The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bullen, D. V. R.
Right arrow Articles by Handman, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bullen, D. V. R.
Right arrow Articles by Handman, E.
The Journal of Immunology, 2003, 170: 4267-4272.
Copyright © 2003 by The American Association of Immunologists

Persistence of Lesions in Suppressor of Cytokine Signaling-1-Deficient Mice Infected with Leishmania major1

Denise V. R. Bullen, Tracey M. Baldwin, Joan M. Curtis, Warren S. Alexander and Emanuela Handman2

The Walter & Eliza Hall Institute of Medical Research and the Cooperative Research Center for Cellular Growth Factors, Royal Melbourne Hospital, Victoria, Australia


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To investigate the role of the cytokine IFN-{gamma} and its negative regulator, the suppressor of cytokine signaling-1 (SOCS1) in the progression of cutaneous leishmaniasis, we infected mice lacking a single copy of the gene encoding SOCS1 (SOCS1+/-), mice lacking both copies of IFN-{gamma} (IFN-{gamma}-/-), or mice lacking copies of both SOCS1 and IFN-{gamma} (SOCS1-/- IFN-{gamma}-/-), with a moderate dose of 103 or 104 of the most virulent stage of parasites, metacyclic promastigotes. Surprisingly, SOCS1+/- mice developed larger lesions than wild-type mice, although the parasite load in the draining lymph node was not significantly altered. These mice also developed apparently normal Th1 responses, as indicated by elevated levels of IFN-{gamma} and low levels of IL-4 and IL-10. The persistence of lesions and the enlargement of draining lymph nodes despite a normal Th1 response and control of parasitemia indicate that there may be a dissociation of the inflammatory pathology and clearance of parasites in SOCS1+/- mice. We also investigated the role of the related suppressor of cytokine signaling, SOCS2, which has been implicated in the development of Th1 immunity. The progression of disease in SOCS2-/- mice did not differ from that in C57BL/6 control mice, suggesting that it is not involved in the host response to Leishmania major infection and supporting the specific role of SOCS1. These results suggest that SOCS1 plays an important role in the regulation of appropriate inflammatory responses during the resolution of L. major infection.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The clinical manifestations of human cutaneous leishmaniasis caused by Leishmania major, L. tropica, and L. mexicana display a spectrum of disease severity (1). The spectrum of disease phenotype observed in human cutaneous leishmaniasis can be reproduced in the laboratory by infection of different inbred strains of mice with L. major. In particular, two strains, the highly susceptible BALB/c and the resistant C57BL/6, have been widely used to study the biology of the host response to infection. In this system the marked polarization in the Th cell immune response observed upon challenge with L. major has been implicated in determining the severity of disease. BALB/c mice produce Th2-type cytokines, in particular IL-4 and IL-10, which have been shown to be associated with disease progression and susceptibility (2, 3, 4). In contrast, recovery from infection in resistant C57BL/6 mice depends upon the induction of a Th1-type response, resulting in activation of macrophages and killing of intracellular organisms (5, 6).

There is now significant evidence that the commonly used infection of mice by inoculation at the base of the tail or the footpad with large numbers of parasites does not reflect the situation during the natural course of disease, where small numbers of the virulent metacyclic forms of the parasite are introduced by the sand-fly. Sacks and colleagues (7, 8) have described a new model for cutaneous leishmaniasis that more closely resembles natural infection; it involves intradermal infection in the pinna of the ear of BALB/c or C57BL/6 mice with small numbers of virulent metacyclic promastigotes. We have modified this method by injecting 103 or 104 metacyclic promastigotes into the pinna of the ear to investigate the role in disease progression of two members of the family of negative regulators of cytokine signaling, the suppressor of cytokine signaling-1 and -2 (SOCS1 and SOCS2).3

SOCS1 is a key regulator of cytokine signal transduction through inhibition of the Janus kinases (9, 10, 11). Although studies in vitro indicated that SOCS1 regulates signaling responses to a range of cytokines, including IFN-{alpha}, IL-2, IL-6, and TNF-{alpha} (9, 12, 13, 14), analysis of SOCS1-deficient mice has suggested a more specific role in vivo, in particular in the regulation of IFN-{gamma} signaling (15, 16). SOCS1-deficient mice die at ~3 wk of age from a complex inflammatory disease characterized by fatty degeneration of the liver (17). Mice that lack both SOCS1 and IFN-{gamma} survive to adulthood and appear in good health, indicating that IFN-{gamma} is a critical mediator of this disease (15). IFN-{gamma} induces SOCS1 expression, and signaling in response to this cytokine is inhibited by SOCS1. Further, it has been shown that mice lacking SOCS1 are more susceptible to the toxic effects of IFN-{gamma} (15, 16), and there is evidence to suggest that SOCS1-/- mice have elevated serum concentrations of IFN-{gamma} (18). Our earlier studies have shown that SOCS1-/- macrophages can be activated by extremely low levels of IFN-{gamma} to kill intracellular L. major (15).

We reasoned that mice lacking SOCS1, which display a heightened responsiveness to IFN-{gamma} and produce more IFN-{gamma}, would be more resistant to L. major infection. However, SOCS1-null mice have a dramatically reduced life span (2–4 wk) that makes them incompatible with the study of chronic diseases such as leishmaniasis. For this reason we examined the disease phenotype in mice lacking one copy of the SOCS1 gene as well as mice lacking SOCS1 and IFN-{gamma}. Surprisingly, mice lacking one copy of the SOCS1 gene displayed larger lesions than wild-type C57BL/6 mice. However, they displayed comparable parasite burdens in the draining lymph nodes, suggesting dissociation of skin pathology and the immune clearance of parasites.

The related SOCS2 has been implicated in T cell immune regulation on the basis of its expression in Th1 cells (19). However, the absence of SOCS2 did not alter the progression of disease in L. major-infected SOCS2-null mice.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Parasites

The virulent clone V121 derived from the Israeli L. major human isolate LRC-L137 (MHOM/IL/67/Jericho II) was obtained from the World Health Organization Reference Center for Leishmaniasis (Jerusalem, Israel). The culture conditions have been described previously (20). Metacyclic promastigotes were isolated by negative selection with peanut agglutinin (Vector Laboratories, Burlingame, CA) as previously described (21).

Mice

SOCS1-/- mice were generated on a mixed C57BL/6 x 129/Sv genetic background as previously described (17). The mice were subsequently backcrossed to C57BL/6 mice for >10 generations to obtain SOCS1-null mice on a pure C57BL/6 background. IFN-{gamma}-/- mice were obtained from The Jackson Laboratory (Bar Harbor, ME). The SOCS1 and IFN-{gamma} genotypes of the intercross mice were determined by Southern blot analysis of tail tip genomic DNA as previously described (17). It is important to note that the mice used to generate IFN-{gamma}-/- and SOCS1-/- IFN-{gamma}-/- progeny were not backcrossed, but remained on the mixed C57BL/6 x 129/Sv background. SOCS2-/- mice were generated on a C57BL/6 genetic background as previously described (22). All mice were housed in conventional clean animal rooms.

Intradermal infection

Metacyclic L. major V121 promastigotes were inoculated intradermally into the pinna of the ear using a 30-gauge needle (104 parasites in a volume of 10 µl of PBS in each ear). Lesion development was measured based on the diameter and thickness of the lesion as follows: 0 = no visible lesion, 1 = lesion of diameter <2 mm, 2 = diameter 2–5 mm, 3 = lesion >5 mm, and 4 = lesion covering >80% of the ear. To facilitate the graphic representation of lesion scores, a random number in the range 0–0.5 was arbitrarily added to each lesion score. This led to the staggering of the scores (jittering), so that otherwise superimposed data points could be separated on the graph. Using this representation of the data allowed us to view the entire cohort of mice at all time points.

Limiting dilution analysis of parasite burden

Limiting dilution analysis was conducted as previously described (23). Briefly, lymph nodes draining the ear lesions were collected from infected mice. Dispersed cell suspensions prepared in Schneider’s Drosophila Medium (Life Technologies, Gaithersburg, MD) were titrated across a 96-well plate, and the highest dilution containing parasites was determined. The parasite burden was calculated per 106 lymph node cells.

Flow cytometry

Dispersed cell suspensions were prepared from the lymph nodes draining the ear lesions of L. major-infected mice. Cells were incubated variously with specific mAbs to the following murine cell surface Ags: CD4, CD8, and B220 (clones RM4-5, 53-6.7, and RA3-6B2, respectively; BD PharMingen, San Jose, CA). Abs were directly conjugated to FITC or R-PE. After propidium iodide staining (1 µg/ml), the cells were washed and fixed in PBS, pH 7.3, containing 1% formaldehyde, 2% glucose, and 5 mM sodium azide. Analyses were performed on a FACScan cell sorter (BD Biosciences, Mountain View, CA) using CellQuest software, with dead cells and erythrocytes excluded on the basis of propidium iodide staining and gating of forward scatter of light.

Real-time fluorescence PCR analysis of IL-4, IL-10, and IFN-{gamma} mRNA expression

Total RNA was extracted from the draining lymph nodes of infected mice using the RNeasy kit from Qiagen (Hilden, Germany) and following the manufacturer’s instructions. cDNA was produced from 1–2 µg of RNA by RT with oligo(dT) primer and Superscript II RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). Real-time fluorescence PCR assays were conducted in the LightCycler using Faststart DNA Master SYBR Green kit (Roche Molecular Biochemicals, Basel, Switzerland) with the primers for IL-4, IL-10, IFN-{gamma}, and the housekeeping gene porphobilinogen deaminase (PBGD) as follows: IL-4: forward primer, TTTTGAACGAGGTCACAGGA; reverse, AGCCCTACAGACGAGCTCAC; IL-10: forward primer, ATCGATTTCTCCCCTGTGAA; reverse, TTCATGGCCTTGTAGACACCT; IFN-{gamma}: forward, CTTCTTCAGCAACAGCAAGG; reverse, TGAGCTCATTGAATGCTTGG; and PBGD: forward primer, CCTGGTTGTTCACTCCCTGA; reverse, CAACAGCATCACAAGGGTTTT.

To control for differential loading of cDNA we calculated relative IL-4, IL-10, and IFN-{gamma} concentrations by dividing by the amount of PBGD transcript. We also calculated the ratio IFN-{gamma}:IL-4.

Isotyping of Abs to L. major in mouse serum

The Ab response to soluble L. major V121 Ag in infected mice was analyzed using the Mouse Typer SubIsotyping Kit (Bio-Rad, Hercules, CA) following the manufacturer’s instructions. Metacyclic Leishmania-soluble Ag was prepared by cyclic freeze/thawing of a suspension of 108 L. major V121 metacyclic promastigotes/ml in PBS and was used at a 1/100 dilution. The titers of the isotypes IgG1, IgG2a, and IgG2c were determined for each mouse. Rabbit anti-IgG1 and -IgG2a were provided in the above kit, and biotinylated mouse anti-IgG2c polyclonal serum was provided by Dr. A. Lew (Walter & Eliza Hall Institute, Melbourne, Australia). This polyclonal serum was generated by immunization of BALB/c mice with a vector encoding IgG2c DNA from nonobese diabetic mice (24).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Pattern of lesion development in SOCS1 mice

Mice were infected intradermally in the pinna of the ear with 104 metacyclic L. major promastigotes, and lesion development was monitored for 12 wk. Wild-type SOCS1+/+ mice developed visible lesions within 1–2 wk of infection. Lesion severity peaked after 3 wk and began to resolve after 7 wk. While the lesions appeared in the SOCS1+/- mice at about the same time, in contrast to wild-type mice the lesions continued to increase in size after wk 3 and peaked at 5–6 wk after infection (Fig. 1A). Lesions were significantly larger in SOCS1+/- mice at wk 5 of infection (p = 0.018; n = 7–9) and at every subsequent week (p = 0.004–0.05). By wk 12, most SOCS1+/- mice still displayed significant lesions, while the wild-type mice were cured by wk 10 (Fig. 1A).



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 1. Infection of SOCS1+/+ and SOCS1+/- mice with 104 L. major metacyclic promastigotes. A, Lesions were significantly larger in SOCS1+/- mice at wk 5 of infection (p = 0.018; n = 7–9) and at every subsequent week (p = 0.004–0.05). Individual lesion scores are shown, modified according to the formula: lesion score = raw score + RND, where RND is a random number between 0 and 0.5. {blacktriangleup}, SOCS1+/+ mice; •, SOCS1+/- mice. B, Analysis of the draining lymph node. Parasite burdens did not differ significantly, while at wk 12 lymph node cellularity was elevated in SOCS1+/- compared with SOCS1+/+ mice (p = 0.026). Bars represent the total number of cells in the draining lymph nodes; error bars represent 1 SD ({blacksquare}, SOCS1+/+; , SOCS1+/-). Points show the number of parasites per 106 cells ({blacktriangleup}, SOCS1+/+ mice; •, SOCS1+/- mice).

 
In wild-type mice the number of lymphoid cells in the lymph nodes draining the lesions increased during the active period of lesion development between wk 1 and 9 of infection and decreased with the resolution of lesions (Fig. 1B). In these mice the parasite burden in the draining lymph node peaked at wk 3. A similar pattern was observed in SOCS1+/- mice, with the number of cells in the draining lymph nodes increasing from wk 3 onward. However, unlike the wild-type mice, the number of cells remained elevated at wk 12 (p = 0.026), at which time lesions were still present. In the wild-type mice, parasite burden in the draining lymph nodes correlated with lesion size, with a peak at wk 3 of infection and a decrease with healing of lesions. In the SOCS1+/- mice parasite burden followed a similar course and decreased by wk 12. However, at wk 12 lesions had not resolved, suggesting a dissociation between lesion size and parasite burden.

Disease pattern in mice lacking IFN-{gamma}

Mice lacking IFN-{gamma} and C57BL/6 mice were infected with 103 metacyclic promastigotes, and the pattern of lesion development was assessed. C57BL/6 mice showed a similar pattern of lesion development as that in mice infected with 104 parasites (Fig. 1), although the onset was slightly delayed (Fig. 2A). In contrast, IFN-{gamma}-/- mice rapidly developed large lesions that they were unable to resolve (Fig. 2A). Mice lacking both IFN-{gamma} and SOCS1 exhibited a similar rapid progression of disease (Fig. 2A). Analysis of the draining lymph nodes from infected IFN-{gamma}-/- and SOCS1-/- IFN-{gamma}-/- mice revealed equivalent increases in cellularity and parasite load in these mice (Fig. 2B).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 2. Infection of IFN-{gamma}-/- and SOCS1-/- IFN-{gamma}-/- mice with 103 L. major metacyclic promastigotes. A, There was no significant difference in lesion evolution between IFN-{gamma}-/- and SOCS1-/- IFN-{gamma}-/- mice. Individual lesion scores are shown, modified according to the formula: lesion score = raw score + RND, where RND is a random number between 0 and 0.5. {blacktriangleup}, C57BL/6 mice; {diamond}, IFN-{gamma}-/- mice; •, SOCS1-/- IFN-{gamma}-/- mice. B, Analysis of the draining lymph node. No significant differences were detected in lymph nodes between IFN-{gamma}-/- and SOCS1-/- IFN-{gamma}-/- mice. Bars represent the total number of cells in the draining lymph nodes; error bars represent 1 SD ({square}, IFN-{gamma}-/-; {blacksquare}, SOCS1-/- IFN-{gamma}-/-). Number of parasites per 106 cells: {diamond}, IFN-{gamma}-/- mice; •, SOCS1-/- IFN-{gamma}-/- mice.

 
Cell populations in the draining lymph nodes of SOCS1+/+ and SOCS1+/- mice

Cells were harvested from the draining lymph nodes of infected mice, and the lymphocyte populations were analyzed by flow cytometry (Fig. 3). There were no significant differences between SOCS1+/+ and SOCS1+/- mice in the CD4+ and B220+ lymphocyte populations between wk 1 and 9. At wk 6 there were significantly more CD8+ cells in SOCS1+/- mice. At wk 12 total cell numbers were significantly elevated in SOCS1+/- mice, and the numbers of B220+, CD4+, and CD8+ cells were all significantly increased (p = 0.022, 0.021, and 0.025, respectively). Most of the difference in cell numbers between SOCS1+/+ and SOCS1+/- mice was due to an almost 5-fold disparity in the number of B cells. Between wk 9 and 12, the proportion of B220+ cells in wild-type mice decreased slightly, while in SOCS1+/- mice, this percentage increased significantly (p = 0.013).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 3. Flow cytometric analysis of cell populations in the draining lymph nodes of L. major-infected SOCS1+/+ and SOCS1+/- mice. The total numbers of cells (x106) are shown; error bars represent 1 SD. A, B220+ cells; B, CD4+ cells; C, CD8+ cells. {blacksquare}, SOCS1+/+; , SOCS1+/-. There were no significant differences between SOCS1+/+ and SOCS1+/- mice in the CD4+ and B220+ lymphocyte populations between wk 1 and 9. At wk 6 there were significantly more CD8+ cells in SOCS1+/- mice (p = 0.016). At wk 12 total cell numbers were significantly elevated in SOCS1+/- mice, and the numbers of B220+, CD4+, and CD8+ cells were all significantly increased (p = 0.022, 0.021, and 0.025, respectively).

 
Analysis of Th phenotype

Th1 immune responses have been implicated in the resolution of cutaneous leishmaniasis, while Th2 responses have been shown to be associated with disease severity. To assess the role of the signature Th1/Th2 cytokines in the susceptibility of SOCS1+/- mice, we collected sera from mice at wk 1, 3, 6, 9, and 12 after infection and examined their L. major-specific IgG isotype. IgG1 has been associated with IL-4-mediated Th2 immune responses, while IgG2a and 2c are indicative of an IFN-{gamma}-mediated Th1 response. We found no significant difference between SOCS1+/+ and SOCS1+/- serum isotypes, with both groups having more IgG2c than IgG1 (data not shown).

As a more direct measure of the Th cell populations present in the draining lymph node during infection, the expression of mRNA encoding IFN-{gamma}, IL-4, and IL-10 was examined. We used quantitative real-time RT-PCR with the single-copy housekeeping gene encoding PBGD as a control to adjust for cDNA loading (Fig. 4). In the case of IL-4 the detectable levels were low, and there was some variability between individual mice (Fig. 4A). Despite this variability it appeared that in wild-type SOCS1+/+ mice the relative amount of IL-4 did not change during infection and was still present at wk 12 when the mice had already cured their lesions. Moreover, there was no difference in IL-4 mRNA levels between wild-type and SOCS1+/- mice, consistent with the similar parasite burdens in the lymph nodes of these mice.



View larger version (10K):
[in this window]
[in a new window]
  		FIGURE 4. Real-time quantitative PCR analysis of cytokine mRNA expression in the draining lymph nodes from SOCS1+/+ and SOCS1+/- mice infected with L. major. A, IL-4 expression relative to expression of the housekeeping gene PBGD. No significant differences were detected. B, Expression of IL-10 relative to PBGD expression. No significant differences were detected. C, Expression of IFN-{gamma} relative to PBGD expression. In wild-type mice IFN-{gamma} mRNA levels increased significantly between wk 1 and 6 (p = 0.041) and decreased after wk 6 (p = 0.040) as the lesions healed. In SOCS1+/- mice there was a similar increase in IFN-{gamma} mRNA between wk 1 and 3 (p = 0.031); however, expression remained high even at wk 12 postinfection while these mice still displayed lesions. D, The ratio of IFN-{gamma}:IL-4 expression. {blacktriangleup}, SOCS1+/+; •, SOCS1+/-.

 
The expression of IL-10 was also low and relatively unchanged throughout the infection (Fig. 4B). In contrast, in wild-type mice IFN-{gamma} mRNA levels increased significantly between wk 1 and 6 (p = 0.041) and decreased after wk 6 (p = 0.040) as the lesions healed. In SOCS1+/- mice there was a similar increase in IFN-{gamma} mRNA between wk 1 and 3 (p = 0.031), but, surprisingly, it remained high even at wk 12 postinfection while these mice still displayed lesions (Fig. 4C).

In view of the unexpected levels of IL-4 in wild-type mice, it was of interest to examine the ratio IFN-{gamma}:IL-4. This ratio did not change significantly in SOCS1+/+ or SOCS1+/- mice during the course of the disease (Fig. 4D). These results are consistent with a recent study in which it was found that the loss of SOCS1 did not alter the direction of Th polarization (25).

Pattern of lesion development in SOCS2-null mice

SOCS2 is up-regulated in Th1 cells in vitro (19). To assess whether SOCS2 plays a role in the regulation of Th cell function in vivo, we investigated the response of mice lacking SOCS2 to infection with L. major. SOCS2-/- mice were infected intradermally with 104 metacyclic promastigotes in the pinna of the ear. The development of lesions in these mice did not differ significantly from that in control C57BL/6 mice (Fig. 5A). Analysis of the cellularity of draining lymph nodes from the infected mice showed that total lymphoid cell numbers increased in both wild-type and SOCS2-/- mice, with a peak 3 wk after infection (Fig. 5B). At 3 wk there were significantly more lymphoid cells in SOCS2-deficient mice than in controls (p = 0.018). However, at wk 6 and 10 the two groups had similar numbers of cells. Measurement of parasite burdens in lymph nodes draining the lesions did not reveal any significant differences (Fig. 5B).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 5. Infection of SOCS2-/- and C57BL/6 mice with 104 L. major metacyclic promastigotes. A, There was no significant difference in lesion evolution between SOCS2-/- and C57BL/6 mice. Individual lesion scores are shown, modified according to the formula: lesion score = raw score + RND, where RND is a random number between 0 and 0.5. {blacktriangleup}, C57BL/6 mice; •, SOCS2-/- mice. B, Analysis of the draining lymph node. No significant differences in parasite burden were detected in the lymph nodes between SOCS2-/- and C57BL/6 mice. At 3 wk there were significantly more lymphoid cells in the SOCS2-deficient mice than in the control mice (p = 0.018). Bars represent the total number of cells in the draining lymph nodes; error bars represent 1 SD. {blacksquare}, C57BL/6; , SOCS2-/-. Number of parasites per 106 cells: {blacktriangleup}, C57BL/6 mice; •, SOCS 2-/- mice.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
L. major parasites are typically transmitted by intradermal inoculation into the mammalian host by the sand-fly vector. Previous studies of the immune response to L. major infection in vivo have often involved the injection of large numbers (106) of stationary phase promastigotes into the footpad, or intradermally or s.c. at the base of the tail. The relevance of this in vivo model has recently been questioned following the development of a natural model of infection incorporating a low dose (102) of metacyclic promastigotes and strictly intradermal injection into the pinna of the ear (7, 8). In this study we have modified the ear model by using a moderate number of metacyclic promastigotes but strict intradermal infection into the pinna of the ear. This change was deemed necessary because of the expected need to generate larger lesions faster (see below).

C57BL/6 mice developed lesions faster, and these progressed to a larger size than reported using 102 parasites, thus allowing a larger window to observe potential changes in disease pattern in the SOCS1-null mice. The parasite burdens in the draining lymph nodes of C57BL/6 mice mirrored the lesion development.

SOCS1 is a key regulator of cytokine signal transduction, and it mediates its function through its interaction with the Janus kinases. Previous studies established that SOCS1 is a key regulator of IFN-{gamma} signaling, and that IFN-{gamma} is responsible for the lethal neonatal disease observed in SOCS1-deficient mice (15, 16). Therefore, we expected that SOCS1-deficient mice, in which IFN-{gamma} responses are uncontrolled, would show increased resistance to infection with L. major. With this in mind, we used the modified ear model to address the potential role of SOCS1 in susceptibility to leishmaniasis.

In contrast to our expectation that the loss of one copy of the SOCS1 gene would render the SOCS1+/- mice more resistant, they developed larger lesions, which took longer to resolve and showed a prolonged elevation of lymph node cellularity. At 12 wk after infection the numbers of CD4+, CD8+, and B220+ lymphocytes as well as total cellularity were all significantly higher in SOCS1+/- than in SOCS1+/+ mice. In particular, there were at least 4-fold more B220+ cells in SOCS1+/- compared with wild-type mice. It is interesting to speculate that this dramatic increase might be due to a decreased ability to turn off B cell proliferation signaling. Although no data are available for heterozygous mice, hyperproliferation of T cells has been described in null mice (26). The surprising differences seen in lymph node lymphocyte populations between SOCS1+/+ and SOCS1+/- mice at wk 12 lead us to speculate that a similar situation may be present in the lesion itself, and that such changes, if present, may contribute to the delayed healing phenotype observed. It should be possible to address these questions through histological analyses of the lymphocyte population present in the skin during infection.

Resistance to L. major infection in C57BL/6 mice is associated with IFN-{gamma} production, while the susceptibility of BALB/c mice is associated with expression of IL-4 and IL-10. Analysis of cytokine gene expression by lymphocytes from SOCS1+/- mice revealed no significant increases in IL-4 or IL-10 despite the increased lesion sizes seen in these mice. In fact, these mice demonstrated a prolonged elevation of IFN-{gamma} expression, and the IFN-{gamma}:IL-4 ratio in SOCS1+/- mice was characteristic of a Th1 response. These results are consistent with a recent study in which it was shown that loss of SOCS1 increased the intensity of Th polarization without, however, altering the direction of polarization (25).

As expected, in view of the critical role for IFN-{gamma} in leishmaniasis, mice lacking IFN-{gamma} showed rapid development of a nonhealing lesion with concomitant development of uncontrolled parasitemia. The additional loss of SOCS1 in SOCS1-/- IFN-{gamma}-/- mice did not significantly alter disease progression, possibly due to the aggressive pathology of disease in these susceptible mice, such that the SOCS1-dependent loss of control of inflammatory responses was inconsequential.

The progression of disease in SOCS2-/- mice infected with L. major did not differ significantly from that in C57BL/6 controls, indicating that despite its potential involvement in Th1 immune responses, SOCS2 is not involved in the control of cutaneous leishmaniasis.

In summary, we found that following a strictly intradermal infection with L. major, mice lacking a single copy of SOCS1 developed a normal Th1-biased immune response and were able to control parasitemia in a manner similar to that of wild-type mice. However, SOCS1+/- mice were unable to appropriately control inflammatory responses following clearance of the parasites, as demonstrated by the persistence of lesions and lymphadenopathy. Such failure to control inflammation has been reported in the homozygous SOCS1-/- mice, which develop fatal inflammatory liver disease (27) and also in adult mice lacking SOCS1 and IFN-{gamma} (28).

Previous analyses of negative regulators in leishmaniasis focused on the role of molecules that regulate T cell differentiation by altering the Th1/Th2 balance, such as Bcl6 and CTLA4 (4). SOCS1 differs from these negative regulators in that it appears to affect both Th1 and Th2 differentiation without altering their balance (25), suggesting that SOCS1 may exert its effect at different steps during the evolution of disease. Since the lack of one SOCS1 allele is sufficient to cause hyper-responsiveness to Th-inducing stimuli, including pathogens such as Listeria monocytogenes and Nippostrongylus brasiliensis (25), it is possible that the enhanced response to pathogens may not only lead to rapid clearance, but also cause enhanced tissue damage by a hyperactivated immune system.


   Acknowledgments
 
We thank J. Mighall, S. Cane, L. Bryan, and D. Advani for skilful technical assistance throughout this study; Andreas Strasser and Andrew Lew for providing anti-IgM and anti-IgG2c Abs, respectively; and Robyn Starr for critical review of the manuscript. We thank Colleen Elso for designing the primers that were used in real-time fluorescence PCR.


   Footnotes
 
1 This work was supported by the National Health and Medical Research Council of Australia, the National Institutes of Health (Grant CA22556), and the Australian Federal Government Cooperative Research Centers Program. Back

2 Address correspondence and reprint requests to Dr. Emanuela Handman, The Walter & Eliza Hall Institute of Medical Research, Post Office Royal Melbourne Hospital, Victoria 3050, Australia. E-mail: handman{at}wehi.edu.au Back

3 Abbreviations used in this paper: SOCS, suppressor of cytokine signaling; PBGD, porphobilinogen deaminase. Back

Received for publication November 14, 2002. Accepted for publication February 10, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Handman, E.. 2000. Cell biology of Leishmania. Adv. Parasitol. 44:1.
  2. Locksley, R. M., F. P. Heinzel, M. D. Sadick, B. J. Holaday, K. D. Gardner, Jr. 1987. Murine cutaneous leishmaniasis: susceptibility correlates with differential expansion of helper T-cell subsets. Ann. Pasteur Inst. Immunol. 138:744.
  3. Kane, M. M., D. M. Mosser. 2001. The role of IL-10 in promoting disease progression in leishmaniasis. J. Immunol. 166:1141.[Abstract/Free Full Text]
  4. Sacks, D., N. Noben-Trauth. 2002. The immunology of susceptibility and resistance to Leishmania major in mice. Nat. Rev. Immunol. 2:845.[Medline]
  5. Solbach, W., T. Laskay. 2000. The host response to Leishmania infection. Adv. Immunol. 74:275.[Medline]
  6. Biedermann, T., S. Zimmermann, H. Himmelrich, A. Gumy, O. Egeter, A. K. Sakrauski, I. Seegmüller, H. Voigt, P. Launois, A. D. Levine, et al 2001. IL-4 instructs TH1 responses and resistance to Leishmania major in susceptible BALB/c mice. Nat. Immunol. 2:1054.[Medline]
  7. Belkaid, Y., S. Kamhawi, G. Modi, J. Valenzuela, N. Noben-Trauth, E. Rowton, J. Ribeiro, D. L. Sacks. 1998. Development of a natural model of cutaneous leishmaniasis: powerful effects of vector saliva and saliva preexposure on the long-term outcome of Leishmania major infection in the mouse ear dermis. J. Exp. Med. 188:1941.[Abstract/Free Full Text]
  8. Belkaid, Y., S. Mendez, R. Lira, N. Kadambi, G. Milon, D. Sacks. 2000. A natural model of Leishmania major infection reveals a prolonged "silent" phase of parasite amplification in the skin before the onset of lesion formation and immunity. J. Immunol. 165:969.[Abstract/Free Full Text]
  9. Starr, R., T. A. Willson, E. M. Viney, L. J. Murray, J. R. Rayner, B. J. Jenkins, T. J. Gonda, W. S. Alexander, D. Metcalf, N. A. Nicola, et al 1997. A family of cytokine-inducible inhibitors of signalling. Nature 387:917.[Medline]
  10. Naka, T., M. Narazaki, M. Hirata, T. Matsumoto, S. Minamoto, A. Aono, N. Nishimoto, T. Kajita, T. Taga, K. Yoshizaki, et al 1997. Structure and function of a new STAT-induced STAT inhibitor. Nature 387:924.[Medline]
  11. Endo, T. A., M. Masuhara, M. Yokouchi, R. Suzuki, H. Sakamoto, K. Mitsui, A. Matsumoto, S. Tanimura, M. Ohtsubo, H. Misawa, et al 1997. A new protein containing an SH2 domain that inhibits JAK kinases. Nature 387:921.[Medline]
  12. Morita, Y., T. Naka, Y. Kawazoe, M. Fujimoto, M. Narazaki, R. Nakagawa, H. Fukuyama, S. Nagata, T. Kishimoto. 2000. Signals transducers and activators of transcription (STAT)-induced STAT inhibitor-1 (SSI-1)/suppressor of cytokine signaling-1 (SOCS-1) suppresses tumor necrosis factor {alpha}-induced cell death in fibroblasts. Proc. Natl. Acad. Sci. USA 97:5405.[Abstract/Free Full Text]
  13. Song, M. M., K. Shuai. 1998. The suppressor of cytokine signaling (SOCS) 1 and SOCS3 but not SOCS2 proteins inhibit interferon-mediated antiviral and antiproliferative activities. J. Biol. Chem. 273:35056.[Abstract/Free Full Text]
  14. Sporri, B., P. E. Kovanen, A. Sasaki, A. Yoshimura, W. J. Leonard. 2001. JAB/SOCS1/SSI-1 is an interleukin-2-induced inhibitor of IL-2 signaling. Blood 97:221.[Abstract/Free Full Text]
  15. Alexander, W. S., R. Starr, J. E. Fenner, C. L. Scott, E. Handman, N. S. Sprigg, J. E. Corbin, A. L. Cornish, R. Darwiche, C. M. Owczarek, et al 1999. SOCS1 is a critical inhibitor of interferon {gamma} signaling and prevents the potentially fatal neonatal actions of this cytokine. Cell 98:597.[Medline]
  16. Brysha, M., J. G. Zhang, P. Bertolino, J. E. Corbin, W. S. Alexander, N. A. Nicola, D. J. Hilton, R. Starr. 2001. Suppressor of cytokine signaling-1 attenuates the duration of interferon {gamma} signal transduction in vitro and in vivo. J. Biol. Chem. 276:22086.[Abstract/Free Full Text]
  17. Starr, R., D. Metcalf, A. G. Elefanty, M. Brysha, T. A. Willson, N. A. Nicola, D. J. Hilton, W. S. Alexander. 1998. Liver degeneration and lymphoid deficiencies in mice lacking suppressor of cytokine signaling-1. Proc. Natl. Acad. Sci. USA 95:14395.[Abstract/Free Full Text]
  18. Marine, J.-C., D. J. Topham, C. McKay, D. Wang, E. Parganas, D. Stravopodis, A. Yoshimura, J. N. Ihle. 1999. SOCS1 deficiency causes a lympocyte-dependent perinatal lethality. Cell 98:609.[Medline]
  19. Egwuagu, C. E., C. R. Yu, M. Zhang, R. M. Mahdi, S. J. Kim, I. Gery. 2002. Suppressors of cytokine signaling proteins are differentially expressed in Th1 and Th2 cells: implications for Th cell lineage commitment and maintenance. J. Immunol. 168:3181.[Abstract/Free Full Text]
  20. Handman, E., R. E. Hocking, G. F. Mitchell, T. W. Spithill. 1983. Isolation and characterization of infective and non-infective clones of Leishmania tropica. Mol. Biochem. Parasitol. 7:111.[Medline]
  21. Courret, N., E. Prina, E. Mougneau, E. M. Saraiva, D. L. Sacks, N. Glaichenhaus, J. C. Antoine. 1999. Presentation of the Leishmania antigen LACK by infected macrophages is dependent upon the virulence of the phagocytosed parasites. Eur. J. Immunol. 29:762.[Medline]
  22. Metcalf, D., C. J. Greenhalgh, E. Viney, T. A. Willson, R. Starr, N. A. Nicola, D. J. Hilton, W. S. Alexander. 2000. Gigantism in mice lacking suppressor of cytokine signalling-2. Nature 405:1069.[Medline]
  23. Titus, R. G., M. Marchand, T. Boon, J. A. Louis. 1985. A limiting dilution assay for quantifying Leishmania major in tissues of infected mice. Parasite Immunol. 7:545.[Medline]
  24. Martin, R. M., J. L. Brady, A. M. Lew. 1998. The need for IgG2c specific antiserum when isotyping antibodies from C57BL/6 and NOD mice. J. Immunol. Methods 212:187.[Medline]
  25. Fujimoto, M., H. Tsutsui, S. Yumikura-Futatsugi, H. Ueda, O. Xingshou, T. Abe, I. Kawase, K. Nakanishi, T. Kishimoto, T. Naka. 2002. A regulatory role for suppressor of cytokine signaling-1 in Th polarization in vivo. Int. Immunol. 14:1343.[Abstract/Free Full Text]
  26. Cornish, A. L., G. M. Davey, D. Metcalf, J. F. Purton, J. E. Corbin, C. J. Greenhalgh, R. Darwiche, L. Wu, N. A. Nicola, D. I. Godfrey, et al 2003. SOCS-1 has IFN{gamma}-independent actions in T-cell homeostasis. J. Immunol. 170:878.[Abstract/Free Full Text]
  27. Bullen, D. V. R., R. Darwiche, D. Metcalf, E. Handman, W. S. Alexander. 2001. Neutralization of interferon-{gamma} in neonatal SOCS1-/- mice prevents fatty degeneration of the liver but not subsequent fatal inflammatory disease. Immunology 104:92.[Medline]
  28. Metcalf, D., S. Mifsud, L. Di Rago, N. A. Nicola, D. J. Hilton, W. S. Alexander. 2002. Polycystic kidneys and chronic inflammatory lesions are the delayed consequences of loss of the suppressor of cytokine signaling-1 (SOCS-1). Proc. Natl. Acad. Sci. USA 99:943.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
T. Yang, P. Stark, K. Janik, H. Wigzell, and M. E. Rottenberg
SOCS-1 Protects against Chlamydia pneumoniae-Induced Lethal Inflammation but Hampers Effective Bacterial Clearance
J. Immunol., March 15, 2008; 180(6): 4040 - 4049.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Zimmermann, P. J. Murray, K. Heeg, and A. H. Dalpke
Induction of Suppressor of Cytokine Signaling-1 by Toxoplasma gondii Contributes to Immune Evasion in Macrophages by Blocking IFN-{gamma} Signaling
J. Immunol., February 1, 2006; 176(3): 1840 - 1847.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
C. Brender, R. Columbus, D. Metcalf, E. Handman, R. Starr, N. Huntington, D. Tarlinton, N. Odum, S. E. Nicholson, N. A. Nicola, et al.
SOCS5 Is Expressed in Primary B and T Lymphoid Cells but Is Dispensable for Lymphocyte Production and Function
Mol. Cell. Biol., July 1, 2004; 24(13): 6094 - 6103.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bullen, D. V. R.
Right arrow Articles by Handman, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bullen, D. V. R.
Right arrow Articles by Handman, E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS