The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kemp, T. J.
Right arrow Articles by Griffith, T. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kemp, T. J.
Right arrow Articles by Griffith, T. S.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
The Journal of Immunology, 2003, 171: 212-218.
Copyright © 2003 by The American Association of Immunologists

Plasmacytoid Dendritic Cell-Derived IFN-{alpha} Induces TNF-Related Apoptosis-Inducing Ligand/Apo-2L-Mediated Antitumor Activity by Human Monocytes Following CpG Oligodeoxynucleotide Stimulation1

Troy J. Kemp*,{dagger}, Bennett D. Elzey*,{dagger} and Thomas S. Griffith2,*,{dagger},{ddagger}

* Department of Urology, {dagger} Interdisciplinary Graduate Program in Immunology, and {ddagger} Prostate Cancer Research Program of Holden Comprehensive Cancer Center, University of Iowa, Iowa City, IA 52242


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunostimulatory oligodeoxynucleotides (ODN) containing the CpG motif are being tested as immune adjuvants in many disease settings. Of the human PBMC examined, plasmacytoid dendritic cells (pDC) are a major source of type I IFN upon stimulation with CpG ODN. IFNs have numerous immunostimulatory effects, including the induction of TNF-related apoptosis-inducing ligand (TRAIL)/Apo-2L on monocytes, NK cells, and T cells. Importantly, IFN has also been linked to antitumor responses. Thus, we tested whether CpG ODN stimulation of PBMC led to TRAIL/Apo-2L-induced tumor cell death. When PBMC were stimulated with CpG ODN, TRAIL/Apo-2L-dependent tumor cell death was observed. Further examination of CpG ODN-stimulated PBMC revealed that TRAIL/Apo-2L expression was limited to CD14+ cells, which, when depleted, led to a loss of the TRAIL/Apo-2L-mediated tumor cell killing. Moreover, pDC depletion also abolished the TRAIL/Apo-2L-mediated killing of tumor cell targets. Analysis of the pDC showed IFN-{alpha} production after CpG ODN stimulation. Finally, inclusion of neutralizing IFN-{alpha} antiserum with the PBMC during CpG ODN stimulation abrogated TRAIL/Apo-2L-mediated tumor cell killing. These results define a mechanism by which CpG ODN induces TRAIL/Apo-2L-dependent killing of tumor cells by CD14+ PBMC, in which CpG ODN-activated pDC produce IFN-{alpha} that stimulates CD14+ PBMC to express functional TRAIL/Apo-2L.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Dendritic cells (DC)3 are bone marrow-derived cells whose primary function in the immune system is the uptake, processing, and presentation of foreign and self Ags (1, 2). Two distinct peripheral blood DC subsets have been described in humans (3, 4, 5). One subset is the myeloid DC, which is characterized by a multilobulated nucleus; the absence of CD3, CD14, CD19, and CD56; and the presence of CD4, CD11c, CD33, and HLA-DR. The other blood DC subset is the plasmacytoid DC (pDC), which is distinguished by an oval nucleus; the absence of CD3, CD14, CD19, CD56, and CD11c; low levels of CD33; and high levels of CD123 and HLA-DR (3, 5). Another difference between these two DC populations is the expression of Toll-like receptor (TLR) 9, in which it is expressed on pDC, but not on myeloid DC (6, 7). The TLRs are an evolutionarily conserved family of proteins that are responsible for mediating innate immune reactions, especially against bacterial infections, through the recognition of pathogen-associated molecular patterns (8, 9). In the case of TLR9, this is the TLR that binds to immunostimulatory CpG-containing bacterial DNA sequences (10, 11).

In recent years, numerous studies have examined the potential of using CpG-containing oligonucleotides (CpG ODN), alone and in combination with other molecules, to boost the immunological response in a variety of disease settings, including the treatment of cancer (12, 13). Among the cells present in peripheral blood, CpG ODN have profound stimulatory effects on pDC, leading to their increased expression of MHC and costimulatory molecules, and their production of proinflammatory cytokines (6, 7, 14, 15, 16). In addition to the production of IL-12 and TNF, CpG ODN-stimulated pDC secrete large amounts of type I IFNs, primarily IFN-{alpha} (14), which is essential for resistance to viral or microbial infections (17). Additionally, IFN-{alpha} has been demonstrated to induce antitumor responses against a number of cancers, including renal cell carcinoma and bladder carcinoma (18, 19, 20).

IFN-{alpha} has numerous effects on a variety of cell types. Somatically, IFN-{alpha} promotes phenotypic differentiation and increases MHC class I expression on normal as well as tumor cells, and has antiviral effects on normal cells (17, 21). Immunologically, IFN-{alpha} enhances NK cell and cytotoxic T lymphocyte lytic activity, and can induce B cell proliferation and Ig secretion (22, 23, 24). However, the cells of the monocyte/macrophage (M{phi}) lineage may benefit the greatest from IFN-{alpha} stimulation. Before their differentiation into nonlymphoid and lymphoid tissue-associated M{phi}, mononuclear phagocytes circulate in the peripheral blood (25). IFN-{alpha} promotes the activation and differentiation of M{phi}, leading to increased synthesis of lysosomal hydrolases, esterases, and neutral proteases (26, 27, 28). The activation of M{phi} by IFN-{alpha} also leads to increased expression of Fc receptors, which in turn promotes phagocytosis of immune complexes and increases the capacity to lyse Ab-coated bacteria, parasites, and tumor cells by Ab-dependent cell-mediated cytotoxicity (27). In addition, human M{phi} express TNF-related apoptosis-inducing ligand (TRAIL)/Apo-2L following IFN-{alpha} stimulation, transforming them into potent killers of tumor cells (29). Recent reports have examined the natural role of TRAIL/Apo-2L, and found it is a critical component in immune surveillance against tumors, graft vs host disease, and graft vs tumor activity after allogeneic hemopoietic cell transplantation (30, 31, 32, 33).

The goal of the studies presented in this work was to determine whether CpG ODN-stimulated PBMC were able to mediate tumor cell death via TRAIL/Apo-2L. We demonstrate that human peripheral blood CD123+ pDC produce IFN-{alpha} after exposure to CpG ODN, which induces TRAIL/Apo-2L expression on CD14+ peripheral blood M{phi} that are able to kill TRAIL-sensitive cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents and mAb

Reagents and sources were as follows: GM-CSF and IFN-{alpha} (100 ng/ml; PeproTech, Rocky Hill, NJ); UCHT1, FITC-conjugated IgG1 anti-human CD3; M5E2, FITC-conjugated IgG2a anti-human CD14; HIB19, FITC-conjugated IgG1 anti-human CD19; B159, PE-conjugated IgG1 anti-human CD56 (BD Biosciences, San Diego, CA); RIK-2, biotinylated IgG1 anti-human TRAIL (eBioscience, San Diego, CA); IgG1 FITC isotype control; IgG2a FITC isotype control; IgG1 PE isotype control; IgG1 biotin isotype control (Caltag Laboratories, Burlingame, CA). The soluble fusion protein TRAIL-R2:Fc was obtained from Immunex (Seattle, WA), while Fas:Fc was purchased from Alexis Biochemicals (San Diego, CA).

CpG ODN

The completely phosphothiorate-modified CpG ODN were obtained from A. Krieg (Coley Pharmaceutical Group, Wellesley, MA). All sequences are 5'-3', and the CpG motifs are in boldface type: 2006, TCGTCGTTTTGTCGTTTTGTCGTT; and 2041, CTGGTCTTTCTGGTTTTTTTCTCG.

Tumor cell line

The human melanoma cell line WM 793 was obtained from M. Herlyn (Wistar Institute, Philadelphia, PA) (34), and cultured in DMEM supplemented with 10% FBS, penicillin, streptomycin, sodium pyruvate, nonessential amino acids, and HEPES (hereafter referred to as complete DMEM).

Preparation of PBMC

PBMC were isolated by standard density-gradient centrifugation over Ficoll-Paque Plus (Pharmacia, Uppsala, Sweden). To isolate untouched M{phi}, a monocyte isolation kit (Miltenyi Biotec, Auburn, CA) was used to deplete T cells, NK cells, B cells, DC, and basophils from PBMC using a cocktail of anti-CD3, anti-CD7, anti-CD19, anti-CD45RA, anti-CD56, and IgE Abs. The remaining cells were then depleted of any contaminating pDC using a blood DC Ag (BDCA)-4 (35) cell isolation kit (Miltenyi Biotec). This procedure resulted in >95% pure M{phi}. To deplete CD14+ M{phi}, PBMC were incubated with 100 µl of 61D3, a mouse IgG1 anti-human CD14 mAb (eBioscience) for 30 min at room temperature. After washing in PBS, the PBMC were then incubated with 400 µl goat anti-mouse IgG Dynabeads (Dynal ASA, Oslo, Norway) for 30 min at room temperature. After washing in PBS, the CD14+ cells were then depleted with a magnetic field, resulting in PBMC containing <0.5% CD14+ cells. To isolate or deplete pDC from purified PBMC, a BDCA-4 cell isolation kit (Miltenyi Biotec) was used. To verify pDC purity, isolated cells were stained with a biotin-conjugated mouse anti-human CD123 mAb (BD Biosciences) and a PE-conjugated mouse anti-BDCA-2 mAb. After 30 min, FITC streptavidin (Caltag Laboratories) was added to the cells for an additional 30 min. The cells were then washed and analyzed by flow cytometry. pDC purity was >90% using these markers.

Flow cytometry

Cell analysis was performed on a FACScan (BD Biosciences) with >104 cells analyzed per sample. For multicolor cell analysis, samples consisting of 20 µl cells were combined in a 96-well round-bottom plate (Costar, Cambridge, MA) with 20 µl human IgG (12 µg/ml; Sigma-Aldrich, St. Louis, MO) to block Fc binding of the mAb and 20 µl each of the direct PE-, FITC-, and biotin-labeled mAb (60 µg/ml). Cells were then incubated at 4°C for 30 min. Following three washes with 200 µl PBS containing 2 mg/ml BSA and 0.02% NaN3, 40 µl of FITC- or PE-labeled streptavidin (1/100 dilution; Caltag Laboratories) was added for an additional 30 min. Cells were analyzed immediately following staining or fixed in 1% paraformaldehyde until analysis.

PBMC-mediated killing of human tumor cells

PBMC (107 cells/2 ml/well in a 6-well plate) were cultured in RPMI 1640 supplemented with 10% FBS, penicillin, streptomycin, sodium pyruvate, nonessential amino acids, and HEPES (hereafter referred to as complete RPMI) medium alone, GM-CSF (100 ng/ml), IFN-{alpha} (100 ng/ml), or CpG ODN (1 µg/ml) for 24 h, after which the cells were washed and resuspended in complete RPMI. Tumor cells were labeled with 100 µCi of 51Cr for 1 h at 37°C, washed three times, and resuspended in complete medium. To determine TRAIL-induced death, 51Cr-labeled tumor cells (104/well) were incubated with varying numbers of effector cells for 14 h. In some cultures, TRAIL-R2:Fc or Fas:Fc (20 µg/ml) was added to the PBMC 15 min before adding tumor cell targets. All cytotoxicity assays were performed in 96-well round-bottom plates, and the percent specific lysis was calculated as: 100 x (experimental cpm - spontaneous cpm)/(total cpm - spontaneous cpm). Spontaneous and total 51Cr release were determined in the presence of either medium alone or 1% Nonidet P-40, respectively. The presence of TRAIL-R2:Fc or Fas:Fc during the assay had no effect on the level of spontaneous release by the target cells.

IFN-{alpha} ELISA

Human IFN-{alpha} protein levels produced after CpG ODN stimulation were quantitated using a sandwich ELISA purchased from R&D Systems (Minneapolis, MN).

IFN-{alpha} neutralization

PBMC were stimulated, as described above, with CpG ODN alone, or CpG ODN in the presence of rabbit anti-human neutralizing IFN-{alpha} antiserum (10,000 U/ml; R&D Systems) or a nonspecific rabbit IgG isotype control Ab (Sigma-Aldrich). PBMC were then analyzed for TRAIL/Apo-2L expression by flow cytometry or cultured with 51Cr-labeled tumor cells to assess tumoricidal activity, as described above.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Human PBMC stimulated with CpG ODN mediate TRAIL/Apo-2L-dependent tumor cell lysis

Among its many immunostimulatory effects, CpG ODN enhance cancer immunosurveillance and stimulate cellular responses in mice that suppress tumor development (36, 37, 38, 39). Although proinflammatory cytokines, such as IFN, IL-12, and TNF, are produced following CpG ODN stimulation, we were interested in investigating the mechanism responsible for the antitumor activity of CpG ODN-stimulated cells. Of the cellular molecules known to be cytotoxic to tumor cells, the TNF family member TRAIL/Apo-2L is receiving a great deal of attention. The excitement behind TRAIL/Apo-2L principally lies in its specificity for inducing tumor cell apoptosis, while leaving normal cells and tissues unaffected (40, 41). Thus, preliminary experiments were performed to determine whether the antitumor activity resulting from CpG ODN stimulation contained a TRAIL/Apo-2L-dependent component. Human PBMC were isolated from normal healthy volunteers and cultured in medium alone, or in the presence of CpG ODN for 24 h. The PBMC were then cultured with the TRAIL/Apo-2L-sensitive human melanoma tumor cell line WM 793 (34). Whereas the unstimulated or control CpG ODN 2041-treated PBMC demonstrated minimal tumoricidal activity toward WM 793, PBMC stimulated with CpG ODN 2006 were efficient killers of these TRAIL-sensitive tumor cells over a range of E:T cell ratios (Fig. 1A). These data were reproducible using PBMC from multiple donors (data not shown). To confirm that the observed PBMC tumoricidal activity was TRAIL/Apo-2L dependent, 2006-stimulated PBMC were incubated with either TRAIL-R2:Fc (42) or Fas:Fc before their incubation with the tumor cell targets. Under these conditions, TRAIL-R2:Fc reduced target cell death to control (unstimulated or 2041-stimulated PBMC effectors) levels, whereas Fas:Fc did not inhibit the ability of the 2006-stimulated PBMC to mediate tumor lysis (Fig. 1B). Collectively, these results demonstrate that PBMC mediate TRAIL/Apo-2L-induced tumor cell lysis following stimulation with CpG ODN.



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 1. TRAIL/Apo-2L-mediated tumoricidal activity by human PBMC occurs after stimulation with CpG ODN. A, PBMC were incubated for 24 h in the absence or presence of either the stimulatory CpG ODN, 2006 (1 µg/ml), or control CpG ODN 2041 (1 µg/ml), and then cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T cell ratios. B, Inclusion of the fusion protein TRAIL-R2:Fc (20 µg/ml) to 24-h 2006-stimulated PBMC inhibited killing of WM 793 target cells, while addition of Fas:Fc (20 µg/ml) did not. Data points represent the mean of triplicate wells, and experiments were repeated at least three times using different donor PBMC with similar results. For clarity, SD bars were omitted from the graphs, but were <10% of the value of all points.

 
CpG ODN stimulation induces TRAIL/Apo-2L expression on peripheral blood M{phi}

Having demonstrated the presence of TRAIL/Apo-2L-dependent antitumor activity in CpG ODN-stimulated PBMC, studies were performed to determine which cell population(s) was responsible for mediating the tumor cell lysis. Previous studies have shown that peripheral blood T cells, NK cells, and M{phi} can express functional TRAIL/Apo-2L (29, 43, 44); thus, CD3+ T cells, CD14+ M{phi}, CD19+ B cells, and CD56+ NK cells within the bulk PBMC were examined by two-color flow cytometry for TRAIL/Apo-2L expression following 24 h culture in the absence or presence of CpG ODN. When stimulated with 2006, there was significant TRAIL/Apo-2L expressed on CD14+ M{phi}, slight expression on CD19+ B cells, and no detectable expression on CD3+ T cells or CD56+ NK cells (Fig. 2). In contrast, stimulation with 2041 resulted in no detectable TRAIL/Apo-2L expression on any cell population above control Ab staining.



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 2. TRAIL/Apo-2L expression on human PBMC. Isolated PBMC were incubated for 24 h in the absence or presence of CpG ODN 2006 or 2041 (1 µg/ml), and then analyzed for TRAIL/Apo-2L surface expression on CD3+, CD14+, CD19+, and CD56+ cells. Histograms represent 104 gated cells in all conditions, and viability was greater than 95%, as assessed by propidium iodide exclusion. These observations were reproduced using PBMC from four different donors.

 
Experiments were then performed to determine which TRAIL/Apo-2L-expressing cell population was mediating the tumor cell lysis. Based on the data on Fig. 2, we depleted CD14+ M{phi} or CD19+ B cells from PBMC, stimulated the remaining cells with CpG ODN as before, and then tested for tumoricidal activity. Whereas PBMC depleted of CD19+ B cells retained the ability to kill the tumor cell targets to the same level as bulk PBMC following CpG ODN stimulation (Fig. 3A), tumor cell lysis dropped to background levels when PBMC were depleted of CD14+ M{phi} (Fig. 3B), suggesting that M{phi} were the primary cell inducing tumor cell lysis. We then tested whether the CpG ODN were directly stimulating purified M{phi} to express functional TRAIL/Apo-2L, even though human M{phi} do not express TLR9 (45). In contrast to the TRAIL/Apo-2L-dependent cytotoxic activity displayed by IFN-{alpha}-stimulated M{phi} (29), purified M{phi} stimulated with CpG ODN possessed no cytotoxic activity nor expressed TRAIL/Apo-2L (Fig. 3, C and D). These results demonstrate that although CD14+ M{phi} are the PBMC population mediating the tumor cell lysis upon CpG ODN stimulation, the CpG ODN is not directly stimulating the M{phi}. Furthermore, these results suggest that the CpG ODN is stimulating another cell within the PBMC to produce a factor that induces TRAIL/Apo-2L expression on the M{phi}.



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 3. CD14+ M{phi} are responsible for the tumoricidal activity of CpG ODN-stimulated PBMC. Isolated PBMC were depleted of either CD19+ B cells (A) or CD14+ M{phi} (B), and then cultured for 24 h in the absence or presence of CpG ODN 2006 or 2041 (1 µg/ml). For comparison, bulk, undepleted PBMC were also cultured in the absence or presence of CpG ODN 2006 or 2041 (1 µg/ml) for 24 h. The bulk or depleted PBMC were then cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T cell ratios. C, Purified M{phi} stimulated for 24 h with CpG ODN (1 µg/ml) did not display tumoricidal activity. As a positive control, purified M{phi} stimulated with IFN-{alpha} (100 ng/ml) were highly cytotoxic, whereas GM-CSF (100 ng/ml) did not induce any cytotoxic activity. For A–C, data points represent the mean of triplicate wells, and experiments were repeated using at least three different donors that yielded similar results. For clarity, SD bars were omitted from the graphs, but were <10% of the value of all points. D, Purified M{phi} stimulated with CpG ODN do not express TRAIL/Apo-2L. Purified M{phi} were incubated for 24 h in the absence or presence of CpG ODN 2006 or 2041 (1 µg/ml), GM-CSF (100 ng/ml), or IFN-{alpha} (100 ng/ml), and then analyzed for TRAIL/Apo-2L expression. Histograms represent 104 gated cells in all conditions, and viability was greater than 95%, as assessed by propidium iodide exclusion. These observations were reproduced using M{phi} from two different donors.

 
CpG ODN stimulates pDC to produce IFN-{alpha}, which induces TRAIL/Apo-2L expression on CD14+ M{phi}

TLR9 is the cell surface molecule involved in the recognition of CpG motifs (10). Recent studies have determined that pDC are the predominant cell within the peripheral blood expressing TLR9, and are the major source of type I IFN within the blood upon exposure of CpG ODN (6, 7, 14, 15, 16). In the current study, purified pDC stimulated with 2006 produced 300 pg/ml IFN-{alpha}, whereas culture supernatants from unstimulated or 2041-stimulated pDC contained undetectable IFN-{alpha} levels (Fig. 4A). This amount is well within the range of IFN-{alpha} concentrations (100 ng/ml–10 pg/ml) that induces TRAIL/Apo-2L expression on M{phi} (29). Having demonstrated that pDC were producing IFN-{alpha} upon CpG ODN stimulation, we wanted to test whether the depletion of pDC from PBMC before CpG ODN stimulation had any effect on the M{phi}-mediated tumor cell lysis. Indeed, Fig. 4B demonstrates that, compared with bulk PBMC, the depletion of pDC from the PBMC abrogates the tumoricidal activity when stimulated with 2006. Moreover, culture supernatants of pDC-depleted, 2006-stimulated PBMC contained undetectable levels of IFN-{alpha} (Fig. 4A). These results suggest that CpG ODN-stimulated pDC produce IFN-{alpha}, which induces CD14+ M{phi} to express functional TRAIL/Apo-2L.



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 4. CpG ODN stimulates IFN-{alpha} production from pDC, and PBMC depleted of pDC possess no tumoricidal capacity following CpG ODN stimulation. A, Purified pDC or PBMC depleted of pDC were cultured for 24 h in the absence or presence of CpG ODN 2006 or 2041 (1 µg/ml). IFN-{alpha} levels in the culture supernatants were then determined by ELISA. IFN-{alpha} levels represent the average amount measured from three independent experiments using different donors. N. D., none detected. pDC purity was >90%. B, Absence of tumoricidal acitivity in pDC-depleted PBMC stimulated with CpG ODN. Isolated PBMC were depleted of pDC, and then cultured for 24 h in the absence or presence of CpG ODN 2006 or 2041 (1 µg/ml). For comparison, bulk, undepleted PBMC were also cultured in the absence or presence of CpG ODN 2006 or 2041 (1 µg/ml) for 24 h. The bulk or depleted PBMC were then cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T cell ratios. Data points represent the mean of triplicate wells, and the experiment was repeated on at least three different donors that gave similar results. For clarity, SD bars were omitted from the graphs, but were <10% of the value of all points.

 
As demonstrated in Fig. 4, CpG ODN stimulation of purified pDC leads to IFN-{alpha} production. We, therefore, proposed that IFN-{alpha} neutralization would also abrogate the TRAIL/Apo-2L-mediated tumor cell lysis after CpG ODN stimulation. To test this hypothesis, PBMC were stimulated with CpG ODN as in previous experiments, with additional 2006-stimulated PBMC set up to also include neutralizing antiserum against human IFN-{alpha}. Under these conditions, IFN-{alpha} neutralization reduced the tumor cell lysis to background (unstimulated or control CpG ODN-stimulated PBMC) levels (Fig. 5A). Additionally, inclusion of an isotype control Ab did not alter the tumoricidal activity of the 2006-stimulated PBMC, demonstrating the specificity of the antiserum. Moreover, flow cytometric analysis of the CD14+ M{phi} stimulated with 2006 in the presence of the neutralizing IFN-{alpha} antiserum revealed TRAIL/Apo-2L expression was comparable to the levels detected on unstimulated or 2041-stimulated PBMC (Fig. 5B), whereas TRAIL/Apo-2L levels were similar to those observed in Fig. 2 after 2006 stimulation alone or in the presence of a control Ab. Collectively, these results demonstrate that CpG ODN-induced TRAIL/Apo-2L expression and function are mediated in an IFN-{alpha}-dependent fashion, with the pDC being the peripheral blood cell directly stimulated by the CpG ODN, resulting in the production of IFN-{alpha}, which then stimulates TRAIL/Apo-2L expression on CD14+ M{phi} and tumoricidal activity.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 5. IFN-{alpha} neutralization abrogates CpG ODN-induced tumoricidal activity and TRAIL/Apo2L expression on CD14+ M{phi}. A, PBMC were incubated for 24 h in the absence or presence of either 1 µg/ml CpG ODN 2006, 2041, IFN-{alpha}-neutralizing antiserum (10,000 NU/ml), or a nonspecific control Ig. The PBMC were then cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T cell ratios. Data points represent the mean of triplicate wells, and the experiment was repeated at least three times with similar results. For clarity, SD bars were omitted from the graphs, but were <10% of the value of all points. B, PBMC were stimulated, as described in A, and then analyzed for TRAIL/Apo-2L surface expression on CD14+ cells. Histograms represent 104 gated cells in all conditions, and viability was greater than 95%, as assessed by propidium iodide exclusion. These observations were reproduced using PBMC from three different donors.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The cells of the mononuclear phagocyte (M{phi}) lineage are distributed throughout most tissues, playing a role in numerous immunological scenarios by virtue of their capacity to recognize and phagocytize a wide range of exogenous materials and then to respond by releasing or expressing biologically active molecules. M{phi} represent the terminally differentiated cell that originates from a precursor found in various tissues, but particularly among bone marrow cells (46). After several cycles of replication, the precursor cell proceeds in its differentiation, halts DNA synthesis, and migrates out of the bone marrow and into the blood to become a monocyte. Not only are M{phi} important APC, they can also be effector cells with profound antitumor activity (47, 48). The results presented in this work demonstrate that one of the mechanisms by which CpG ODN may mediate antitumor immune responses is by inducing the expression of TRAIL/Apo-2L on M{phi}. Interestingly, the CpG ODN effect on the M{phi} is indirect, as the CpG ODN acts instead on the pDC, stimulating the production of IFN-{alpha} that, in turn, stimulates the M{phi} to express TRAIL/Apo-2L. Because TRAIL/Apo-2L mediates apoptosis in a wide variety of hemopoietic and nonhemopoietic tumor cell types (34, 41, 49, 50), these results imply that M{phi} have the potential to induce the apoptotic death of a broad range of tumor cell types via TRAIL/Apo-2L. Moreover, our observations are the first to demonstrate that TRAIL/Apo-2L-mediated tumor cell lysis should be included in the growing list of immunostimulatory qualities of CpG ODN.

Unmethylated bacterial DNA and synthetic ODN containing CpG motifs (CpG ODN) are potent inducers of innate and specific immune reactions, driving the response toward the Th1 phenotype. Among the various settings in which bacterial DNA or CpG ODN are beneficial in stimulating an immunological response is in the activation of antitumor immunity. For example, in superficial bladder cancer, the treatment of choice is the installation of the Mycobacterium bovis strain bacille Calmette-Guérin (51). Yet, the use of bacteria, or bacterial extracts, in the treatment of cancer dates back over 100 years in the reports of Coley (52). More recently, studies investigating the similar qualities of synthetic CpG ODN have shown that the immunological stimulation by CpG ODN depends on TLR9 (10). The TLR family of mammalian pattern-recognition receptors is responsible for microbial recognition and the initiation of innate immune reactions against bacterial pathogens (8, 9). Within human PBMC, CpG ODN generally have not been reported to directly activate T cells, NK cells, or M{phi}, due to the fact that these cells do not express TLR9. Human B cells express some TLR9 (15), and can be stimulated by CpG ODN to secrete IL-6, IL-10, and IgM, and express increased levels of MHC class II, CD80, and CD86 (53, 54, 55). In contrast, TLR9 is most readily expressed by pDC, which gives CpG ODN the ability to directly stimulate pDC (6, 14, 15). CpG ODN-stimulated pDC display increased levels of MHC molecules, ICAM-1, CD40, CD54, CD80, and CD86 (6, 7, 14, 15, 16). pDC also produce high levels of the proinflammatory cytokines TNF, IL-12, and type I IFN. The pDC secretion of IFN-{alpha} was essential for the expression of functional TRAIL/Apo-2L on the M{phi} in our system, as the depletion of pDC or inclusion of neutralizing IFN-{alpha} antiserum with the PBMC during CpG stimulation resulted in no increase in tumor cell death over background levels. pDC comprise 0.1–0.3% of PBMC, yet are the principal type I IFN-producing cells in human blood (45, 56, 57). It is clear that increasing the numbers of pDC in vivo, with agents such as Flt3 ligand, is beneficial for generating vigorous immune responses (58); however, it is unknown whether combining pDC-mobilizing agents with CpG ODN would result in heightened TRAIL/Apo-2L-dependent antitumor responses.

The induction of TRAIL/Apo-2L expression by unmethylated bacterial DNA and CpG ODN on circulating PBMC, such as M{phi}, could also play important roles in other physiological events. As previously mentioned, early studies demonstrated TRAIL/Apo-2L induced apoptosis specifically in tumor cells, but not normal cells and tissues (40, 41). Reports within the last year, however, have found TRAIL/Apo-2L can, in certain physiological situations, also induce apoptosis in select, noncancerous cell populations, such as neutrophils, plasma cells, monocytes, neurons, and activated stellate cells within the liver (59, 60, 61, 62, 63). At first consideration, it may seem that TRAIL/Apo-2L expression on PBMC could be dangerous to the normal cells susceptible to TRAIL/Apo-2L-mediated apoptosis. The report describing the susceptibility of neutrophils to TRAIL/Apo-2L (59), though, suggests a role for TRAIL/Apo-2L-expressing M{phi} in the regulation of normal inflammatory responses. For example, because neutrophils and M{phi} are the first cells to infiltrate sites of bacterial infections, it is easy to hypothesize the following scenario based on our results demonstrating functional TRAIL/Apo-2L on M{phi} after CpG ODN stimulation. Neutrophils and M{phi} are the first cells to a bacterial infection, with IFN being one of the locally produced cytokines. As M{phi} enter the site, IFN stimulates them to express TRAIL/Apo-2L, allowing the M{phi} to gain control of the evolving inflammatory response. Once the infection is under control, one function of the TRAIL/Apo-2L-expressing M{phi} is to induce apoptotic death in the neutrophils to help turn off the inflammatory response. Obviously, additional studies are needed to validate this hypothesis and to determine the physiologic effect of TRAIL/Apo-2L-expressing M{phi}, and perhaps other PBMC, on other normal cells.

Immunological surveillance against tumors is mediated by both innate and adaptive components of the immune response. The observation that CpG ODN stimulation leads to TRAIL/Apo-2L expression demonstrates the complexity and cooperation between innate and adaptive immunity. Although the development and testing of recombinant, soluble forms of TRAIL/Apo-2L for the treatment of cancer are presently under intense investigation, identifying methods of increasing the natural levels or TRAIL/Apo-2L within the body should not be overlooked. In theory, TRAIL/Apo-2L has several modes of action as an antitumor molecule. Most evident is the ability of TRAIL/Apo-2L to reduce the tumor load by inducing tumor cell apoptosis, as preclinical studies using soluble TRAIL/Apo-2L have demonstrated this ability (64, 65). More recently, studies using TRAIL/Apo-2L-deficient mice have described the importance of TRAIL/Apo-2L in controlling tumor metastasis, with TRAIL/Apo-2L-expressing NK cells being the predominant cell responsible (31, 32, 33, 66). Our findings demonstrate the use of CpG ODN to induce TRAIL/Apo-2L expression on peripheral blood CD14+ M{phi}, and are similar to those recently published by Washburn et al. (67), who showed that M{phi} directly stimulated by Newcastle disease virus produce type I IFN that induces the expression of functional TRAIL/Apo-2L. M{phi} constitute ~40% of Ficoll-Hypaque-isolated PBMC, making it possible to create copious TRAIL/Apo-2L-expressing effector cells using CpG ODN therapy to eliminate tumor cells. Indeed, studies dating back 30 years suggest such a role by M{phi}, in which tumor-specific cell-mediated immunity was induced in tumor-bearing guinea pigs using bacille Calmette-Guérin therapy (68, 69, 70). In this model, M{phi} were the predominant cells responding and infiltrating into the experimental tumors. Obviously, the role of TRAIL/Apo-2L in the guinea pig system was not investigated; however, it is tempting to speculate that our study describing the CpG ODN-induced expression of TRAIL/Apo-2L on M{phi} explains these observations of old.

The second, and perhaps more important, potential role for TRAIL/Apo-2L is the induction of systemic antitumor immune responses. Recent reports have demonstrated the critical role that DC play in the generation of such antitumor responses, especially because of the ability of DC to cross-present the Ags derived from apoptotic cells in an MHC class I-restricted fashion that leads to increased Ag-specific CTL activity (71, 72). As previously mentioned, CpG ODN can mature pDC, causing them to secrete proinflammatory cytokines, such as IFN, IL-12, and TNF, and increase surface expression of MHC and costimulatory molecules (6, 7, 14, 15, 16). Thus, the use of CpG ODN in cancer therapy protocols may further increase the maturation and immunostimulatory capacity of DC to induce systemic antitumor immunity.

Although the potential of CPG ODN therapy, either alone or combined with other agents, in cancer immunotherapy is becoming evident, the exact mechanisms by which CpG ODN stimulate such antitumor immune responses are still being elucidated. The results presented in this work define the indirect conversion of M{phi} into TRAIL/Apo-2L-expressing effector cells following CpG ODN stimulation. Additional studies are needed, however, to determine whether our in vitro results occur in vivo. Regardless, the presence of a TRAIL/Apo-2L component broadens the potential impact of CpG ODN cancer immunotherapy.


   Acknowledgments
 
We thank Drs. David Lubaroff and Timothy Ratliff for critical review of the manuscript. We also thank Dr. Kira Gantt for phlebotomy assistance.


   Footnotes
 
1 This work was supported by the Edwin Beer Program of The New York Academy of Medicine, and a Department of Defense Prostate Cancer Research Program New Investigator Award (PC010599). Back

2 Address correspondence and reprint requests to Dr. Thomas S. Griffith, Department of Urology, 3204 MERF, University of Iowa, 375 Newton Road, Iowa City, IA 52242-1089. E-mail address: thomas-griffith{at}uiowa.edu Back

3 Abbreviations used in this paper: DC, dendritic cell; BDCA, blood DC Ag M{phi}, macrophage; ODN, oligodeoxynucleotide; pDC, plasmacytoid DC; TLR, Toll-like receptor; TRAIL, TNF-related apoptosis-inducing ligand. Back

Received for publication February 26, 2003. Accepted for publication April 28, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Steinman, R. M.. 1991. The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9:271.[Medline]
  2. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
  3. O’Doherty, U., R. M. Steinman, M. Peng, P. U. Cameron, S. Gezelter, I. Kopeloff, W. J. Swiggard, M. Pope, N. Bhardwaj. 1993. Dendritic cells freshly isolated from human blood express CD4 and mature into typical immunostimulatory dendritic cells after culture in monocyte-conditioned medium. J. Exp. Med. 178:1067.[Abstract/Free Full Text]
  4. O’Doherty, U., M. Peng, S. Gezelter, W. J. Swiggard, M. Betjes, N. Bhardwaj, R. M. Steinman. 1994. Human blood contains two subsets of dendritic cells, one immunologically mature and the other immature. Immunology 82:487.[Medline]
  5. Fanger, N. A., D. Voigtlaender, C. Liu, S. Swink, K. Wardwell, J. Fisher, R. F. Graziano, L. C. Pfefferkorn, P. M. Guyre. 1997. Characterization of expression, cytokine regulation, and effector function of the high affinity IgG receptor Fc{gamma}RI (CD64) expressed on human blood dendritic cells. J. Immunol. 158:3090.[Abstract]
  6. Krug, A., A. Towarowski, S. Britsch, S. Rothenfusser, V. Hornung, R. Bals, T. Giese, H. Engelmann, S. Endres, A. M. Krieg, G. Hartmann. 2001. Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12. Eur. J. Immunol. 31:3026.[Medline]
  7. Jarrossay, D., G. Napolitani, M. Colonna, F. Sallusto, A. Lanzavecchia. 2001. Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells. Eur. J. Immunol. 31:3388.[Medline]
  8. Akira, S., K. Takeda, T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immun. 2:675.[Medline]
  9. Takeda, K., S. Akira. 2001. Roles of Toll-like receptors in innate immune responses. Genes Cells 6:733.[Abstract]
  10. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  11. Takeshita, F., C. A. Leifer, I. Gursel, K. J. Ishii, S. Takeshita, M. Gursel, D. M. Klinman. 2001. Cutting edge: role of Toll-like receptor 9 in CpG DNA-induced activation of human cells. J. Immunol. 167:3555.[Abstract/Free Full Text]
  12. Krieg, A., H. Davis. 2001. Enhancing vaccines with immune stimulatory CpG DNA. Curr. Opin. Mol. Ther. 3:15.[Medline]
  13. Krieg, A., J. Kline. 2000. Immune effects and therapeutic applications of CpG motifs in bacterial DNA. Immunopharmacology 48:303.[Medline]
  14. Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdorfer, S. Blackwell, Z. K. Ballas, S. Endres, A. M. Krieg, G. Hartmann. 2001. Identification of CpG oligonucleotide sequences with high induction of IFN-{alpha}/{beta} in plasmacytoid dendritic cells. Eur. J. Immunol. 31:2154.[Medline]
  15. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres, G. Hartmann. 2002. Quantitative expression of Toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168:4531.[Abstract/Free Full Text]
  16. Bauer, M., V. Redecke, J. W. Ellwart, B. Scherer, J. P. Kremer, H. Wagner, G. B. Lipford. 2001. Bacterial CpG-DNA triggers activation and maturation of human CD11c-, CD123+ dendritic cells. J. Immunol. 166:5000.[Abstract/Free Full Text]
  17. Isaacs, A., J. Lindenmann. 1987. Virus interference. I. The interferon. J. Interferon Res. 7:429.
  18. Negrier, S., B. Escudier, C. Lasset, J. Y. Douillard, J. Savary, C. Chevreau, A. Ravaud, A. Mercatello, J. Peny, M. Mousseau, et al 1998. Recombinant human interleukin-2, recombinant human interferon {alpha}-2a, or both in metastatic renal cell carcinoma: Groupe Francais d’Immunotherapie. N. Engl. J. Med. 338:1272.[Abstract/Free Full Text]
  19. Spencer, W. F., W. M. Linehan, M. M. Walther, G. P. Haas, M. T. Lotze, S. L. Topalian, J. C. Yang, M. J. Merino, J. R. Lange, B. A. Pockaj, S. A. Rosenberg. 1992. Immunotherapy with interleukin-2 and {alpha}-interferon in patients with metastatic renal cell cancer with in situ primary cancers: a pilot study. J. Urol. 147:24.[Medline]
  20. Luo, Y., X. Chen, T. M. Downs, W. C. DeWolf, M. A. O’Donnell. 1999. IFN-{alpha} 2B enhances Th1 cytokine responses in bladder cancer patients receiving Mycobacterium bovis bacillus Calmette-Guérin immunotherapy. J. Immunol. 162:2399.[Abstract/Free Full Text]
  21. Gresser, I.. 1990. Biologic effects of interferons. J. Invest. Dermatol. 95:66S.[Medline]
  22. Herberman, R. B., C. W. Reynolds, J. R. Ortaldo. 1986. Mechanism of cytotoxicity by natural killer (NK) cells. Annu. Rev. Immunol. 4:651.[Medline]
  23. Lindahl, P., P. Leary, I. Gresser. 1972. Enhancement by interferon of the specific cytotoxicity of sensitized lymphocytes. Proc. Natl. Acad. Sci. USA 69:721.[Abstract/Free Full Text]
  24. Morikawa, K., H. Kubagawa, T. Suzuki, M. D. Cooper. 1987. Recombinant interferon-{alpha}, -{beta}, and -{gamma} enhance the proliferative response of human B cells. J. Immunol. 139:761.[Abstract]
  25. Adams, D. O., T. A. Hamilton. 1984. The cell biology of macrophage activation. Annu. Rev. Immunol. 2:283.[Medline]
  26. Schultz, R., M. Chirigos. 1978. Similarities among factors that render macrophages tumoricidal in lymphokine and interferon preparations. Cancer Res. 38:1003.[Abstract/Free Full Text]
  27. Vogel, S., D. Finbloom, K. English, D. Rosenstreich, S. Langreth. 1983. Interferon-induced enhancement of macrophage Fc receptor expression: {beta}-interferon treatment of C3H/HeJ macrophages results in increased numbers and density of Fc receptors. J. Immunol. 130:1210.[Abstract]
  28. Chen, B. D., F. Najor. 1987. Macrophage activation by interferon {alpha} + {beta} is associated with a loss of proliferative capacity: role of interferon {alpha} + {beta} in the regulation of macrophage proliferation and function. Cell. Immunol. 106:343.[Medline]
  29. Griffith, T. S., S. R. Wiley, M. Z. Kubin, L. M. Sedger, C. R. Maliszewski, N. A. Fanger. 1999. Monocyte-mediated tumoricidal activity via the tumor necrosis factor-related cytokine, TRAIL. J. Exp. Med. 189:1343.[Abstract/Free Full Text]
  30. Schmaltz, C., O. Alpdogan, B. J. Kappel, S. J. Muriglan, J. A. Rotolo, J. Ongchin, L. M. Willis, A. S. Greenberg, J. M. Eng, J. M. Crawford, et al 2002. T cells require TRAIL for optimal graft-versus-tumor activity. Nat. Med. 8:1433.[Medline]
  31. Seki, N., Y. Hayakawa, A. D. Brooks, J. Wine, R. H. Wiltrout, H. Yagita, J. E. Tanner, M. J. Smyth, T. J. Sayers. 2003. Tumor necrosis factor-related apoptosis-inducing ligand-mediated apoptosis is an important endogenous mechanism for resistance to liver metastases in murine renal cancer. Cancer Res. 63:207.[Abstract/Free Full Text]
  32. Takeda, K., M. J. Smyth, E. Cretney, Y. Hayakawa, N. Kayagaki, H. Yagita, K. Okumura. 2002. Critical role for tumor necrosis factor-related apoptosis-inducing ligand in immune surveillance against tumor development. J. Exp. Med. 195:161.[Abstract/Free Full Text]
  33. Cretney, E., K. Takeda, H. Yagita, M. Glaccum, J. J. Peschon, M. J. Smyth. 2002. Increased susceptibility to tumor initiation and metastasis in TNF-related apoptosis-inducing ligand-deficient mice. J. Immunol. 168:1356.[Abstract/Free Full Text]
  34. Griffith, T. S., W. A. Chin, G. C. Jackson, D. H. Lynch, M. Z. Kubin. 1998. Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J. Immunol. 161:2833.[Abstract/Free Full Text]
  35. Dzionek, A., A. Fuchs, P. Schmidt, S. Cremer, M. Zysk, S. Miltenyi, D. W. Buck, J. Schmitz. 2000. BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. J. Immunol. 165:6037.[Abstract/Free Full Text]
  36. Kawarada, Y., R. Ganss, N. Garbi, T. Sacher, B. Arnold, G. J. Hammerling. 2001. NK- and CD8+ T cell-mediated eradication of established tumors by peritumoral injection of CpG-containing oligodeoxynucleotides. J. Immunol. 167:5247.[Abstract/Free Full Text]
  37. Weiner, G. J., H. M. Liu, J. E. Wooldridge, C. E. Dahle, A. M. Krieg. 1997. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc. Natl. Acad. Sci. USA 94:10833.[Abstract/Free Full Text]
  38. Miconnet, I., S. Koenig, D. Speiser, A. Krieg, P. Guillaume, J. C. Cerottini, P. Romero. 2002. CpG are efficient adjuvants for specific CTL induction against tumor antigen-derived peptide. J. Immunol. 168:1212.[Abstract/Free Full Text]
  39. Heckelsmiller, K., K. Rall, S. Beck, A. Schlamp, J. Seiderer, B. Jahrsdorfer, A. Krug, S. Rothenfusser, S. Endres, G. Hartmann. 2002. Peritumoral CpG DNA elicits a coordinated response of CD8 T cells and innate effectors to cure established tumors in a murine colon carcinoma model. J. Immunol. 169:3892.[Abstract/Free Full Text]
  40. Pitti, R. M., S. A. Marsters, S. Ruppert, C. J. Donahue, A. Moore, A. Ashkenazi. 1996. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J. Biol. Chem. 271:12687.[Abstract/Free Full Text]
  41. Wiley, S. R., K. Schooley, P. J. Smolak, W. S. Din, C. P. Huang, J. K. Nicholl, G. R. Sutherland, T. D. Smith, C. Rauch, C. A. Smith, et al 1995. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity 3:673.[Medline]
  42. Degli-Esposti, M. A., P. J. Smolak, H. Walczak, J. Waugh, C.-P. Huang, R. F. DuBose, R. G. Goodwin, C. A. Smith. 1997. Cloning and characterization of TRAIL-R3, a novel member of the emerging TRAIL receptor family. J. Exp. Med. 186:1165.[Abstract/Free Full Text]
  43. Kayagaki, N., N. Yamaguchi, M. Nakayama, H. Eto, K. Okumura, H. Yagita. 1999. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression on human T cells: a novel mechanism for the antitumor effects of type I IFNs. J. Exp. Med. 189:1451.[Abstract/Free Full Text]
  44. Zamai, L., M. Ahmad, I. M. Bennett, L. Azzoni, E. S. Alnemri, B. Perussia. 1998. Natural killer (NK) cell-mediated cytotoxicity: differential use of TRAIL and Fas ligand by immature and mature primary human NK cells. J. Exp. Med. 88:2375.
  45. Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan, Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194:863.[Abstract/Free Full Text]
  46. Van Furth, R., Z. A. Cohn. 1968. The origin and kinetics of mononuclear phagocytes. J. Exp. Med. 128:415.[Abstract]
  47. Adams, D. O.. 1989. Molecular interactions in macrophage activation. Immunol. Today 10:33.[Medline]
  48. Te Velde, A. A., C. G. Figdor. 1992. Monocyte mediated cytotoxic activity against melanoma. Melanoma Res. 1:303.[Medline]
  49. Griffith, T. S., D. H. Lynch. 1998. TRAIL: a molecule with multiple receptors and control mechanisms. Curr. Opin. Immunol. 10:559.[Medline]
  50. Degli-Esposti, M. A., W. C. Dougall, P. J. Smolak, J. Y. Waugh, C. A. Smith, R. G. Goodwin. 1997. The novel receptor TRAIL-R4 induces NF-{kappa}B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity 7:813.[Medline]
  51. Malkowicz, S. B.. 2000. Intravesical therapy for superficial bladder cancer. Semin. Urol. Oncol. 18:280.[Medline]
  52. Wiemann, B., C. O. Starnes. 1994. Coley’s toxins, tumor necrosis factor and cancer research: a historical perspective. Pharmacol. Ther. 64:529.[Medline]
  53. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
  54. Yi, A. K., J. H. Chace, J. S. Cowdery, A. M. Krieg. 1996. IFN-{gamma} promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J. Immunol. 156:558.[Abstract]
  55. Redford, T. W., A. K. Yi, C. T. Ward, A. M. Krieg. 1998. Cyclosporin A enhances IL-12 production by CpG motifs in bacterial DNA and synthetic oligodeoxynucleotides. J. Immunol. 161:3930.[Abstract/Free Full Text]
  56. Cella, M., D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakajima, A. Lanzavecchia, M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat. Med. 5:919.[Medline]
  57. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah, S. Ho, S. Antonenko, Y. J. Liu. 1999. The nature of the principal type 1 interferon-producing cells in human blood. Science 284:1835.[Abstract/Free Full Text]
  58. Lynch, D. H., A. Andreasen, E. Maraskovsky, J. Whitmore, R. E. Miller, J. C. Schuh. 1997. Flt3 ligand induces tumor regression and antitumor immune responses in vivo. Nat. Med. 3:625.[Medline]
  59. Renshaw, S. A., J. S. Parmar, V. Singleton, S. J. Rowe, D. H. Dockrell, S. K. Dower, C. D. Bingle, E. R. Chilvers, M. K. Whyte. 2003. Acceleration of human neutrophil apoptosis by TRAIL. J. Immunol. 170:1027.[Abstract/Free Full Text]
  60. Ursini-Siegel, J., W. Zhang, A. Altmeyer, E. N. Hatada, R. K. Do, H. Yagita, S. Chen-Kiang. 2002. TRAIL/Apo-2 ligand induces primary plasma cell apoptosis. J. Immunol. 169:5505.[Abstract/Free Full Text]
  61. Kaplan, M. J., E. E. Lewis, E. A. Shelden, E. Somers, R. Pavlic, W. J. McCune, B. C. Richardson. 2002. The apoptotic ligands TRAIL, TWEAK, and Fas ligand mediate monocyte death induced by autologous lupus T cells. J. Immunol. 169:6020.[Abstract/Free Full Text]
  62. Miura, Y., N. Misawa, Y. Kawano, H. Okada, Y. Inagaki, N. Yamamoto, M. Ito, H. Yagita, K. Okumura, H. Mizusawa, Y. Koyanagi. 2003. Tumor necrosis factor-related apoptosis-inducing ligand induces neuronal death in a murine model of HIV central nervous system infection. Proc. Natl. Acad. Sci. USA 100:2777.[Abstract/Free Full Text]
  63. Taimr, P., H. Higuchi, E. Kocova, R. A. Rippe, S. Friedman, G. J. Gores. 2003. Activated stellate cells express the TRAIL receptor-2/death receptor-5 and undergo TRAIL-mediated apoptosis. Hepatology 37:87.[Medline]
  64. Walczak, H., R. E. Miller, K. Ariail, B. Gliniak, T. S. Griffith, M. Kubin, W. Chin, J. Jones, A. Woodward, T. Le, et al 1999. Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo. Nat. Med. 5:157.[Medline]
  65. Ashkenazi, A., R. C. Pai, S. Fong, S. Leung, D. A. Lawrence, S. A. Marsters, C. Blackie, L. Chang, A. E. McMurtrey, A. Hebert, et al 1999. Safety and antitumor activity of recombinant soluble Apo2 ligand. J. Clin. Invest. 104:155.[Medline]
  66. Takeda, K., Y. Hayakawa, M. J. Smyth, N. Kayagaki, N. Yamaguchi, S. Kakuta, Y. Iwakura, H. Yagita, K. Okumura. 2001. Involvement of tumor necrosis factor-related apoptosis-inducing ligand in surveillance of tumor metastasis by liver natural killer cells. Nat. Med. 7:94.[Medline]
  67. Washburn, B., M. A. Weigand, A. Grosse-Wilde, M. Janke, H. Stahl, E. Rieser, M. R. Sprick, V. Schirrmacher, H. Walczak. 2003. TNF-related apoptosis-inducing ligand mediates tumoricidal activity of human monocytes stimulated by Newcastle disease virus. J. Immunol. 170:1814.[Abstract/Free Full Text]
  68. Key, M. E., M. G. Hanna, Jr.. 1981. Mechanism of action of BCG-tumor cell vaccines in the generation of systemic tumor immunity. I. Synergism between BCG and line 10 tumor cells in the induction of an inflammatory response. J. Natl. Cancer Inst. 67:853.
  69. Fidler, I. J., T. Kataoka, M. G. Hanna, Jr.. 1976. A comparison of in vitro cell-mediated reactivity against syngeneic tumor cells by various lymphoid cell populations from bacillus Calmette-Guérin-tumor-cured, tumor-sensitized, tumor-bearing, and normal inbred guinea pigs. Cancer Res. 36:4459.[Abstract/Free Full Text]
  70. Littman, B. H., M. S. Meltzer, R. P. Cleveland, B. Zbar, H. J. Rapp. 1973. Tumor-specific, cell-mediated immunity in guinea pigs with tumors. J. Natl. Cancer Inst. 51:1627.
  71. Albert, M. L., B. Sauter, N. Bhardwaj. 1998. Dendritic cells acquire antigen from apoptotic cells and induce class I-restricted CTLs. Nature 392:86.[Medline]
  72. Bevan, M. J.. 1976. Cross-priming for a secondary cytotoxic response to minor H antigens with H-2 congenic cells which do not cross-react in the cytotoxic assay. J. Exp. Med. 143:1283.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
E. L. Brincks, A. Katewa, T. A. Kucaba, T. S. Griffith, and K. L. Legge
CD8 T Cells Utilize TRAIL to Control Influenza Virus Infection
J. Immunol., October 1, 2008; 181(7): 4918 - 4925.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
R. V. Warke, K. J. Martin, K. Giaya, S. K. Shaw, A. L. Rothman, and I. Bosch
TRAIL Is a Novel Antiviral Protein against Dengue Virus
J. Virol., January 1, 2008; 82(1): 555 - 564.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. L. VanOosten and T. S. Griffith
Activation of Tumor-Specific CD8+ T Cells after Intratumoral Ad5-TRAIL/CpG Oligodeoxynucleotide Combination Therapy
Cancer Res., December 15, 2007; 67(24): 11980 - 11990.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
B. G. Molenkamp, P. A.M. van Leeuwen, S. Meijer, B. J.R. Sluijter, P. G.J.T.B. Wijnands, A. Baars, A. J.M. van den Eertwegh, R. J. Scheper, and T. D. de Gruijl
Intradermal CpG-B Activates Both Plasmacytoid and Myeloid Dendritic Cells in the Sentinel Lymph Node of Melanoma Patients
Clin. Cancer Res., May 15, 2007; 13(10): 2961 - 2969.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
M. A. Cassatella
On the production of TNF-related apoptosis-inducing ligand (TRAIL/Apo-2L) by human neutrophils
J. Leukoc. Biol., June 1, 2006; 79(6): 1140 - 1149.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. Chaperot, A. Blum, O. Manches, G. Lui, J. Angel, J.-P. Molens, and J. Plumas
Virus or TLR Agonists Induce TRAIL-Mediated Cytotoxic Activity of Plasmacytoid Dendritic Cells
J. Immunol., January 1, 2006; 176(1): 248 - 255.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. J. Kemp, J. M. Moore, and T. S. Griffith
Human B Cells Express Functional TRAIL/Apo-2 Ligand after CpG-Containing Oligodeoxynucleotide Stimulation
J. Immunol., July 15, 2004; 173(2): 892 - 899.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
A. T. Ludwig, J. M. Moore, Y. Luo, X. Chen, N. A. Saltsgaver, M. A. O'Donnell, and T. S. Griffith
Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand: A Novel Mechanism for Bacillus Calmette-Guerin-Induced Antitumor Activity
Cancer Res., May 15, 2004; 64(10): 3386 - 3390.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kemp, T. J.
Right arrow Articles by Griffith, T. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kemp, T. J.
Right arrow Articles by Griffith, T. S.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS