| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Induces the Human IL-10 Gene by Recruiting Both IFN Regulatory Factor 1 and Stat31
,
* Institute for Immunology, University of Munich, Munich, Germany;
Division of Immunology, University of Leicester, Leicester, United Kingdom;
Institute of Mammalian Genetics, GSF National Research Center for Environment and Health, Neuherberg and Genomatix Software, Munich, Germany; and
Clinical Cooperation Group Aerosols in Medicine, GSF National Research Center for Environment and Health, Institute for Inhalation Biology and Asklepios Hospitals, Gauting, Germany
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
will induce the binding of IRF-1 and Stat3 to the respective motifs. Mutational analysis revealed that inactivation of the IRF-1 motif substantially reduces trans-activation from 5- to 2-fold and that inactivation of the Stat3 motif completely ablates trans-activation by IFN-. The dominant role of Stat3 in this module was confirmed with the blockade of trans-activation by a dominant negative Stat3. By contrast, Stat1 contributes a minor proportion to the DNA binding to the Stat site, and overexpression will counteract Stat3-mediated trans-activation. The data show that IFN- induces the IL-10 gene via a module consisting of interdependent IRF-1 and Stat3 motifs. Of note, LPS-induced trans-activation does not target this module, since it is independent of the IRF-1 motif but completely depends on Stat3. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(9). In a previous study we have shown that expression of the human IL-10 gene after LPS stimulation of a B cell line is controlled by the transcription factor Stat3, which binds to a single motif at -120 bp (10).
IL-10 is also regulated by IFNs. Specifically, IFN-
will down-regulate IL-10 (11), while the type I IFN, IFN-, will up-regulate IL-10 expression (12). IFN- exerts most of its activities via the transcription factor complex ISGF3 (Stat1 + Stat2 + p48) and via IFN regulatory factor-1 (IRF-1) (13).
When analyzing the human IL-10 promoter by MatInspector (14), we noted an IRF-1 motif at -180 bp upstream of the transcription start. Based on the conservation of the IRF and Stat motifs in the mouse at a similar distance, the in silico analysis predicted these two sites to form a module of interdependent elements (15). We show herein that IFN- does, in fact, use the IRF-1 site within the human IL-10 promoter, but on its own the IFN--induced IRF-1 is unable to trans-activate the IL-10 gene. Cooperation with the concomitantly induced Stat3 is absolutely required to induce the expression of IL-10. Thus, we experimentally confirm the in silico prediction of an IRF-1/Stat3 module that is used by IFN- (but not by LPS) in the human IL-10 gene.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The human RPMI 8226.1 B cell line (16) was grown in RPMI 1640 culture medium supplemented with 2 mM L-glutamine (25030-024; Life Technologies, Gaithersburg, MD), 200 U/ml penicillin, 200 µg/ml streptomycin (15140-114; Life Technologies), 1x nonessential amino acids (11140-035; Life Technologies), and 1% (v/v) OPI supplement (O-5003; Sigma-Aldrich, Munich, Germany). This medium was passed through a Gambro U-2000 ultrafiltration column (Gambro Medizintechnik, Planegg-Martinsried, Germany) to deplete contaminating LPS, and this was followed by the addition of 10% v/v low LPS FCS (477U; Seromed, Berlin, Germany). RPMI 8226.1 cells were passaged in 75-cm2 tissue culture flasks (Costar, Bodenheim, Germany).
HEK 293 cells (17) were grown in culture medium in six-well plates (no. 3506; Costar, Cambridge, MA). LPS from Salmonella minnesota was obtained from Sigma-Aldrich (L6261). IFN-2b (intron A) was provided by Essex Pharma (Munich, Germany).
ELISA
IL-10 protein was determined in a sandwich ELISA using a biotinylated second Ab and streptavidin-peroxidase for detection (M1910 Pelikine Compact Plus and M1980 Pelikine Tool Set; CLB, Amsterdam, The Netherlands).
Sequence analysis
Analysis of the sequences for transcription factor binding sites was conducted with the program MatInspector Professional (Genomatix Software, Munich, Germany) based on the MatInspector program (14) using the selected matrix library (vertebrate section) and optimized thresholds. Modules were detected by comparative analysis of the human and mouse IL-10 promoter sequences identifying modular conservation of binding sites in analogy to the NF-
B/IRF module in the HLA class I genes (15).
Gel shift analysis
Nuclear extracts were isolated according to the method described by Dignam et al. (18) in the presence of a protease inhibitor mixture (10 µg/ml aprotinin (A6279; Sigma-Aldrich), 1 mM PMSF (P7626; Sigma-Aldrich), 40 µg/ml leupeptin-propionyl (L3402; Sigma-Aldrich), 20 µg/ml leupeptin-acetate (L2023; Sigma-Aldrich), 20 µg/ml antipain (A6191; Sigma-Aldrich), 20 µg/ml pepstatin A (P4265; Sigma-Aldrich), 400 µM ALLN (A6185; Sigma-Aldrich), and 2 mM DTT (11474; Merck, Rahway, NJ)). Five micrograms of nuclear protein was then admixed with 32P-labeled double-stranded IRF oligonucleotide (GATGCAAAAATTGAAAACTAAGT) or with the LS4 oligonucleotide (ATCCTGTGCCGGGAAACC) in the presence of 0.5 µg of poly(dI-dC) (US20539; Amersham Pharmacia Biotech, Arlington Heights, IL) and 1 mg/ml BSA (A2153; Sigma-Aldrich) per 20 µl. After 20 min of incubation at 21°C, samples were electrophoresed on nondenaturing polyacrylamide gels in 0.25x TBE buffer (22.5 mM Tris borate and 0.5 mM EDTA, pH 8.5). For supershift analysis nuclear extracts were first incubated with a 1/20 dilution of Ab for 30 min, followed by incubation with the oligonucleotides. The following Abs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA): IRF-1 sc-497, IRF-2 sc-498, Stat1 p84/p91 sc-346, Stat2 sc-839, Stat3 sc-7179, Stat4 sc-485, Stat5 sc-1656, and Stat6 sc-621. For competition analysis, nuclear extracts were admixed with 32P-labeled double-stranded oligonucleotides in the presence of 100, 10, or 1 ng of unlabeled double-stranded oligonucleotide (Stat consensus, TCGTTCGATTCCGGGAATTGA (19); IRF-motif, GATGCAAAAATTGAAAACTAAGT; LS4-Stat3 motif, ATCCTGTGCCGGGAAACC).
Constructs
The -195 bp IL-10 promoter fragment analyzed has the following sequence: GCTTACGATGCAAAAATTGAAAACTAAGTTTATTAGAGAGGTTAGAGAAGGAGGAGCTCTAAGGAGAAAAAATCCTGTGCCGGGAAACCTTGATTGTGGCTTTTTAATGAATGAAGAGGCCTCCCTGAGCTTACAATATAAAAGGGGGACAGAGAGGTGAAGGTCTACACATCAGGGGCTTGCTCTTGCAAAACCAAACCACAAGACAGACTTGCAAAAGAAGGC.The IRF motif (AATTGAAA) and the Stat motif (TGCCGGGAA) are shown in bold letters, the TATAA box is underlined, and the transcription start site +1 is in bold and underlined. This sequence was generated by oligonucleotide synthesis of three subfragments with a BamHI sequence at the very 5' end and a XhoI site at the very 3' end. The three fragments were annealed and ligated into the p
TATA.luci reporter plasmid (provided by T. Wirth, Wurzburg, Germany) that had been cut with BamHI and XhoI, followed by isolation of the vector via gel electrophoresis.
Mutations were obtained and controlled based on MatInspector predictions. For the IRF site the sequence AATTGAAA was exchanged by GTTAGTAC, while for mutation of the Stat site the sequence TGCCGGGAA was replaced by AGACTTGAA. The mutant promoter constructs were again generated by having oligonucleotide subfragments synthesized, annealed, ligated, and cloned into pTATA.luci.
Expression plasmids for wild-type Stat3 (pCAGGS Neo HA STAT3) dominant negative Stat3 (pCAGGS Neo HA STAT3F), wild-type Stat1 (pCAGGS Neo HA STAT1), and the control plasmid (pCAGGS) (20) were provided by Dr. T. Hirano (Osaka, Japan) via Drs. P. C. Heinrich and I. Behrmann (Aachen, Germany).
Transfection
RPMI 8226 cells were transfected according to the method described by Shakhov et al. (21) with 5 µg of reporter plasmid/107 cells in the presence of DEAE-dextran (125 µg/ml; E1210; Promega, Madison, WI) for 90 min, followed by the addition of 10% (v/v) DMSO (D58791; Sigma-Aldrich) for 150 s. Cells were then cultured for 3 days in six-well plates (3.3 x 106 cells/well) and were stimulated for 6 h with LPS (S. minnesota; L-6261; Sigma-Aldrich) at 100 ng/ml. Cotransfection studies were performed with an admixture of reporter plasmids (5 µg) with empty control plasmids and expression plasmids for IRF-1, for wild-type Stat3, and dominant negative Stat3 (2 µg each).
For measurement of luciferase activity cells were harvested and lysed, and luciferase activity in cell lysates was determined using a model LB9501 luminometer (Berthold, Wildbad, Germany) and a luciferase assay kit (ELA100; Berthold).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
For analysis of IL-10 gene expression we employed the human B cell line RPMI 8226 clone 1. Consistent with earlier findings of mRNA analysis (16), stimulation of these cells with LPS at 100 ng/ml resulted in strong expression of IL-10 protein in the supernatant with 85,615 ± 24,504 pg/ml after 18 h compared with 149 ± 92 pg/ml in unstimulated cells (n = 3). Stimulation of the cells with IFN- at 100 U/ml also led to the production of IL-10 protein, such that 1,665 ± 502 pg/ml was detectable. After stimulation with both LPS and IFN-, there was a slight increase compared with the LPS alone (116,834 ± 40,095 pg/ml).
IFN- induced DNA binding to the IRF motif
Previous studies have demonstrated that the transcription factor Stat3, binding to the TGCCGGGAA motif at position -120 of the human IL-10 gene, is responsible for the LPS-stimulated gene expression in RPMI 8226 cells. When searching for additional potential transcription factor binding sites by MatInspector analysis, we noted an IRF motif (AATTGAAA) 
50 bp upstream of the Stat site among many other predicted binding sites (see sequence in Materials and Methods). This IRF motif was selected for further analysis because in silico analysis demonstrated that the IRF and Stat3 motifs appeared to be the only composite feature in the proximal promoter conserved between mouse and man. Moreover, the relative arrangement of the binding sites suggested the possibility of a functional promoter module.
Gel-shift analysis with nuclear extracts from IFN--stimulated cells revealed an inducible band (arrowhead in Fig. 1A). This band was not affected by an admixture of unlabeled Stat motif, but it was specifically competed by unlabeled IRF-motif (Fig. 1A). The nonspecific band marked by an asterisk in Fig. 1 was competed by both the specific IRF oligonucleotide and the nonspecific Stat oligonucleotide, indicating that this band cannot be involved in specific binding to the IRF motif. When performing supershift analysis, the gels were run for longer periods of time to better separate the specific binding complex. Using anti-IRF Abs under these conditions we could shift most of the binding protein with the anti-IRF-1 Ab (Fig. 1B, lane 3). A weak band with somewhat slower mobility remained, and this was supershifted with the anti-IRF-2 Ab (Fig. 1B, lane 4). The combination of both Abs removed both of the specific IRF bands (Fig. 1B, last lane). These data indicate that the specific complex consists of a minor IRF-2 band with lower mobility and a major IRF-1 band with higher mobility.
|
. As shown in Fig. 2A, a strong band was induced as early as 1 h after IFN- stimulation, and this band gradually declined, but was still detectable at 6 h. In a dose-response analysis 10 U of IFN-/ml led to some IRF binding, and a strong specific band (Fig. 2B, black arrowhead) was seen with 100 U/ml. There was no further substantial increase at 1000 U/ml. Additional bands with higher and lower mobilities also changed with IFN- treatment, but these where shown to be nonspecific, as demonstrated in Fig. 1.
|
|
effect in this system could be due at least in part to LPS contamination of the recombinant protein. Boiling IFN- for 10 min at 95°C completely ablated IRF induction, such that only a weak constitutive band remained. This indicates that no heat-resistant LPS was active in the IFN preparation (Fig. 3B). This was confirmed by the addition of polymyxin B for inactivation of LPS, which did not reduce the activity of IFN-. These data show that the induction of IRF-1 by IFN- is not due to LPS contamination, but is a genuine activity of IFN.
Trans-activation of the human IL-10 promoter by IFN-
We then analyzed the effect of IFN- on the human IL-10 promoter by studying a luciferase reporter construct with the -195 bp IL-10 promoter, which contains both the Stat and the IRF motif. IFN- stimulation of RPMI 8226 cells transfected with this construct led to an average 5-fold trans-activation (Fig. 4, left panel, 
) comparable to what was observed with LPS stimulation (
).
|
-induced trans-activation, we mutated the respective motif. This led, in fact, to a clear reduction of IFN--induced trans-activation (Fig. 4, second panel), but some activity (2-fold trans-activation) remained. This indicates that IFN- can induce the human IL-10 promoter most likely via another motif, in addition to the IRF motif that was mutated in this construct. By contrast, trans-activation induced by LPS was similar for the wild type and the IRF mutant, indicating that for LPS-induced trans-activation the IRF motif is not required.
When we mutated the Stat motif, the LPS-induced trans-activation was markedly reduced, but surprisingly the IFN- activity was completely ablated (Fig. 4, third panel). Mutation of both sites resulted in a loss of trans-activation by any of the stimuli (Fig. 4, fourth panel).
The loss of IFN--induced trans-activation after mutation of the Stat motif demonstrates that IRF alone is unable to drive the human IL-10 promoter. Rather, cooperation with the Stat3 site is essential to achieve trans-activation of this promoter.
IFN- induced DNA binding to the Stat motif
To study the contribution of Stat to the IFN- action, we performed gel-shift analysis with the Stat motif using nuclear extracts from IFN--stimulated cells. IFN- did, in fact, lead to a strong induction of a Stat binding protein (Fig. 5A, arrowhead). The specificity of this band has been demonstrated previously (10). There was a clear signal after 1 h of stimulation, sometimes with a decrease in binding activity at 2 h, as in this example. Later, the signal was strong again (Fig. 5A). To identify the proteins bound to the Stat3 motif after IFN- stimulation by supershift analysis, the gels were again run for a longer period of time for better resolution of the bands (Fig. 5B). Here, anti-Stat1 Ab removed a minor high mobility band, while anti-Stat3 ablated the major low mobility band (lanes 3 and 5, respectively, in Fig. 5B). The combination of the Abs against Stat1 and Stat3 removed the entire specific complex (Fig. 5B, lane 6). The anti-Stat3 Ab induced the appearance of two supershifted bands (Fig. 5B, open arrows, lanes 5 and 6), while the anti-Stat1 Ab did not result in a visible band in the upper part of the gel. All other anti-Stat-Abs had no effect. These data suggest that the IFN--induced complex, which binds to the Stat3 motif, consists mainly of Stat3 homodimers (strong low mobility band) plus a small amount of Stat1 homodimers (weak higher mobility band).
|
preparation abolished this effect, and polymyxin B had no effect (Fig. 5C), indicating that the Stat induction is not due to LPS contamination but is a genuine effect of IFN-.
Involvement of Stat3 in trans-activation of the human IL-10 promoter by IFN-
To confirm that Stat3 is involved in the IFN- action on the human IL-10 promoter, we overexpressed wild-type and dominant negative Stat3 together with the IL-10 promoter reporter construct in RPMI 8226 cells, followed by stimulation with IFN- at 100 U/ml. In these experiments the dominant negative constructs strongly reduced constitutive and IFN--induced trans-activation (Fig. 6). Furthermore, the wild-type Stat3 strongly increased trans-activation by IFN- from 2-fold (pCAGGS) to 7-fold (Stat3) while leaving the constitutive promoter activity unaffected. These data indicate that IFN- employs Stat3 to trans-activate the human IL-10 promoter.
|
/Stat3-mediated trans-activation of the human IL-10 promoterIn gel-shift analysis using the Stat motif we observed induction of a minor band that was identified as Stat1 (see Fig. 5). We therefore asked what role Stat1 might play in trans-activation of the gene. For these studies RPMI 8226 cells were transfected with the -195 fragment of the IL-10 promoter plus a total of 1 µg of expression plasmid. The experiments in Fig. 7 confirmed induction by Stat3, but Stat1 had no activity when added alone. When Stat1 was admixed with Stat3 expression plasmid, Stat1 was able to counteract the Stat3-mediated trans-activation at equal and 2/1 Stat1/Stat3 ratios (Fig. 7, right columns). These data demonstrate that Stat1 is able to counteract Stat3-mediated trans-activation of the human IL-10 promoter.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
can effectively down-regulate IL-10, the type I IFNs have been shown to up-regulate IL-10 expression (12). This induction of the anti-inflammatory IL-10 may contribute to the beneficial effects of IFN- therapy in multiple sclerosis (22). We can confirm this activity of IFN- by the finding of a pronounced expression of IL-10 protein in the supernatant in IFN--treated RPMI 8226 cells. We used this model system to study the molecular mechanisms and the transcription factors involved in IL-10 up-regulation by type I IFNs.
A role of NF-B in IL-10 gene expression had been suggested in early studies (23), but our own in silico analysis of the implicated motifs (unpublished) and the finding that blockade of the NF-B pathway does not affect IL-10 gene expression (24) clearly dismiss a role for this transcription factor.
For the murine IL-10 gene an important role of Sp1 in regulating LPS-stimulated promoter activity was demonstrated (5). The respective motif, GAGGAGGAGC, was found within the first 100 bp of the promoter, and its mutation reduced both the inducible and the constitutive promoter activity in the murine RAW 264 macrophage cell line (5, 6). A similar motif can be found in the human promoter (6) at -145 bp, i.e., it is located between the Stat3 and IRF-1 motifs studied in the present report. In our previous study of LPS induction, a linker-scanning series covering this area did not reveal any impact of this motif on induction in human B cells (10). However, we cannot exclude that this motif is involved in IFN-induced gene expression. When analyzing the human promoter after 24 h of LPS stimulation of the promonocytic cell line THP-1, Ma et al. (7) noted an Sp1 site at -636 bp, which appeared to be responsible for all inducible activity in this system. In our earlier report, in which we used an IL-10 promoter deletion series in a human B cell system, no such drop in LPS-inducible promoter activity was noted (10), suggesting that in B cells regulation of IL-10 may be different. Thus, it appears that Sp1 may be involved in regulation of the IL-10 gene dependent on the species and tissue investigated. For the human gene another study reported on the contribution of cAMP-responsive elements to catecholamine-mediated trans-activation, in that mutation of the three main cAMP-responsive element sites reduced promoter activity by 50% (8). In addition, trans-activation by catecholamines appears to require the action of c/EBP (9). Furthermore, there is evidence for a role for c-Maf in IL-10 gene expression, but c-Maf may act indirectly by activating other transcription factors (25).
We have demonstrated by systematic linker scanning analysis that a site at -120 bp is crucial for LPS-stimulated IL-10 promoter activity. This site was shown to bind LPS-induced Stat3 and, in fact, dominant negative Stat3 could strongly suppress trans-activation (10). We now have analyzed the molecular mechanism that controls IFN--induced trans-activation of the human IL-10 promoter.
Type I IFNs, including IFN-, act mainly via ISGF3 and IRF (12), but IFN- also has been shown to recruit Stat3 to IFN- receptor I, followed by phosphorylation and translocation into the nucleus (26, 27).
We show herein that IFN- recruits both IRF and Stat transcription factors to the human IL-10 promoter. The mobilization of these factors is a genuine effect of IFN- and is not due to LPS contamination of the recombinant protein. This conclusion is based on the finding that transcription factor mobilization was ablated by heating the IFN- for 10 min to 95°C, a procedure that denatures the protein, but leaves LPS unaffected. Also, neutralization of LPS by polymyxin B did not reduce the IFN- induction of DNA binding proteins. The same pattern of results was seen in IFN--driven reporter gene analyses (data not shown).
When studying the IFN--induced DNA-binding proteins that bind to the IRF motif, we noted the induction of a major IRF-1 band, while the constitutive weak IRF-2 band was essentially unaltered. Mutation of the IRF motif in the context of the IRF-Stat promoter module reduced the trans-activation induced by IFN-, but did not ablate it. This indicates that IFN- invokes an additional independent DNA motif for trans-activation of the human IL-10 gene. This might well be the Stat3 site of the module. This could, in fact, be demonstrated, since trans-activation by IFN- was reduced by mutation of the Stat3 motif. This implicates both IRF and Stat in regulation of the IL-10 gene. It was surprising, however, that mutation of the Stat3 motif completely ablated IFN--induced trans-activation. This indicates that IRF-1 on its own cannot act on the IL-10 promoter. Rather, there is a complete dependence of the IRF action on Stat3. Hence, these functional data confirm the module nature of the two transcription factor binding sites that had been predicted based on FastM analysis (15) of the human IL-10 promoter. This module is also conserved in the murine promoter, which exhibits a 64-bp intervening sequence. A similar module was recently predicted and experimentally confirmed for the R(A) and R(B) elements within the human RANTES promoter, which bind Sp1 and NK-B (28).
In addition to the induction of Stat3, we noted that IFN- also induced Stat1, which contributed a minor portion to the total DNA binding activity. With overexpression of Stat1 we found a suppression of IFN-/Stat3-mediated trans-activation. Hence, it appears that Stat1 can have a negative effect on IL-10 gene expression. It is unclear why transfection of Stat1 on its own did not change IFN--induced trans-activation (Fig. 7). A possible explanation is that Stat1 is a weak agonist in this system and will only blunt the activity of a strong agonist such as Stat3. Analysis of the molecular interaction of these Stat proteins and their associated costimulators and corepressors may be able to resolve this question.
Of note, LPS-induced trans-activation does not appear to depend on the IRF-1/Stat3 module. LPS induces IRF binding to the respective motif, albeit with a lower intensity (Fig. 3A). The mutation analysis does, however, indicate that this transcription factor is not required for LPS-induced trans-activation, since a mutation of the IRF site does not affect luciferase activity induced by LPS (Fig. 4). It is unclear why there is LPS-induced IRF binding to this site, but this does not impact on IL-10 promoter activity. A possible explanation is that additional factors involved in cooperativity of the IRF and Stat binding proteins are not invoked in LPS-stimulated cells. Taken together, LPS acts on the IL-10 gene via Stat3 only while IFN- trans-activation requires the IRF-1/Stat3 module. This indicates that the effects of IFN- are more tightly controlled, requiring more complex interactions for the induction of IL-10 expression. Here negative control mechanisms at two sites can prevent the gene induction. For LPS the sole dependence on Stat3 allows for a brisk response, which may be essential to counteract the otherwise damaging effects of the proinflammatory cytokines that this bacterial product induces concomitantly. When comparing promoter activity and IL-10 protein production, it is evident that LPS and IFN- show similar induction of the luciferase reporter gene, but LPS induces much higher levels of IL-10 protein. This indicates that LPS uses additional transcriptional and post-transcriptional elements to induce high levels of IL-10 protein.
The mode of interaction of the two transcription factors after IFN- stimulation may be dependent on their cognate binding to DNA, as has been shown for the NF-AT interaction with AP-1 (29), or it may be a direct protein-protein interaction, as has been shown for Stat3 and c-Jun (30). These authors have defined two Stat3 domains that are involved in the interaction with c-Jun, and these could also be involved in the Stat3 interaction with IRF-1. Alternatively, additional adaptor molecules could come into play to form an enhanceosome complex that ultimately controls the expression of the IL-10 gene.
Taken together the unique finding in our study is the discovery in the human IL-10 promoter of an IRF-1/Stat3 module that is stringently dependent on Stat3 for trans-activation by IFN-.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Prof. L. Ziegler-Heitbrock, Division of Immunology, University of Leicester, Leicester, U.K. LE1 9HN. E-mail address: lzh1{at}le.ac.uk
3 Abbreviations used in this paper: Sp1, specific protein-1; IRF, IFN regulatory factor.
Received for publication January 13, 2003. Accepted for publication January 28, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
inhibits interleukin 10 production by monocytes. J. Exp. Med. 177:523. stimulates production of interleukin-10 in activated CD4+ T cells and monocytes. Blood 87:4731.B-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor gene in primary macrophages. J. Exp. Med. 171:35. (TNF-)- and IL-10-secreting blood cells that is corrected by interferon- (IFN-) treatment. Clin. Exp. Immunol. 120:147.[Medline]
B binding sites in the regulatory region of the interleukin-10 gene. Eur. J. Haematol. 59:162.[Medline]
B into human macrophages: lipopolysaccharide-induced, but not zymosan-induced, proinflammatory cytokines are inhibited, but IL-10 is nuclear factor-B independent. J. Immunol. 162:2939.This article has been cited by other articles:
|
|
 |
|
  A. R. Elia, P. Cappello, M. Puppo, T. Fraone, C. Vanni, A. Eva, T. Musso, F. Novelli, L. Varesio, and M. Giovarelli Human dendritic cells differentiated in hypoxia down-modulate antigen uptake and change their chemokine expression profile J. Leukoc. Biol., December 1, 2008; 84(6): 1472 - 1482. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Tsuji-Takayama, M. Suzuki, M. Yamamoto, A. Harashima, A. Okochi, T. Otani, T. Inoue, A. Sugimoto, T. Toraya, M. Takeuchi, et al. The Production of IL-10 by Human Regulatory T Cells Is Enhanced by IL-2 through a STAT5-Responsive Intronic Enhancer in the IL-10 Locus J. Immunol., September 15, 2008; 181(6): 3897 - 3905. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Chakrabarti, A. J. Sadler, N. Kar, H. A. Young, R. H. Silverman, and B. R. G. Williams Protein Kinase R-dependent Regulation of Interleukin-10 in Response to Double-stranded RNA J. Biol. Chem., September 12, 2008; 283(37): 25132 - 25139. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Norkina, A. Dolganiuc, T. Shapiro, K. Kodys, P. Mandrekar, and G. Szabo Acute alcohol activates STAT3, AP-1, and Sp-1 transcription factors via the family of Src kinases to promote IL-10 production in human monocytes J. Leukoc. Biol., September 1, 2007; 82(3): 752 - 762. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Dong, C. Ivascu, H.-D. Chang, P. Wu, R. Angeli, L. Maggi, F. Eckhardt, L. Tykocinski, C. Haefliger, B. Mowes, et al. IL-10 Is Excluded from the Functional Cytokine Memory of Human CD4+ Memory T Lymphocytes J. Immunol., August 15, 2007; 179(4): 2389 - 2396. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Fahey, R. A. Robins, and C. S. Constantinescu Reciprocal effects of IFN-{beta} and IL-12 on STAT4 activation and cytokine induction in T cells J. Leukoc. Biol., June 1, 2007; 81(6): 1562 - 1567. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. J. Staples, T. Smallie, L. M. Williams, A. Foey, B. Burke, B. M. J. Foxwell, and L. Ziegler-Heitbrock IL-10 Induces IL-10 in Primary Human Monocyte-Derived Macrophages via the Transcription Factor Stat3 J. Immunol., April 15, 2007; 178(8): 4779 - 4785. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kasprzycka, M. Marzec, X. Liu, Q. Zhang, and M. A. Wasik From the Cover: Nucleophosmin/anaplastic lymphoma kinase (NPM/ALK) oncoprotein induces the T regulatory cell phenotype by activating STAT3 PNAS, June 27, 2006; 103(26): 9964 - 9969. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Schreiber, R. G. Jenner, H. L. Murray, G. K. Gerber, D. K. Gifford, and R. A. Young Coordinated binding of NF-{kappa}B family members in the response of human cells to lipopolysaccharide PNAS, April 11, 2006; 103(15): 5899 - 5904. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Shoemaker, M. Saraiva, and A. O'Garra GATA-3 Directly Remodels the IL-10 Locus Independently of IL-4 in CD4+ T Cells J. Immunol., March 15, 2006; 176(6): 3470 - 3479. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Jones and R. A. Flavell Distal Enhancer Elements Transcribe Intergenic RNA in the IL-10 Family Gene Cluster J. Immunol., December 1, 2005; 175(11): 7437 - 7446. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Saraiva{paragraph}, J. R. Christensen, A. V. Tsytsykova, A. E. Goldfeld, S. C. Ley, D. Kioussis, and A. O'Garra Identification of a Macrophage-Specific Chromatin Signature in the IL-10 Locus J. Immunol., July 15, 2005; 175(2): 1041 - 1046. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Cartharius, K. Frech, K. Grote, B. Klocke, M. Haltmeier, A. Klingenhoff, M. Frisch, M. Bayerlein, and T. Werner MatInspector and beyond: promoter analysis based on transcription factor binding sites Bioinformatics, July 1, 2005; 21(13): 2933 - 2942. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Dikopoulos, A. Bertoletti, A. Kroger, H. Hauser, R. Schirmbeck, and J. Reimann Type I IFN Negatively Regulates CD8+ T Cell Responses through IL-10-Producing CD4+ T Regulatory 1 Cells J. Immunol., January 1, 2005; 174(1): 99 - 109. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, IFN-