivered with 5 nmol of ISS+ ODN-1826 (group 2). Spleen cells obtained from immune mice 12 days postvaccination were restimulated in vitro (recall) with either Kb-binding S190–197 peptide or (control) SIINFEKL (OVA) peptide. Primed and restimulated CD8+ T cells were analyzed by flow cytometry. Mean numbers of splenic IFN-{gamma}+ CD8+ T cells/105 CD8+ T cells ± SD (of three or six mice per group in two independent experiments) are shown (lower panel). B, B6 mice were not immunized (group 1) or were vaccinated i.m. with 3 µg/mouse HBsAg alone (group 2), with HBsAg mixed with 0.5 nmol ISS+ ODN-1826 (group 3), with 0.5 nmol of ISS+ ODN-1826 plus 35 nmol of tat49–57 (RKKRRQRRR) peptide (group 4), with 35 nmol tat49–57 peptide (group 5), with 5 nmol of NSS+ ODN-1982 (group 6), or with 5 nmol of NSS+ ODN-1982 plus 35 nmol of tat49–57 peptide (group 7). Spleen cells obtained from vaccinated mice 12 days postvaccination were restimulated in vitro with the Kb-binding HBsAg peptide S190–197 or the Kb-binding OVA257–264 peptide SIINFEKL (Kb/OVA). Mean numbers of specific IFN-{gamma}+ CD8+ T cells/105 CD8+ T cells ± SD (of five mice per group) are shown.

 
Enhanced immunogenicity for CD8+ T cell precursors of epitopes fused to cationic peptides loaded with ODN (containing, or not containing CpG motifs)

Synthetic, antigenic peptides injected without adjuvants are poor immunogens for CD8+ T cell precursors. Instead of immunizing mice with the immunogenic HBsAg proteoliposome, we injected B6 mice with the synthetic (S190–197; VWLSVIWM) 8-mer peptide (35 nmol/mouse) that represents a Kb-restricted epitope of HBsAg (35). This did not elicit a CD8+ T cell response (Fig. 2; group 2). Neither codelivery of ISS+ ODN-1826 (group 3) or NSS+ ODN-1982 (group 4; 0.5 or 5 nmol/mouse) nor codelivery of cationic tat49–57 peptide (group 5) enhanced the immunogenicity of this antigenic peptide for CD8+ T cell precursors. Priming of low CD8+ T cell frequencies was detected when the antigenic peptide was mixed with 5 nmol, but not 0.5 nmol, tat49–57 peptide loaded with ODN-1826 (group 6). No CD8+ T cell priming was detected when the antigenic peptide was codelivered with the tat49–57 peptide loaded with NSS+ ODN-1982 (group 7). A different picture emerged when the cationic peptide was fused to the antigenic peptide, bound to ODN, and injected into mice. Injection of the 17-mer fusion peptide S190–197-tat49–57 VWLSVIWMRKKRRQRRR bound to 0.5 and 5 nmol of ISS+ ODN-1826 (group 9) or NSS+ ODN-1982 (group 10), but not without ODN (group 8), efficiently primed the CD8+ T cell response. The efficiency of CD8+ T cell priming was improved when the S190–197-tat49–57 peptide was delivered with 5 nmol ofODN (Fig. 2, compare A and B; groups 9 and 10). Statistical analysis revealed no significant difference between Kb/S190–197-specific CD8+ T cell frequencies induced by peptide-bound ISS+ (CpG-containing) ODN and NSS+ (without CpG sequences) ODN (p > 0.05). The ODN and the cationic/antigenic fusion peptides had to be injected into the same site to prime CD8+ T cells. When we injected ISS+ ODN-1826 into the muscle of the left leg and S190–197-tat49–57 fusion peptide into the muscle of the right leg, no T cells were primed (Fig. 2; group 11).



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 2. Cationic HIV tat peptide fused to an antigenic peptide and bound to ODN facilitates priming of CD8+ T cell responses. B6 mice were vaccinated i.m. with 35 nmol of peptide mixed with 0.5 nmol (A) or 5 nmol (B) ODN. Mice were injected with the HBsAg S190–197 peptide VWLSVIWM (Kb/S190–197) alone (group 2), with the S190–197 peptide mixed with ISS+ ODN-1826 (group 3) or NSS+ ODN-1982 (group 4) or mixed with the tat49–57 RKKRRQRRR peptide alone (group 5), with the tat49–57 peptide mixed with ISS+ ODN-1826 (group 6) or NSS+ ODN-1982 (group 7), with the S190–197-tat49–57 fusion peptide VWLSVIWMRKKRRQRRR alone (group 8), or with the fusion peptide mixed with ISS+ ODN-1826 (group 9) or NSS+ ODN-1982 (group 10). In control group 11, ISS+ ODN-1826 were injected into the muscle of the left leg, and S190–197-tat49–57 fusion peptide was injected into the muscle of the right leg. Spleen cells obtained from vaccinated mice 12 days postvaccination were restimulated ex vivo with S190–197 (Kb/S190–197) peptide. Specific IFN-{gamma}+ CD8+ T cells were detected by flow cytometry. Mean numbers of specific IFN-{gamma}+ CD8+ T cells/105 CD8+ T cells ± SD (of four mice per group) are shown.

 
We investigated the CD8+ T cell response to the Kb-restricted epitope T4 of the SV40 large T Ag (38, 39). Injection of various doses (0.35, 3.5, or 35 nmol) of the Kb-binding, 9-mer peptide T4 (VVYDFLKCM) (39) did not prime a CD8+ T cell response even when codelivered with ISS+ ODN-1826 or NSS+ ODN-1982 (Fig. 3; groups 2–4; data not shown). Similarly, injection of the synthetic 14-mer T4a peptide VVYDFLKVMVYNIP representing the T4 epitope extended C-terminally by five residues of the natural T Ag sequence displayed no immunogenicity for CD8+ T cells when injected with or without ODN (groups 5–7). Interestingly, the further C-terminal extension of the peptide by three cationic amino acids of the natural T Ag sequence to generate peptide T4b VVYDFLKVMVYNIPKKR (containing two K residues and one R residue) strikingly increased the immunogenicity of the T4 epitope for CD8+ T cell precursors when preincubated with ISS+ ODN-1826 (group 9) or NSS+ ODN-1982 (group 10). Cationic residues flanking an antigenic epitope within the natural sequence of the protein can thus modulate its immunogenicity for CD8+ T cells in the presence of ODN.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 3. Fusion of the SV40 T Ag-derived T4 epitope to ODN-loaded tat peptide facilitates priming of CD8+ T cell responses. B6 mice were not vaccinated (group 1) or were vaccinated i.m. with 35 nmol of T4 peptide VVYDFLKCM (Kb/T404–412; group 2) or with an equimolar dose of T4a peptide VVYDFLKCMVYNIP (Kb/T404–417; group 5), T4b peptide VVYDFLKCMVYNIPKKR (Kb/T404–420; group 8), or T4-tat fusion peptide VVYDFLKCMVYNIPKKRRQRRR (Kb/T404–417-tat50–57; group 11). In addition, mice were vaccinated with the respective peptides bound to 5 nmol of ISS+ ODN-1826 (groups 3, 6, 9, and 12) or 5 nmol of NSS+ ODN-1982 (groups 4, 7, 10, and 13). Spleen cells obtained from immune mice 12 days postvaccination were restimulated ex vivo with T4 peptide (Kb/T404–412). Mean numbers of specific IFN-{gamma}+ CD8+ T cells per 105 CD8+ T cells ± SD (of four mice per group) from one representative of three independent experiments are shown.

 
The KKR sequence in T4b is also present in the tat50–52 peptide used in the studies described above. We used a synthetic fusion peptide in which the 17-mer T4b peptide was fused C-terminally to five tat-derived residues (tat53–57) to obtain a 22-mer T4-tat fusion peptide VVYDFLKVMVYNIPKKRRQRRR. The resulting peptide contains a KKR motif identical with that in the natural T Ag sequence and a cationic tat sequence. B6 mice vaccinated by a single injection of 35 nmol of fusion peptide did not generate detectable CD8+ T cell responses (group 11). In contrast, injecting the same doses of T4-tat peptide bound to ISS+ or NSS+ ODN efficiently primed T4-specific CD8+ T cell responses (groups 12 and 13). Extension of the natural T4b peptide by a RQRRR sequence thus enhanced its immunogenicity. Again, no statistically significant differences were detectable when ISS+ or NSS+ ODN were bound to peptides (p > 0.05; Fig. 3). Hence, CD8+ T cell epitopes linked to cationic peptides loaded with ODNs and delivered by a single injection are potent immunogens for CD8+ T cells.

T4-specific CD8+ T cell lines primed by cationic fusion peptide/ODN and expanded in vitro specifically lysed T Ag-expressing, syngeneic transfectants in a 4-h 51Cr release assay (data not shown) (39). These data indicate that the primed CD8+ T cell populations are functional, displaying specifically inducible IFN-{gamma} production and cytotoxicity.

Different ODN-binding cationic peptide sequences enhance the immunogenicity of the CD8+ T cell-stimulating epitopes to which they are fused

Different cationic sequences were fused to the antigenic T4 epitope to assess their ability to facilitate the priming of T4-specific CD8+ T cell responses (Fig. 4). The T4a peptide was fused to the HIV-tat50–57 peptide (T4a-tat; VVDFLKCMVYNIPKKRRQRRR), the HBV core166–176 peptide (T4-core; VVDFLKCMVYNIPRRRRSQSPRRR), or two copies of the honey bee melittin mel21–25 peptide (T4-mel; VVDFLKCMVYNIPKRKRQKRKRQ). Injection of 35 nmol of synthetic peptide loaded with 5 nmol of NSS+ ODN-1982 (Fig. 4A) or 5 nmol of ISS+ ODN-1826 (Fig. 4B) efficiently primed Kb-restricted CD8+ T cell responses to the T4 epitope (groups 3, 5, and 7). Peptides injected without ODN were not immunogenic (groups 2, 4, and 6). Using one-way ANOVA to compare groups 3, 5, and 7, no statistically significant differences in the number of specific CD8+ T cells primed were apparent when either ISS+ or NSS+ ODN were codelivered with the different peptides (p > 0.05; Fig. 4). Hence, different cationic peptide sequences from different natural sources bound to ODN can enhance the immunogenicity of CD8+ T cell epitopes to which they are fused.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 4. Fusion of the antigenic T4 peptide to different cationic peptides and binding ODN to them creates potent immunogens for CD8+ T cells. The T4 peptide T404–417 VVYDFLKCMVYNIP was fused to cationic peptide sequences from tat (KKRRQRRR) of HIV, HBcAg (RRRRSQSPRRR) of HBV, or melittin (KRKRQKRKRQ) from the honey bee. B6 mice were vaccinated i.m. with 35 nmol of these peptides alone (groups 2, 4, and 6) or mixed with ODN (groups 3, 5, and 7), not containing (A; NSS+ ODN-1982) or containing (B; ISS+ ODN-1826) CpG motifs. Spleen cells obtained from immune mice 12 days postvaccination were restimulated ex vivo with the T4 peptide VVYDFLKCM (Kb/T404–412). Mean numbers of specific IFN-{gamma}+ CD8+ T cells per 105 CD8+ T cells ± SD (of six mice per group) averaged from two independent experiments are shown.

 
CD8+ T cell priming by T4-tat peptides bound to different ODN

Our finding that NSS+ ODN-1982 efficiently enhanced CD8+ T cell priming was unexpected (15, 16, 17, 18, 19, 20). We tested whether other NSS+ ODN exhibit a similar activity. The T4-tat peptide (35 nmol) was incubated with 5 nmol of the ODN listed in Fig. 5. Comparable CD8+ IFN-{gamma}+ T cell responses were induced when the T4-tat peptide was codelivered with three different NSS+ ODN (i.e., ODN-1982 (TCCAGGACTTCTCTCAGGTT). ODN-amp (TCATTGGAAAAGGTTC TTGGGGGGG) from the ampicillin gene (31), and ODN-D (GGtgcatgcatgcaGGGGGg; Fig. 5A; groups 2, 3, and 5) (29, 30). Injection of the T4-tat peptide bound to the ISS+ ODN-D19 (GGtgcatcgatgcaGGGGGg) (29, 30) efficiently primed comparable Kb-restricted CD8+ T cell responses to the T4 epitope (group 4). Using one-way ANOVA to compare groups 2–5, no statistically significant differences in the number of specific CD8+ T cells primed were apparent when different ODN were codelivered with T4-tat peptide (p > 0.05; Fig. 5).



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 5. CD8+ T cell priming by T4-tat fusion peptide bound to different ODN. A, B6 mice were vaccinated i.m. with 35 nmol of T4-tat fusion peptide VVYDFLKCMVYNIPKKRRQRRR (Kb/T404–417-tat50–57) alone (group 1) or mixed with 5 nmol of NSS+ ODN-amp (group 2), NSS+ ODN-1982 (group 3), ISS+ ODN-D19 (group 4), or NSS+ ODN-D (group 5). Spleen cells obtained from immune mice 12 days postvaccination were restimulated ex vivo with the T4 peptide (Kb/T404–412). Mean numbers of specific IFN-{gamma}+ CD8+ T cells per 105 CD8+ T cells ± SD (of four mice per group) from one representative of two independent experiments are shown. B, One, 10, or 35 nmol of T4-tat fusion peptide (VVYDFLKCMVYNIPKKRRQRRR) bound to 5 nmol of ISS+ ODN-1826 or NSS+ ODN-1982 was injected into B6 mice. Spleen cells obtained from immunized mice 12 days postvaccination were restimulated ex vivo with T4 peptide VVYDFLKCM (Kb/T404–412). Mean numbers of specific IFN-{gamma}+ CD8+ T cells per 105 CD8+ T cells ± SD (of four mice per group) from one representative of two independent experiments are shown.

 
We incubated 1, 10, or 35 nmol of T4-tat peptide with a constant amount of ISS+ ODN-1826 or NSS+ ODN-1982 to determine their relative potencies in priming of T4-specific CD8+ T cell responses (Fig. 5B). Both ODNs primed comparable numbers of specific CD8+ T cells (Fig. 5B). A single immunization using 1 nmol of T4-tat peptide (i.e., 2.9 µg of T4-tat peptide/mouse) bound to ODN primed CD8+ T cell responses. The size of the T4-specific CD8+ T cell population primed increased in a dose-dependent manner when 1, 10, or 35 nmol of T4-tat peptide was codelivered with ODN (Fig. 5B). No statistically significant difference between the size of the specific CD8+ T cell populations primed by peptide bound to ISS+ or NSS+ ODN was apparent (data not shown). Hence, different ODN (with or without CpG motifs) enhance the immunogenicity of the fusion peptides to which they bind.

Specific CD8+ T cell immunity primed by peptides fused to ODN-loaded cationic peptides persists for many months at a high level

A single injection into mice of a DNA vaccine encoding the SV40 T Ag (pCI/T) primed, Kb-restricted, T4-specific CD8+ T cells (Fig. 6A). The highest numbers of specific CD8+ T cells induced by the pCI/T plasmid DNA vaccine were measured in spleen 10–14 days postinjection, but elevated numbers of specific splenic CD8+ T cells were detectable for >50 days postvaccination. This course of CD8+ T cell response is reproducibly observed in mice after a single injection of DNA vaccines encoding different Ags (data not shown). In contrast, the numbers of specific CD8+ T cells primed by T4-tat fusion peptide bound to NSS+ ODN-1982 or ISS+ ODN-1826 reached a high level 12–21 days postvaccination and remained high for 50 days (Fig. 6A). Codelivery of ODN-loaded peptides with the antigenic peptide hence induces high numbers of persisting, functional CD8+ T cells after a single immunization.



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 6. Longevity of primed CD8+ T cell responses induced by ODN bound to T4-tat peptide. A, Into B6 mice, 35 nmol of T4-tat fusion peptide VVYDFLKCMVYNIPKKRRQRRR bound to 5 nmol of ISS+ ODN-1826 or NSS+ ODN-1982 was injected i.m. Control mice were immunized i.m. with 100 µg of SV40 T Ag-encoding pCI/T plasmid DNA or noncoding pCI plasmid DNA. Spleen cells obtained from immunized mice at different time points between days 7 and 49 postvaccination were restimulated ex vivo with RBL5 cells pulsed with the T4 peptide VVYDFLKCM (Kb/T404–412). Mean numbers of specific IFN-{gamma}+ CD8+ T cells per 105 CD8+ T cells ± SD (of five mice per group) averaged from two independent experiments are shown. B, The S190–197-tat50–57 fusion peptide VWLSVIWMKKRRQRRR (•), the S208–215-tat50–57 fusion peptide ILSPFLPLKKRRQRRR ({circ}), or the OVA257–264-melittin21–25/21–25 fusion peptide SIINFEKLKRKRQKRKRQ (*) bound to 35 nmol of ISS+ ODN 1826 were injected into B6 mice. Spleen cells obtained from mice 12, 28, and 48 days postvaccination were restimulated ex vivo with the respective Kb-binding S190–197 peptide (•), S208–215 peptide ({circ}), or OVA257–264 peptide (*). Mean numbers of specific IFN-{gamma}+ CD8+ T cells per 105 CD8+ T cells ± SD (of four mice per group) from one representative of two independent experiments are shown.

 
We fused different Kb-binding epitopes to cationic peptides (Fig. 6B). These included the HBsAg epitopes S190–197 VWLSVIWM and S208–215 ILSPFLPL (35) fused to the tat50–57 sequence, and the OVA257–264 epitope SIINFEKL fused to the melittin-derived cationic sequence. These peptides (35 nmol) bound to ODN-1826 (5 nmol) were injected into B6 mice. Specific CD8+ IFN-{gamma}+ T cell numbers determined 12, 28, and 48 days postimmunization showed that long-lasting CD8+ T cell responses to the SIINFEKL and the VWLSVIWM epitopes were detectable (Fig. 6B). In contrast, CD8+ T cells specific for the ILSPFLPL epitope (with low immunogenicity) were difficult to detect after the third week postvaccination. Thus, the immunogenicity of the MHC-I binding peptide has an influence on the magnitude and longevity of CD8+ T cell responses.

Binding ODN attenuates the cytotoxicity of cationic peptides

Cationic peptides quantitatively bind to ODN (Fig. 7A). A constant amount of ODN-1982 was incubated with increasing amounts of T4-tat peptide. Samples were subjected to agarose gel electrophoresis, followed by ethidium bromide staining of the gels. This revealed that >=30 nmol of the T4-tat peptide was required to quantitatively bind 5 nmol of ODN, as determined by the failure of peptide/ODN complexes to migrate into the gels (Fig. 7A). Similar results were obtained when different ODN were tested in these assays (data not shown).



View larger version (54K):
[in this window]
[in a new window]
  		FIGURE 7. Binding of ODN to cationic peptides attenuates their cytotoxicity. A, Quantitative binding of ODN to cationic peptides. A constant amount of ODN (5 nmol) was incubated with the indicated amounts of cationic T4-tat peptide (for 30 min at room temperature in 100 µl of PBS, pH 7.4). Samples were subjected to agarose gel electrophoresis, followed by ethidium bromide staining. Free ODN (arrow) and peptide-bound ODN not migrating into the gel (dashed arrow) are indicated. B, 51Cr-labeled RBL5 cells (5 x 104 cells) were incubated with the indicated amounts of the T4 peptide VVYDFLKCM, T4-tat fusion peptide VVYDFLKCMVYNIPKKRRQRRR), S190–197 peptide VWLSVIWM, or S190–197-tat49–57 fusion peptide VWLSVIWMRKKRRQRRR (left panel) or with preformed peptide/ODN complexes obtained with 35 nmol of peptides incubated with titrated amounts of ODN-1982 (0.1–50 nmol; right panel). Cytotoxicity was determined in a 4-h 51Cr release assay (as described in Materials and Methods).

 
Cationic peptides are cytotoxic for cells, but ODN binding to cationic peptides attenuated their cytotoxicity (Fig. 7B). This was shown by incubating 51Cr-labeled cells with either increasing concentrations of the cationic T4-tat or S190–197-tat peptides (left panel) or with a constant, cytolytic concentration of cationic peptide (35 nmol) mixed with increasing concentrations of ODN-1982 (right panel). Above a threshold of 5 nmol, the tat-containing fusion peptide showed a dose-dependent increase in cytotoxicity, evidenced by increasing 51Cr release (Fig. 7B). The cytotoxicity of 35 nmol of cationic T4-tat or S190–197-tat peptide was quantitatively neutralized by binding >=5 nmol of ODN-1982 (Fig. 7B), indicating that ODN quantitatively interact with cationic T4-tat or S190–197-tat peptides. Similar data were obtained when ODN-1826 was used (data not shown). These data fit well with the binding analyses (Fig. 7A). Cationic peptide/ODN complexes thus have lower cytotoxicity than free cationic peptides, a finding expected to improve their safety profile as adjuvant.

CD8+ T cell priming by cationic peptide/ODN complexes is TLR9 dependent

We investigated priming of Kb-restricted, T4-specific CD8+ T cell responses by T4-tat fusion peptide complexes to either ISS+ ODN-1826 or NSS+ ODN-1982 in TLR9-competent or TLR9-deficient B6 mice (Fig. 8). Normal B6 mice and TLR9-/- KO B6 mice generated no T4-specific T cell response after injections of various doses of the native T4-tat fusion peptide (group 2). The T4-tat peptide bound to either ISS+ ODN-1826 (group 3) or NSS+ ODN-1982 (group 4) stimulated a T4-specific CD8+ T cell response in B6 mice. These T cell responses were strikingly reduced or completely absent in TLR9-/- KO B6 mice (Fig. 8; groups 3 and 4). Cationic T4-tat peptide efficiently binds to poly I/C (data not shown). In contrast, TLR9-/- KO B6 mice developed potent T4-specific CD8+ T cell reactivities in response to a single injection of either a T Ag-encoding DNA vaccine (Fig. 8; group 6) or the T4-tat peptide bound to the RNA homologue poly I/C (Fig. 8; group 5); the T4-specific CD8+ T cell responses primed in B6 and TLR9-/- KO B6 mice were of comparable magnitude (Fig. 8; groups 5 and 6). Regardless of whether they contained or lacked a CpG motif, the adjuvant effect of ODN bound to cationic peptides was thus TLR9 dependent.



View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 8. The priming of CD8+ T cell responses by ODN/T4-tat complexes is TLR-9-dependent. TLR9-deficient (TLR-9-/- KO) and normal congenic B6 mice were vaccinated i.m. with 35 nmol of T4-tat fusion peptide VVYDFLKCMVYNIPKKRRQRRR alone (group 2) or mixed with 5 nmol of ISS+ ODN-1826 (group 3) or NSS+ ODN-1982 (group 4) or with 200 µg of poly I/C (group 5). A control group was vaccinated i.m. with 100 µg of pCI/T plasmid DNA encoding T Ag (group 6). Spleen cells obtained from immunized mice 12 days postvaccination were restimulated ex vivo with the T4 peptide VVYDFLKCM (Kb/T404–412). Mean numbers of splenic IFN-{gamma}+ CD8+ T cells per 105 CD8+ T cells ± SD (of four mice per group) from one representative of two independent experiments are shown.

 
Priming CD8+ T cell responses facilitated by cationic peptide/ODN complexes is CD4 T cell independent

To test whether CD8+ T cell priming facilitated by cationic peptide/ODN complexes is independent of CD4+ T cell help, we immunized MHC class II-deficient (A{beta}-/- KO) B6 mice. Normal or mutant (A{beta}-/-) B6 mice were immunized with T4-tat fusion peptide complexed to either ISS+ ODN-1826 or NSS+ ODN-1982 (Fig. 9). Comparable numbers of T4-specific CD8+ T cells were detected in normal and mutant (A{beta}-/-) B6 mice 12 days after a single injection of the T4-tat peptide bound to either ISS+ ODN-1826 (group 3) or NSS+ ODN-1982 (group 4). The T4-tat/ODN complex-facilitated priming of virus-specific CD8+ T cell responses is thus independent of CD4+ T cell help.



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 9. Priming specific CD8+ T cell responses with ODN/T4-tat complexes is CD4+ T cell independent. Normal B6 mice or congenic, MHC class II-deficient (A{beta}-/- KO) B6 mice were vaccinated i.m. with 35 nmol of T4-tat fusion peptide VVYDFLKCMVYNI PKKRRQRRR alone alone (group 2) or mixed with 5 nmol of ISS+ ODN-1826 (group 3) or NSS+ ODN-1982 (group 4). Spleen cells obtained from immunized mice 12 days postvaccination were restimulated ex vivo with the T4 peptide VVYDFLKCM (Kb/T404–412). Mean numbers of specific IFN-{gamma}+ CD8+ T cells per 105 CD8+ T cells ± SD (of five mice per group) averaged from two independent experiments are shown.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Regardless of their sequence, ODN/cationic peptide complexes are potent tools for priming CD8+ T cell immunity. The optimal complex formulation 1) required covalent linkage between the antigenic epitope and the ODN-loaded cationic peptide, 2) operated efficiently with many different antigenic (MHC class I-binding) epitopes, 3) was optimal with a sequence containing many R and/or K residues, but did not require a particular sequence of the cationic peptide, 4) showed attenuated toxicity of the cationic peptides for cells, 5) displayed TLR9-dependent activity, and 6) supported CD4+ T cell help-independent CD8+ T cell priming.

The complex formation required electrostatic linkage of the positively charged peptide (yielding an antigenic epitope fused to a cationic domain) to the negatively charged ODN. Conjugation of immunostimulatory DNA or ODN to protein Ags facilitates the rapid, long-lasting, and potent induction of cell-mediated immunity (40). This suggests that codelivery of the Ag and the costimulatory signals to the same APC facilitates CD8+ T cell priming in situ. In this study we used small, synthetic peptides to test the concept. We found that only simple mixing of ODN with antigenic peptide is required to formulate a vaccine. Linking small cationic peptides to large protein Ags or cationic domains within large protein Ags loaded with ODN may similarly enhance their immunogenicity for CD8+ T cells. We reported that the C-terminal, R-rich domain of HBcAg is essential for the Th1 immunity-inducing activity of this viral nucleocapsid (36, 37). Many viral (nucleo)proteins have similar RNA and DNA binding domains. Internal or N/C-terminal stretches of cationic residues may hence modulate the type of cellular immunity that the Ag induces. The adjuvant we designed by combining simple, synthetic modules may mimic a feature inherent in many microbial Ags.

We have tested different antigenic peptides, i.e., different HBV Ags, OVA, and SV40 T Ag (Fig. 6). The immunogenicity of all epitopes tested was strikingly enhanced by fusing them to cationic peptides, followed by ODN loading. Similarly, we tested different cationic peptides from HIV, HBV, or the honey bee (Figs. 4 and 6). We found no evidence for a sequence-specific variability in their potency as adjuvants within this small sample of cationic peptides tested. The data indicate that many epitopes and many cationic peptides can be used for designing CD8+ T cell-stimulating vaccines to various pathogens.

The mechanism of uptake of cationic peptides or ODN by cells is unresolved. CpG-containing ODN covalently coupled to OVA shift uptake of OVA by immature DC from inefficient fluid phase pinocytosis to efficient receptor-mediated endocytosis. Uptake of OVA conjugated with either stimulatory (ISS) or nonstimulatory (NSS) ODN is equally enhanced, but only stimulatory ODN cross-linked to OVA provide the DC maturation signal required to trigger primary CD8+ T cell responses (41). Our data suggest that ODN bound to cationic peptides are efficiently taken up by APCs and can signal through TLR9 regardless of their CpG content.

Cationic peptides pass membranes in an unusual, energy-independent manner. They are not internalized by endocytosis or macropinocytosis (2, 3, 4). Many of the cationic peptides are toxic for cells, as confirmed in this study by the strong and rapid 51Cr release from cells incubated with cationic peptides. It is unclear why cationic peptides are toxic. This toxicity seems to vary between different cationic peptides. Binding to ODN attenuates this toxicity in a dose-dependent way. It is unknown whether cationic peptides bound to ODN are taken up by cells by an alternative route. ODN signal in intracellular, vesicular compartments that operate through TLR9 and requires CpG motifs in their sequence. We demonstrate that ODN without CpG motifs were equally effective in providing adjuvant activity for CD8+ T cell priming when bound to cationic peptides. The adjuvants effect of ODN without CpG motifs was also dependent on TLR9. The data indicate that the motif requirements of polynucleotides for TLR9 signaling can be overcome when nucleotides are delivered to the cell as complexes with cationic peptides.

Some cationic peptides, such as polylysines or polyarginines, are adjuvants (42, 43). The cationic peptides we used did not facilitate CD8+ T cell priming when delivered without ODN, as evident from the data in this study. Enhanced peptide-specific immune responses have been induced by a synthetic vaccine composed of antigenic peptides (T cell epitopes), ODN with CpG motifs, and poly-L-arginine (44). High numbers of Ag-specific CD8+ T cells were observed for >300 days, and the potentially harmful systemic release of proinflammatory cytokines induced by injection of CpG-containing ODN was attenuated. In the described vaccine the antigenic peptide and the cationic peptide were not linked, and the sequence requirement of the ODN was not investigated. Our data indicate that targeting the adjuvants and the epitope is essential for potentiating the induction of T cell immunity, and that sequence requirements for ODN are relaxed when they are delivered in this novel way.

As they have adjuvant effects independent of each other, both cationic peptides and ODN can apparently signal. Signals triggered by cationic peptides are not defined; signals triggered by CpG-containing ODNs are TLR9 dependent. Signals (and the adjuvant effect) of the cationic peptide/ODN complexes are TLR9 dependent, as shown in this report. It is unknown if these signals differ from those triggered by "naked" CpG-containing ODNs. TLR9 signaling may interference with signals triggered by cationic peptides or vice versa. The coactivation of signaling by cationic peptides may relax the stringency of sequence requirements for the triggering ODN.

The practical implication of the study is that efficient, direct (CD4+ T cell help-independent) and long-lasting priming of stable CD8+ T cell immunity has been achieved by combining two simple, safe, and synthetic adjuvants. The formulation can be expected to improve the safety profile of the individual components of the adjuvants and will be effective at considerably lower doses. The technology seems to mimic a principle that operates in the induction of CD8+ T cell immunity to many viruses.


   Acknowledgments
 
We thank Tanja Güntert and Katrin Ölberger for excellent technical assistance. We greatly appreciate the many helpful comments and suggestions from Dr. A. Krieg (Wellesley, MA). We thank Drs. L. Deml (University of Regensburg, Regensburg, Germany) and K. Melber (Rhein-Biotech, Dusseldorf, Germany) for valuable reagents.


   Footnotes
 
1 This work was supported by grants (to R.S. and J.R.) from the German Federal Ministry for Science and Technology (01GE9907) and the University of Ulm (IZKF/H7). Back

2 Address correspondence and reprint requests to Dr. Reinhold Schirmbeck, Institute for Medical Microbiology and Immunology, University of Ulm, Albert Einstein Allee 11, D-89081 Ulm, Germany. E-mail address: reinhold.schirmbeck{at}medizin.uni-ulm.de Back

3 Abbreviations used in this paper: TLR, Toll-like receptor; DC, dendritic cell; HBV, hepatitis B virus; HBsAg, hepatitis B surface Ag; ISS, immune-stimulating (CpG-containing) sequence; KO, knockout; NSS, nonstimulating sequence (without CpG); ODN, oligodeoxynucleotide; S, small HBsAg. Back

Received for publication April 7, 2003. Accepted for publication September 11, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Krieg, A. M.. 2002. CpG motifs in bacterial DNA and their immune effects. Annu. Rev. Immunol. 20:709.[Medline]
  2. Futaki, S.. 2002. Arginine-rich peptides: potential for intracellular delivery of macromolecules and the mystery of the translocation mechanisms. Int. J. Pharmacol. 245:1.
  3. Lindsay, M. A.. 2002. Peptide-mediated cell delivery: application in protein target validation. Curr. Opin. Pharmacol. 2:587.[Medline]
  4. Ye, D., D. Xu, A. U. Singer, R. L. Juliano. 2002. Evaluation of strategies for the intracellular delivery of proteins. Pharm. Res. 19:1302.[Medline]
  5. Futaki, S., I. Nakase, T. Suzuki, Z. Youjun, Y. Sugiura. 2002. Translocation of branched-chain arginine peptides through cell membranes: flexibility in the spatial disposition of positive charges in membrane-permeable peptides. Biochemistry 41:7925.[Medline]
  6. Futaki, S., T. Suzuki, W. Ohashi, T. Yagami, S. Tanaka, K. Ueda, Y. Sugiura. 2001. Arginine-rich peptides: an abundant source of membrane-permeable peptides having potential as carriers for intracellular protein delivery. J. Biol. Chem. 276:5836.[Abstract/Free Full Text]
  7. Pooga, M., U. Soomets, M. Hallbrink, A. Valkna, K. Saar, K. Rezaei, U. Kahl, J. X. Hao, X. J. Xu, Z. Wiesenfeld-Hallin, et al 1998. Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in vivo. Nat. Biotechnol. 16:857.[Medline]
  8. Cutrona, G., E. M. Carpaneto, M. Ulivi, S. Roncella, O. Landt, M. Ferrarini, L. C. Boffa. 2000. Effects in live cells of a c-myc anti-gene PNA linked to a nuclear localization signal. Nat. Biotechnol. 18:300.[Medline]
  9. Stock, R. P., A. Olvera, S. Scarfi, R. Sanchez, M. A. Ramos, L. C. Boffa, U. Benatti, O. Landt, A. Alagon. 2000. Inhibition of neomycin phosphorotransferase expression in Entamoeba histolytica with antisense peptide nucleic acid (PNA) oligomers. Arch. Med. Res. 31:S271.[Medline]
  10. Stock, R. P., A. Olvera, R. Sanchez, A. Saralegui, S. Scarfi, R. Sanchez-Lopez, M. A. Ramos, L. C. Boffa, U. Benatti, A. Alagon. 2001. Inhibition of gene expression in Entamoeba histolytica with antisense peptide nucleic acid oligomers. Nat. Biotechnol. 19:231.[Medline]
  11. Astriab-Fisher, A., D. Sergueev, M. Fisher, B. R. Shaw, R. L. Juliano. 2002. Conjugates of antisense oligonucleotides with the Tat and antennapedia cell-penetrating peptides: effects on cellular uptake, binding to target sequences, and biologic actions. Pharm. Res. 19:744.[Medline]
  12. Britigan, B. E., T. S. Lewis, M. Waldschmidt, M. L. McCormick, A. M. Krieg. 2001. Lactoferrin binds CpG-containing oligonucleotides and inhibits their immunostimulatory effects on human B cells. J. Immunol. 167:2921.[Abstract/Free Full Text]
  13. Gorgani, N. N., B. A. Smith, D. H. Kono, A. N. Theofilopoulos. 2002. Histidine-rich glycoprotein binds to DNA and Fc{gamma}RI and potentiates the ingestion of apoptotic cells by macrophages. J. Immunol. 169:4745.[Abstract/Free Full Text]
  14. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, et al 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  15. Carson, D. A., E. Raz. 1997. Oligonucleotide adjuvants for T helper 1 (Th1)-specific vaccination. J. Exp. Med. 186:1621.[Free Full Text]
  16. Brazolot, M. C., R. Weeratna, A. M. Krieg, C. A. Siegrist, and H. L. Davis. 1998. CpG DNA can induce strong Th1 humoral and cell-mediated immune responses again15558.
  17. Sun, S., H. Kishimoto, J. Sprent. 1998. DNA as an adjuvant: capacity of insect DNA and synthetic oligodeoxynucleotides to augment T cell responses to specific antigen. J. Exp. Med. 187:1145.[Abstract/Free Full Text]
  18. Oxenius, A., M. M. Martinic, H. Hengartner, P. Klenerman. 1999. CpG-containing oligonucleotides are efficient adjuvants for induction of protective antiviral immune responses with T-cell peptide vaccines. J. Virol. 73:4120.[Abstract/Free Full Text]
  19. Schirmbeck, R., K. Melber, J. Reimann. 1999. Adjuvants that enhance priming of cytotoxic T cells to a Kb-restricted epitope processed from exogenous but not endogenous hepatitis B surface antigen. Int. Immunol. 11:1093.[Abstract/Free Full Text]
  20. Warren, T. L., S. K. Bhatia, A. M. Acosta, C. E. Dahle, T. L. Ratliff, A. M. Krieg, G. J. Weiner. 2000. APC stimulated by CpG oligodeoxynucleotide enhance activation of MHC class I-restricted T cells. J. Immunol. 165:6244.[Abstract/Free Full Text]
  21. Wild, J., M. J. Grusby, R. Schirmbeck, J. Reimann. 1999. Priming MHC-I-restricted, cytotoxic T lymphocyte responses to exogenous hepatitis B surface antigen is CD4+ T cell-dependent. J. Immunol. 163:1880.[Abstract/Free Full Text]
  22. Krieg, A. M., H. L. Love, A. K. Yi, J. T. Harty. 1998. CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J. Immunol. 161:2428.[Abstract/Free Full Text]
  23. Redford, T. W., A. K. Yi, C. T. Ward, A. M. Krieg. 1998. Cyclosporin A enhances IL-12 production by CpG motifs in bacterial DNA and synthetic oligodeoxynucleotides. J. Immunol. 161:3930.[Abstract/Free Full Text]
  24. Walker, P. S., K. T. Scharton, A. M. Krieg, H. L. Love, E. D. Rowton, M. C. Udey, J. C. Vogel. 1999. Immunostimulatory oligodeoxynucleotides promote protective immunity and provide systemic therapy for leishmaniasis via IL-12- and IFN-{gamma}-dependent mechanisms. Proc. Natl. Acad. Sci. USA 96:6970.[Abstract/Free Full Text]
  25. Cardell, S., S. Tangri, S. Chan, M. Kronenberg, C. Benoist, D. Mathis. 1995. CD1-restricted CD4+ T cells in major histocompatibility complex class II-deficient mice. J. Exp. Med. 182:993.[Abstract/Free Full Text]
  26. Schirmbeck, R., K. Melber, A. Kuhröber, Z. A. Janowicz, J. Reimann. 1994. Immunization with soluble hepatitis B virus surface (S) protein particles elicits murine H-2 class I-restricted CD8+ cytotoxic T lymphocyte responses in vivo. J. Immunol. 152:1110.[Abstract]
  27. Janowicz, Z. A., K. Melber, A. Merckelbach, E. Jacobs, N. Harford, M. Comberbach, C. P. Hollenberg. 1991. Simultaneous expression of the S and L surface antigens of hepatitis B, and formation of mixed particles in the methylotrophic yeast, Hansenula polymorpha. Yeast 7:431.[Medline]
  28. Ballas, Z. K., A. M. Krieg, T. Warren, W. Rasmussen, H. L. Davis, M. Waldschmidt, G. J. Weiner. 2001. Divergent therapeutic and immunologic effects of oligodeoxynucleotides with distinct CpG motifs. J. Immunol. 167:4878.[Abstract/Free Full Text]
  29. Verthelyi, D., K. J. Ishii, M. Gursel, F. Takeshita, D. M. Klinman. 2001. Human peripheral blood cells differentially recognize and respond to two distinct CPG motifs. J. Immunol. 166:2372.[Abstract/Free Full Text]
  30. Hemmi, H., T. Kaisho, K. Takeda, S. Akira. 2003. The roles of Toll-like receptor 9, MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of two distinct CpG DNAs on dendritic cell subsets. J. Immunol. 170:3059.[Abstract/Free Full Text]
  31. Sato, Y., M. Roman, H. Tighe, D. Lee, M. Corr, M.-D. Nguyen, G. J. Silverman, M. Lotz, D. A. Carson, E. Raz, et al 1996. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 273:352.[Abstract]
  32. Schirmbeck, R., W. Boehm, K.-I. Ando, F. V. Chisari, J. Reimann. 1995. Nucleic acid vaccination primes hepatitis B surface antigen-specific cytotoxic T lymphocytes in nonresponder mice. J. Virol. 69:5929.[Abstract]
  33. Boehm, W., A. Kuhröber, T. Paier, T. Mertens, J. Reimann, R. Schirmbeck. 1996. DNA vector constructs that prime hepatitis B surface antigen-specific cytotoxic T lymphocyte and antibody responses in mice after intramuscular injection. J. Immunol. Methods 193:29.[Medline]
  34. Schirmbeck, R., J. Reimann. 2001. Modulation of gene-gun-mediated Th2 immunity to hepatitis B surface antigen by bacterial CpG motifs or IL-12. Intervirology 44:115.[Medline]
  35. Schirmbeck, R., W. Boehm, N. Fissolo, K. Melber, J. Reimann. 2003. Different immunogenicity of H-2 Kb-restricted epitopes in natural variants of the hepatitis B surface antigen. Eur. J. Immunol. 33:2429.[Medline]
  36. Riedl, P., D. Stober, C. Oehninger, K. Melber, J. Reimann, R. Schirmbeck. 2002. Priming Th1 immunity to viral core particles is facilitated by trace amounts of RNA bound to its arginine-rich domain. J. Immunol. 168:4951.[Abstract/Free Full Text]
  37. Riedl, P., M. Buschle, J. Reimann, R. Schirmbeck. 2002. Binding immune-stimulating oligonucleotides to cationic peptides from viral core antigen enhances their potency as adjuvants. Eur. J. Immunol. 32:1709.[Medline]
  38. Mylin, L. M., T. D. Schell, D. Roberts, M. Epler, A. Boesteanu, E. J. Collins, J. A. Frelinger, S. Joyce, S. S. Tevethia. 2000. Quantitation of CD8+ T-lymphocyte responses to multiple epitopes from simian virus 40 (SV40) large T antigen in C57BL/6 mice immunized with SV40, SV40 T-antigen-transformed cells, or vaccinia virus recombinants expressing full-length T antigen or epitope minigenes. J. Virol. 74:6922.[Abstract/Free Full Text]
  39. Schirmbeck, R., W. Boehm, J. Reimann. 1996. DNA vaccination primes MHC class I-restricted, simian virus 40 large tumor antigen-specific cytotoxic T lymphocytes in H-2d mice that reject syngeneic tumors. J. Immunol. 157:3550.[Abstract]
  40. Tighe, H., K. Takabayashi, D. Schwartz, R. Marsden, L. Beck, J. Corbeil, D. D. Richman, J. Eiden-JJ, H. L. Spiegelberg, E. Raz. 2000. Conjugation of protein to immunostimulatory DNA results in a rapid, long-lasting and potent induction of cell-mediated and humoral immunity. Eur. J. Immunol. 30:1939.[Medline]
  41. Maurer, T., A. Heit, H. Hochrein, F. Ampenberger, M. O’Keeffe, S. Bauer, G. B. Lipford, R. M. Vabulas, H. Wagner. 2002. CpG-DNA aided cross-presentation of soluble antigens by dendritic cells. Eur. J. Immunol. 32:2356.[Medline]
  42. Luhrs, P., W. Schmidt, R. Kutil, M. Buschle, S. N. Wagner, G. Stingl, A. Schneeberger. 2002. Induction of specific immune responses by polycation-based vaccines. J. Immunol. 169:5217.[Abstract/Free Full Text]
  43. Mattner, F., J. K. Fleitmann, K. Lingnau, W. Schmidt, A. Egyed, J. Fritz, W. Zauner, B. Wittmann, I. Gorny, M. Berger, et al. 2002. Vaccination with poly-L-arginine as immunostimulant for peptide vaccines: induction of po-1480.
  44. Lingnau, K., A. Egyed, C. Schellack, F. Mattner, M. Buschle, W. Schmidt. 2002. Poly-L-arginine synergizes with oligodeoxynucleotides containing CpG-motifs (CpG-ODN) for enhanced and prolonged immune responses and prevents the CpG-ODN-induced systemic release of pro-inflammatory cytokines. Vaccine 20:3498.[Medline]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
R. S. Kornbluth and G. W. Stone
Immunostimulatory combinations: designing the next generation of vaccine adjuvants
J. Leukoc. Biol., November 1, 2006; 80(5): 1084 - 1102.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Cooper and Y. Shaul
Clathrin-mediated Endocytosis and Lysosomal Cleavage of Hepatitis B Virus Capsid-like Core Particles
J. Biol. Chem., June 16, 2006; 281(24): 16563 - 16569.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
P. J. Wettstein, N. D. Borson, J. G. Park, K. T. McNallan, and A. M. Reed
Cysteine-Tailed Class I-Binding Peptides Bind to CpG Adjuvant and Enhance Primary CTL Responses
J. Immunol., September 15, 2005; 175(6): 3681 - 3689.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
N. Dikopoulos, A. Bertoletti, A. Kroger, H. Hauser, R. Schirmbeck, and J. Reimann
Type I IFN Negatively Regulates CD8+ T Cell Responses through IL-10-Producing CD4+ T Regulatory 1 Cells
J. Immunol., January 1, 2005; 174(1): 99 - 109.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles