The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Curnock, A. P.
Right arrow Articles by Ward, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Curnock, A. P.
Right arrow Articles by Ward, S. G.
The Journal of Immunology, 2003, 170: 4021-4030.
Copyright © 2003 by The American Association of Immunologists

Optimal Chemotactic Responses of Leukemic T Cells to Stromal Cell-Derived Factor-1 Requires the Activation of Both Class IA and IB Phosphoinositide 3-Kinases1

Adam P. Curnock2, Yannis Sotsios2, Karen L. Wright and Stephen G. Ward3

Department of Pharmacy and Pharmacology, Bath University, Bath, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stromal cell-derived factor-1 (SDF-1) and its receptor CXCR4 are a multifunctional chemokine/receptor system with essential roles in the development of the immune system and other aspects of embryogenesis, including vascularization and organ development. SDF-1 is also a potent chemoattractant for T cells and has roles in both inflammation and immune homeostasis. Our group has previously demonstrated that phosphoinositide 3-kinase (PI 3-kinase) is activated in SDF-1-stimulated T cells and is indeed required for SDF-1-mediated chemotaxis. In this study Jurkat clones were established, stably expressing dominant negative constructs of class IA and class IB PI 3-kinases under the control of the tetracycline off inducible gene system, to determine the relative roles of these PI 3-kinases in SDF-1 signaling. Our results show that expression of either kinase-dead PI3K{gamma} (KD-PI3K{gamma}) or {Delta}p85 (a construct unable to bind class IA p110{alpha}, -{beta}, or -{delta}) leads to a partial inhibition of SDF-1-stimulated protein kinase B phosphorylation, but had no effect on SDF-1-induced phosphorylation of the mitogen-activated protein kinase ERK1/2. Functional studies demonstrated that expression of KD-PI3K{gamma} markedly inhibited SDF-1-mediated chemotaxis, typically eliciting 40–60% inhibition. Interestingly, the expression of {Delta}p85 also leads to inhibition of the SDF-1-mediated chemotactic response, albeit to a much lesser extent than achieved with the KD-PI3K{gamma} mutant, typically in the range of 20–40% inhibition. Furthermore, the inhibition of chemotaxis by the expression of dominant negative class IA or class IB PI 3-kinases could be enhanced by the presence of the PI 3-kinase inhibitor LY294002. Together, these results demonstrate that optimal chemotactic response of leukemic T cells to SDF-1 requires the activation of both class IA and class IB PI 3-kinases.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The human chemokine system is comprised of ~50 chemokines and 20 G protein-coupled, seven-transmembrane chemokine receptors and is divided into four groups, C, CC, CXC, and CX3C chemokines, based upon the positioning of N-terminal cysteine residues (1). Chemokines play a central role in the development and regulation of the immune system. Primarily, they are responsible for the directional migration, or chemotaxis, of leukocyte populations, where they coordinate the homing of lymphocyte populations to specific lymphoid tissues and the recruitment of leukocytes to sites of infection or tissue damage. In addition to their chemotactic function, chemokines are implicated in other biological events, including cell growth, lymphopoiesis, vascularization, organ development, HIV pathogenesis, and tumor metastases (1, 2, 3, 4, 5, 6, 7, 8). The realization of the importance of chemokines in immune function has encouraged an escalation of research into the signaling pathways activated downstream of their receptors. One important discovery has been the identification of phosphoinositide 3-kinase (PI 3-kinase)4 as a pivotal enzyme responsible for regulating the key processes, actin polymerization and cell polarization, underlying chemokine-mediated chemotaxis (3, 4, 9, 10, 11, 12, 13, 14, 15).

PI 3-kinases catalyze the phosphorylation of phosphatidylinositol lipids (PtdIns) at the 3' position of the inositol ring to produce phosphatidylinositol 3-phosphate (PtdIns(3)P), phosphatidylinositol 3,4-bisphosphate (PtdIns(3,4)P2), and phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P3) (16). The levels of PtdIns(3,4)P2 and PtdIns(3,4,5)P3 are acutely regulated by class I PI 3-kinases in response to receptor stimulation and function as second messengers by recruiting pleckstrin homology (PH) domain-containing cytosolic proteins to the membrane, enabling them to perform either adaptor or catalytic roles (16, 17, 18, 19). Class IA PI 3-kinases are heterodimeric proteins, comprising a 110-kDa catalytic subunit and a prototypical regulatory subunit of 85 kDa that is responsible for recruiting the catalytic domain to the membrane by interactions with tyrosine-phosphorylated proteins via its SH2 domains. Three mammalian forms of the catalytic subunit (p110{alpha}, p110{beta}, and p110{delta}) and five different regulatory subunits (p85{alpha}, p85{beta}, p55{gamma}, and two splice variants of p85{alpha}, p50{alpha} and p55{alpha}) have been identified (20, 21, 22, 23). A G protein-coupled PI 3-kinase activity, consisting of a 120-kDa catalytic subunit, named p110{gamma}, and its 101-kDa regulatory subunit, have been purified and cloned (24, 25). The N-terminal region of p110{gamma} diverges considerably from class 1A PI 3-kinases, does not interact with p85 regulatory proteins, and has been designated a separate subclass, class IB (26).

Studies using green fluorescent protein-tagged PH domains that bind selectively to PtdIns(3,4,5)P3 or PtdIns(3,4,5)P3-specific Abs have revealed that PtdIns(3,4,5)P3 accumulates rapidly at the leading edge of chemoattractant-stimulated cells (11, 12). Furthermore, it has been demonstrated that protein kinase B (PKB), a major effector of the PI 3-kinase-dependent signaling cascade that interacts with PtdIns(3,4,5)P3 and PtdIns(3,4)P2 via its PH domain, colocalizes with these lipids and filamentous actin at the leading edge (13). These studies suggest that the polarized activation of PI 3-kinase and subsequent PtdIns(3,4,5)P3-dependent recruitment of PKB and possibly other PH domain-containing proteins are crucial early events in the detection of a chemoattractant gradient. Very recent studies have implicated intimate roles for PI 3-kinase, the lipid products of PI 3-kinase and Rho family GTPases in the generation of a positive feedback loop that produces an internal PtdIns(3,4,5)P3 gradient, exceeding that of the external chemoattractant gradient (14, 15). This provides a mechanism for the detection of very shallow chemoattractant gradients, enabling polarization and directional movement of cells. Recent exciting studies have also revealed a role for phosphatase and tensin homologue deleted on chromosome 10 (PTEN) in maintaining cell polarity by localizing at the rear and sides of cells, thus enhancing the polarized accumulation of PtdIns(3,4,5)P3 at the leading edge (27, 28).

Despite these exciting developments, it is unclear which PI 3-kinase isoforms are involved in the accumulation of PtdIns(3,4,5)P3 and PtdIns(3,4)P2 in response to chemokines. The G protein-sensitive PI3K{gamma} is an obvious candidate for the accumulation of PtdIns(3,4,5)P3 in response to chemokine stimulation of G protein-coupled chemokine receptors, as it is activated by G{beta}{gamma} following ligation of G protein-coupled receptors (26, 29). However, there is evidence that G protein-coupled receptors are able to activate class IA PI 3-kinases. It has been demonstrated that the p85/p110 type PI 3-kinases are synergistically activated by G{beta}{gamma} subunits of trimeric G proteins and phosphotyrosyl peptides (30, 31), and chemokine-mediated activation of p85/p110 class IA PI 3-kinases has been reported by several groups (32, 33, 34), suggesting that multiple PI 3-kinase isoforms are involved in chemotaxis.

Using a pharmacological approach, it is not possible to assign the chemokine-stimulated accumulation of PtdIns(3,4,5)P3 and the chemotactic response to a particular PI 3-kinase isoform, since available inhibitors do not exhibit sufficient isoform specificity. Genetic approaches have revealed a key role for p110{gamma} in chemotactic responses (35, 36, 37). However, studies with mice deficient in class IA PI3K activity are limited by impaired viability and the fact that p85{alpha}-/- and p85{beta}-/- mice retain the expression of at least one other isoform of the adaptor subunit (38, 39, 40). A common molecular approach used to assess the role of an enzyme in cellular responses is to establish stable transfectants that overexpress dominant-negative forms of the enzyme. However, given the importance of PI 3-kinase in cell growth and survival (41, 42), overexpression of dominant negative PI 3-kinase constructs is likely to be toxic and result in the selection of clones with other compensatory mutations, thus rendering direct comparisons with nonexpressing cells meaningless.

In this study we have used a tetracycline-regulated gene system to inducibly express dominant negative forms of class IA ({Delta}p85) and class IB (kinase-dead PI3K{gamma} (KD PI3K{gamma})) PI 3-kinases. Evidence is presented suggesting that optimal chemotactic response to SDF-1 requires the involvement of both class IA and class IB PI 3-kinases.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

A bovine p85{alpha} regulatory subunit construct with a deletion of the inter-SH2 domain (aa 479–513, which constitute the p110 binding domain) was a gift from Dr. M. Kasuga (Kobe University, Kobe, Japan). Porcine wild-type (WT) and KD-PI3K{gamma} constructs (K799R) were gifts from Dr. H. Takeda (Kobe University School of Medicine, Kobe, Japan). The response vector pUHD10-3hygro was provided by M. J. Welham (University of Bath, Bath, U.K.). SDF-1{alpha} and human insulin-like growth factor I (IGF-I) was purchased from R&D Systems (Abingdon, U.K.). A c-Myc mAb (9E10) was purified in-house from hybridoma supernatant. The anti-CXCR4 mAb, 12G5 was obtained from the National Institutes of Health AIDS Research and Reference Reagent Program. Polyclonal rabbit anti-ERK1/2 and goat anti-PKB were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Phospho-specific polyclonal Abs, recognizing PKB phosphoserine 473 and ERK1/2 (p42/p44) phosphorylated at threonine 202 and tyrosine 204, were purchased from New England Biolabs (Knowl Pierce, U.K.). G418, hygromycin B, pertussis toxin, LY294002, and wortmannin were purchased from Calbiochem (Nottingham, U.K.). Histone 2B (H2B) was supplied by Roche (Lewes, U.K.). The ECL system and [{gamma}-32P]ATP were obtained from Amersham International (Little Chalfont, U.K.). Cell culture reagents were purchased from Life Technologies (Paisley, U.K.). All other reagents were purchased from Sigma-Aldrich (Poole, U.K.). Where appropriate, stock solutions of drugs were prepared in a suitable solvent, aliquoted, and stored at -20°C. Final dilutions were made immediately before use.

Cell culture

The human leukemic T cell line Jurkat, stably expressing the pUHD15-1-neo plasmid (tetracycline off (Tet-OFF) Jurkat cells), was purchased from Clontech (Basingstoke, U.K.). Cells were cultured in humidified incubators in 5% CO2 at 37°C in RPMI 1640 medium, supplemented with 10% (v/v) FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin. For selection of Tet-Off clones expressing both regulatory and response vectors, the medium was supplemented with G418 (500 µg/ml), hygromycin B (300 µg/ml), and 2 µg/ml tetracycline.

Dominant negative PI 3-kinase cloning strategy

Dominant negative constructs of class IA and IB PI 3-kinases were subcloned into the response vector pUHD10-3hygro, which contained a hygromycin resistance gene, for direct selection of transfectants. For class IA PI3K, a bovine p85{alpha} regulatory subunit construct with a deletion of the inter-SH2 domain (aa 479–513, which constitute the p110 binding domain) was used. This {Delta}p85 is unable to bind to p110 catalytic domains, but retains its adapter function via its two SH2 domains, SH3, and proline-rich regions, and so overexpression of {Delta}p85 prevents the recruitment and activation of the catalytic subunit by out-competing endogenous p85 for binding sites. For the class IB PI 3-kinase, KD-PI3K{gamma} was used. KD-PI3K{gamma} has a single-point mutation in its catalytic domain, K799R, rendering it inactive. Both constructs were tagged by the decapeptide recognized by the c-Myc mAb 9E10 to enable screening for expressing clones (43).

Myc-tagged {Delta}p85 was excised from the pBluescript-N-Myc2 vector using SacII and EcoRI, and Myc-tagged WT and KD-PI3K{gamma} were excised from the vector pCDNA3 using KpnI and XbaI. All inserts were blunt ended on both the 3' and 5' ends using T4 polymerase, followed by the Klenow fragment of DNA polymerase. The response plasmid pUHD10-3hygro was linearized with XbaI, followed by blunt ending and removal of 3'-OH groups by treatment with calf intestinal phosphatase to minimize resealing of empty pUHD10-3 hygro. Ligation reactions of linearized, blunt-ended pUHD10-3 hygro with each of the blunt-ended Myc-tagged PI 3-kinase constructs were conducted and ligation products were used to transform Escherichia coli strain DH5{alpha}. Analytical restriction digests were performed to identify transformants with pUHD10-3hygro-containing Myc-tagged PI 3-kinase constructs in the correct orientation. The identity and orientation of the PI 3-kinase inserts were confirmed by sequencing using forward and reverse primers flanking the insertion site on pUHD10-3hygro. The forward primer sequence was CTCCATAGAAGACACCGGGA, and the reverse primer sequence was GCATTCTAGTTGTGGTTTGT. To confirm the identity of KD and WT p110{gamma} inserts, primers flanking the catalytic domain region were used: the forward primer sequence was CAGAATTTGAATCTCCCCCA, and the reverse primer sequence was TGATAGAGCCGTAGGATCGG. A single guanosine to adenosine substitution in codon 799, resulting in a lysine to arginine substitution, confirmed the identity of the kinase-dead PI3K{gamma} construct.

Transfection and selection of Tet-Off dominant negative PI 3-kinase Jurkat clones

The pUHD10–3/dominant-negative PI3K constructs were linearized with FspI and purified by gel electrophoresis, chloroform extraction, and ethanol precipitation. Jurkat cells already stably expressing the pUHD15-1-neo plasmid (Tet-Off Jurkats) were transfected with 10 µg of purified DNA by electroporation at 950 µF and 300 V. Cells were transferred to growth medium containing 2 µg/ml tetracycline and were cultured for 48 h in the absence of selection agents. Following this recovery period, the transfected cells were washed; resuspended in selection medium containing tetracycline (2 µg/ml), G418 (500 µg/ml), and hygromycin B (300 µg/ml); and aliquoted into 96-well plates at 1 x 104 cells/well. The levels of G418 and hygromycin B were maintained by replacing the medium on a weekly basis, while tetracycline was replenished every 48 h. From ~2 wk post-transfection, selected colonies were picked and transferred to 1 ml of selective medium in 24-well plates for expansion.

Flow cytometry

Cells (1 x 106) were washed twice in PBS and resuspended in 100 µl of anti-CXCR4 (12G5, 10 µg/ml) or corresponding IgG2a isotype control, diluted in PBS/10% FBS, and incubated for 45 min on ice. After washing, cells were incubated in 100 µl of anti-mouse IgG-FITC secondary Ab (1/250 dilution in PBS/10% FBS) for 45 min on ice. After washing, cells were analyzed by FACS (BD Biosciences, San Jose, CA).

Cell lysis

Cells (1 x 107/sample) were incubated in 1.5-ml microfuge tubes at 37°C, and after the indicated treatment regimens the reactions were terminated by pelleting the cells in a microfuge for 10 s, aspiration of the supernatant, and then resuspending in 500 µl of ice-cold lysis buffer (20 mM Tris (pH 7.4), 137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 10% glycerol (w/v), 1% Nonidet P-40 (w/v), and protease inhibitors, 1 mM PMSF, 2 µg/ml aprotinin, 2 µg/ml leupeptin, 2 µg/ml pepstatin A, and 1 mM sodium orthovanadate). Lysates were incubated on a rotator for 20 min, and nonsoluble material was removed by spinning in a microfuge at 14,000 rpm for 10 min. The protein levels in supernatants were determined by the bicinchoninic acid protein assay (Pierce and Warriner, Chester, U.K.) and adjusted to equal protein concentration by dilution with lysis buffer where necessary.

PKB assays

PKB assays were conducted following the procedure described by Reif et al. (44, 45). Cell lysates were preabsorbed with protein A-Sepharose (50 µl of a 50/50 slurry) for 1 h on a rotator and spun at 15,000 rpm to pellet the Sepharose beads, and the lysates were transferred to clean tubes. Anti-PKB Ab was preconjugated to protein G-agarose beads for 1 h at 4°C on a rotator (at 2 µg of Ab/20 µl of protein G-agarose (50/50 slurry)). Before use, anti-PKB/protein G-agarose beads, were washed three times in lysis buffer, and 20 µl was added to each sample, followed by incubation for 1–2 h on a rotator at 4°C. Immunoprecipitates were washed twice in lysis buffer, twice in high salt wash buffer (100 mM Tris (pH 7.5), 500 mM LiCl, and 1 mM EDTA), and once in PKB assay buffer (50 mM Tris (pH 7.5), 10 mM MgCl2, and 1 mM DTT). The last wash was removed as completely as possible, and reactions were started by adding 15 µl of PKB reaction buffer (PKB assay buffer containing, 50 µM ATP, 2.5 µg of H2B, 500 nM protein kinase inhibitor, and 3 µCi of [{gamma}-32P]ATP). The reaction was allowed to proceed for 30 min at 25°C with constant agitation and was terminated by adding SDS-PAGE sample buffer and boiling for 5 min. Samples were resolved on 14% SDS-PAGE gels. The lower half of the gel was dried and analyzed by autoradiography, followed by densitometric analysis (Gene Tools; Syngene, Cambridge, U.K.) to determine 32P incorporation into H2B. The upper half of the gel was transferred to nitrocellulose and probed for PKB, and densitometry was performed to enable normalization of 32P incorporation into H2B visualized using a chemiluminescent detection system (Amersham International).

Immunoblotting

Cell lysates were boiled for 5 min in sample buffer, and samples were loaded, at volumes corresponding to equivalent amounts of protein, onto 7.5% SDS-PAGE gels. After electrophoresis, resolved proteins were transferred onto nitrocellulose membranes and probed with the appropriate Abs. Briefly, membranes were blocked in TBS (10 mM Tris (pH 7.5) and 100 mM NaCl)/5% nonfat milk for 2 h, followed by overnight incubation with primary Ab (at 0.5–1 µg/ml diluted in TBS/0.1% Tween/0.01% sodium azide) at 4°C on a platform shaker. After extensive washing in TBS/Tween, membranes were incubated with an appropriate HRP-conjugated secondary Ab for 1 h. After a further round of extensive washing in TBS/Tween, membranes were developed using the ECL system. When necessary, membranes were stripped for reprobing by incubation in stripping buffer (62.5 mM Tris (pH 6.8), 2% SDS, and 100 mM 2-ME) at 60°C for 30 min.

Chemotaxis assays

Chemotaxis assays were conducted in 96-well chemotaxis chambers (NeuroProbe, Gaithersburg, MD). The wells of the 96-well plate in the lower chamber were filled with 385 µl of RPMI 1640/0.1% BSA containing a range of SDF-1 concentrations and carefully overlaid with a polyvinylpyrrolidine-free polycarbonate membrane (5 µm pore size). Jurkat cells were added to the upper chambers (200 µl of a 2 x 105 cell/ml suspension in RPMI 1640/0.1% BSA), and the chamber was incubated at 37°C for 2 h. The cell suspension was carefully aspirated off, and 200 µl of Versene (Life Technologies) was added to each well and incubated for 20 min at 4°C. The 96-well plate and attached membrane were centrifuged at 1500 rpm at 4°C for 10 min, and the supernatant was carefully aspirated off. The remaining cells were resuspended in 100 µl of RPMI/0.1% BSA, and cell numbers were determined from standard curves of the same cells using Cell Titer 96 AQueous reagent (Promega, Southampton, U.K.) following the manufacturer’s instructions.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of dominant negative class IA and IB PI 3-kinases is tightly regulated using the tetracycline off (Tet-Off) inducible gene system.

Tet-Off Jurkat clones, expressing dominant-negative class IA ({Delta}p85, a p85 deletion mutant lacking aa 479–513 of the inter-SH2 domain, which constitutes the p110 binding domain and hence is unable to bind p110{alpha}, -{beta}, or -{delta} catalytic subunits) and class IB (KD-PI3K{gamma}) PI 3-kinases were selected that exhibited tight regulation of expression, with minimal leakiness in the presence of tetracycline (Fig. 1A). High and intermediate expressing clones for {Delta}p85 (clones 1 and 2) and KD-PI3K{gamma} (clones 3 and 4, respectively) are demonstrated in Fig. 1A. The Tet-Off system allowed the levels of expression of {Delta}p85 and KD-PI3K{gamma} to be regulated dose-dependently over a range of tetracycline concentrations (IC50 = 0.3 ng/ml; Fig. 1B). FACS analysis of expressing clones revealed levels of CXCR4 surface expression similar to those seen in empty vector control cells (Fig. 1C).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 1. KD-PI3K{gamma} and {Delta}p85 expression is tightly regulated by tetracycline in Tet-Off Jurkats. A, Clones of Tet-Off Jurkat cells (2 x 104 cells/ml) transfected with either KD-PI3K{gamma} or {Delta}p85 were washed and incubated in the absence of 2 µg/ml tetracycline. B, Clone 1 ({Delta}p85 expressing) and clone 3 (KD-PI3K{gamma} expressing) were washed and incubated with a range of tetracycline concentrations for 48 h. Cell lysates (40 µg of protein) were resolved by SDS-PAGE and transferred to nitrocellulose membranes. Membranes were immunoblotted with a Myc epitope Ab, and protein was visualized by ECL. C, Expression of CXCR4 was assessed by immunostaining with a CXCR4 mAb (12G5) and FITC-conjugated secondary Ab, followed by FACS analysis, as described in Materials and Methods.

 
SDF-1-stimulated PKB activation is inhibited by the expression of class IA and IB dominant-negative PI 3-kinases

The serine/threonine kinase, PKB, is a major downstream effector of PI 3-kinase activity, whose recruitment and subsequent activation are entirely dependent on the lipid products of PI 3-kinase (46). Several studies have reported the activation of PKB following SDF-1 stimulation of leukocytes (47, 48, 49), and a specific role for PKB in the polarization of neutrophils toward a chemotactic gradient has been determined (12, 13). Therefore, we verified whether the PI 3-kinase mutants were indeed acting to disrupt PI 3-kinase activation by assessing their effect on PKB activation in the high expressing KD-PI3K{gamma} (clone 3) and {Delta}p85 (clone 1) clones using two approaches. Firstly, immunoblotting for phospho-Ser473 (a residue that is phosphorylated during the activation of PKB) and, secondly, using a specific PKB in vitro assay that measures kinase activity. SDF-1 stimulation time-course experiments were conducted in KD-PI3K{gamma} and {Delta}p85 clones in the presence or the absence of expression (i.e., precultured without or with tetracycline, respectively). Jurkat cells typically exhibit a high basal level of PKB phosphorylation and activity (50, 51). However, in response to SDF-1 stimulation, increases in both PKB phosphorylation and activity above basal were detected after 5–10 min in nonexpressing, dominant negative PI 3-kinase clones (i.e., cells incubated in the presence of tetracycline; Fig. 2, A and B) and empty vector control cells (data not shown). The expression of either KD-PI3K{gamma} or {Delta}p85 (i.e., clones incubated in the absence of tetracycline) led to an inhibition of SDF-1-stimulated PKB phosphorylation and activity (Fig. 2, A and B). The inhibition of receptor-stimulated PKB phosphorylation and activity by both KD-PI3K{gamma} and {Delta}p85 confirms that these constructs do indeed disrupt PI3K/PKB activation, probably by disrupting their respective endogenous PI 3-kinase activities.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 2. Expression of dominant negative class I PI 3-kinases inhibits SDF-1-stimulated PKB phosphorylation and activation. Tet-Off KD-PI3K{gamma} (clone 3) and {Delta}p85 (clone 1)-expressing Jurkat clones (2 x 104 cells/ml) were incubated in the presence or the absence of tetracycline (2 µg/ml) for 48 h. Before experimentation cells were washed twice in RPMI, resuspended at 1 x 106 cell/ml for phospho-PKB immunoblots or 1 x 107 cell/ml for PKB kinase assays, and serum-starved for 2 h. Cells were stimulated with SDF-1 (10 nM) for the indicated times, and cells were lysed as described in Materials and Methods. A, Cell lysates (40 µg protein) were resolved by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with anti-phospho-Ser473 PKB Ab, and protein was visualized with ECL. Equal loading was confirmed by reprobing with a PKB Ab, and dominant negative PI 3-kinase expression assessed by probing with an anti-Myc Ab. B, PKB was immunoprecipitated from cell lysates, and kinase assays were conducted as described in Materials and Methods. Reactions were terminated by the addition of sample buffer and boiling for 5 min. Samples were resolved by SDS-PAGE and transferred to nitrocellulose. The upper half was probed for PKB by immunoblotting with a PKB specific Ab (middle panel). The lower half was autoradiographed (top panel) and analyzed by densitometry to determine 32P incorporation into H2B (bottom panel).

 
Class I dominant negative PI 3-kinases do not inhibit SDF-1-stimulated ERK 1/2 activation

Several studies have demonstrated activation of the mitogen-activated protein kinase (MAPK) ERK1/2 in response to SDF-1 stimulation (47, 49, 52), but the role of ERK1/2 in chemokine mediated-chemotaxis is contentious. While the MAPK kinase inhibitor PD98059 was shown to partially inhibit SDF-1, eotaxin, and macrophage inflammatory protein-3{alpha}-induced chemotaxis in T cells and eosinophils, respectively (47, 53, 54), the chemotactic response of neutrophils to IL-8 was unaffected by PD98059 (55). This may reflect functional diversity, where chemokines couple to distinct signaling pathways to evoke a particular response.

The effects of dominant negative, class I PI 3-kinases on SDF-1-mediated ERK 1/2 activation were assessed using a phospho-specific Ab recognizing phospho-ERK1/2. An SDF-1 time-course experiment in nonexpressing, dominant negative PI 3-kinase clones demonstrated a rapid and transient activation of ERK1/2, peaking at 2 min and declining after 5 min (Fig. 3, top panels). The expression of KD-PI3K{gamma} or {Delta}p85 did not alter the profile of SDF-1-stimulated ERK1/2 phosphorylation in terms of either the magnitude or kinetics of phosphorylation.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 3. SDF-1-stimulated activation of ERK1/2 is not affected by the expression of dominant negative class I PI 3-kinases. Tet-Off KD-PI3K{gamma} (clone 3) and {Delta}p85 (clone 1)-expressing Jurkat clones (2 x 104 cells/ml) were incubated in the presence or the absence of tetracycline (2 µg/ml) for 48 h. Before experimentation cells were washed twice in RPMI, resuspended at 1 x 106 cell/ml, and serum-starved for 2 h. Cells were stimulated with SDF-1 (10 nM) for the indicated times. Cells were lysed as described in Materials and Methods, lysates (40 µg protein) were immunoblotted with anti-phospho-ERK1/2 Ab (top panels), and protein was visualized with ECL. Equal loading was confirmed by immunoblotting with an ERK 1/2 Ab (bottom panels), and dominant negative PI 3-kinase expression was assessed by probing with anti-Myc Ab (middle panels).

 
Expression of dominant negative class IA and class IB PI 3-kinases inhibits SDF-1-mediated chemotaxis

We and others have previously shown that SDF-1 stimulates a robust, wortmannin-sensitive chemotactic response in Jurkat T cells, suggesting that it is a PI 3-kinase-dependent event (33, 34, 47). The use of Jurkat clones, inducibly expressing class IA and class IB dominant negative PI 3-kinases, under the control of the Tet-Off system enabled the roles of individual PI 3-kinase isoforms in SDF-1-mediated chemotaxis to be assessed. In a noninduced state, dominant negative PI 3-kinase clones exhibited a characteristic bell-shaped chemotactic response to a range of SDF-1 concentrations (Fig. 4). Although individual clones exhibited different levels of chemotaxis, in terms of the number of cells migrating the overall profiles of chemotaxis were similar, with maximal chemotaxis observed in response to 1 nM SDF-1 in all clones. In the absence of a chemotactic gradient (equal concentrations of SDF-1 in the upper and lower wells), the migration of cells was not affected by the expression of mutated PI 3-kinase constructs in any clone examined (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 4. SDF-1-mediated chemotaxis is abrogated in dominant negative PI 3-kinase-expressing clones. Tet-Off Jurkat clones (2 x 104 cells/ml), stably transfected with KD-PI3K{gamma} clone 3 (A) and {Delta}p85 clone 2 (B) were incubated in the presence ({blacksquare}) or the absence ({square}) of 2 µg/ml tetracycline for 48 h, washed, and resuspended in RPMI/0.1% BSA. Cells (2 x 105 cells/200 µl) were added to the upper wells of a chemotaxis chamber (NeuroProbe), above lower wells containing varying concentrations of SDF-1 as described in Materials and Methods. Chemotaxis across a 5-µm membrane was determined after a 2-h incubation at 37°C in 5% CO2. The data are derived from an individual experiment with quintuplicate replicates that is representative of four other experiments. Data were analyzed by ANOVA, followed by Student’s t test to compare responses in the presence and the absence of Tet at individual concentrations of SDF-1 (**, p < 0.001; *, p < 0.05). A sample of cell lysate from both clones (40 µg of protein) was resolved by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with an Myc epitope Ab to verify the expression of the individual mutants (inset).

 
Clones expressing class I dominant negative PI 3-kinases exhibited impeded cell migration toward an SDF-1 gradient over a range of SDF-1 concentrations (Fig. 4, A and B). Compared with the maximal chemotaxis attained in respective noninduced cells in response to 1 nM SDF-1, the expression of KD-PI3K{gamma} inhibited chemotaxis by 62.5% (clone 3) and 36.8% (clone 4). In contrast, the expression of {Delta}p85 inhibited chemotaxis by 44.7% (clone 1) and 25.3% (clone 2). Thus, the degree of inhibition of chemotaxis generally correlates with the level of expression of the dominant negative PI 3-kinase (Table I).


View this table:
[in this window]
[in a new window]
 
Table I. Inhibition of SDF-1-mediated chemotaxis by dominant negative PI 3-kinases is dependent on their level of expressiona

 
Expression of dominant negative class IA, but not class IB, PI 3-kinases inhibits IGF-I-mediated chemotaxis

The ability of the PI 3-kinase mutants to influence migratory responses to other chemotactic factors that use receptor classes such as the tyrosine kinase-linked receptor for IGF-I was also investigated. While the expression of KD-PI3K{gamma} had no effect on the chemotactic responses to IGF-I, these responses were abrogated by the expression of the {Delta}p85 mutant (Fig. 5). This confirms that the inhibitory effects of the KD-PI3K{gamma} mutant on cell migration are context dependent, being able to influence responses initiated by chemotactic agents acting via G protein-coupled receptor, but not those acting via tyrosine kinase-linked receptors.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of {Delta}p85 and KD-PI3K{gamma} expression on IGF-I-stimulated chemotaxis. Tet-Off Jurkat clones (2 x 104 cells/ml), stably transfected with KD-PI3K{gamma} clone 3 and {Delta}p85 clone 2 as indicated, were incubated in the presence ({blacksquare}) or the absence ({square}) of 2 µg/ml tetracycline for 48 h, washed, and resuspended in RPMI/0.1% BSA. Cells (2 x 105 cells/200 µl) were added to the upper wells of a chemotaxis chamber (NeuroProbe) above lower wells containing 1 ng/ml IGF-I as described in Materials and Methods. Chemotaxis across a 5-µm membrane was determined after a 2-h incubation at 37°C in 5% CO2. Data are expressed as the mean chemotactic index (±SEM; n = 5), which is the ratio of cells migrating toward IGF-I vs cells randomly migrating. Data were analyzed by ANOVA, followed by Student’s t test to compare responses in the presence and the absence of Tet at individual concentrations of SDF-1 (*, p < 0.05).

 
{Delta}p85 and KD-PI3K{gamma} inhibition of SDF-1-mediated chemotaxis can be further abrogated by the PI 3-kinase inhibitor LY294002 and pertussis toxin

If, as indicated in the above data, both class IA and class IB PI 3-kinases are indeed required for an optimal chemotactic response to chemokine gradients, one might predict that the partial inhibition of chemotaxis observed in {Delta}p85- and KD-PI3K{gamma}-expressing cells would be further inhibited in the presence of a pharmacological inhibitor of PI 3-kinase activity. To address this hypothesis, chemotaxis assays with 1 nM SDF-1 were conducted on {Delta}p85- and KD-PI3K{gamma}-expressing cells preincubated with 30 µM LY294002 in either the absence or the presence of tetracycline. Incubation of cells with a range of LY294002 concentrations from 0.1–30 µM had no effect on the basal migration of cells alone (data not shown). When incubated with vehicle alone, the expression of KD-PI3K{gamma} inhibited SDF-1-mediated chemotaxis by ~60%. However, in the presence of LY294002, the chemotactic response in KD-PI3K{gamma}-expressing cells was reduced by ~80% (Fig. 6A). Similarly, addition of LY294002 to {Delta}p85-expressing cells resulted in ~75% inhibition of SDF-1-mediated chemotaxis compared with the 20% inhibition observed upon expression of {Delta}p85 in the absence of the inhibitor. The inhibitory effects of LY294002 on migration in the presence of either KD-PI3K{gamma} or {Delta}p85 were concentration dependent (Fig. 6, B and C). This partial inhibition of SDF-1-induced chemotaxis by cells expressing individual class IA and IB dominant-negative PI 3-kinase isoforms and the further inhibition seen in the presence of a pharmacological inhibitor of PI 3-kinase suggest a role for multiple class I PI 3-kinases in the SDF-1-mediated chemotactic response in human T cells. As expected, pertussis toxin completely abrogated the migratory responses of nonexpressing KD-PI3K{gamma} and {Delta}p85 clones to SDF-1 as previously reported (Fig. 7). Similarly, the addition of pertussis toxin abrogated the residual migratory activity that was observed upon the expression of either KD-PI3K{gamma} or {Delta}p85, thus confirming that the biochemical signals supporting the mutant resistant migration were mediated via Gi{alpha}-dependent routes.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 6. {Delta}p85 and KD-PI3K{gamma} inhibition of SDF-1-mediated chemotaxis is further inhibited by the PI 3-kinase inhibitor LY294002. A, Tet-Off Jurkat clones (2 x 104 cells/ml), stably transfected with KD-PI3K{gamma} clone 3 and {Delta}p85 clone 2, were incubated in the presence or the absence of 2 µg/ml tetracycline for 48 h (as indicated), washed, and resuspended in RPMI/0.1% BSA. Cells were preincubated with 10 µM LY294002 or vehicle for 30 min as indicated. KD-PI3K{gamma} clone 3 (B) or {Delta}p85 clone 1 (C; 2 x 104 cells/ml) cells were incubated with ({blacksquare}) or without ({square}) 2 µg/ml tetracycline as described above and treated with a range of LY294002 concentrations for 30 min. Cells (2 x 105 cells/200 µl) were added to the upper wells of a chemotaxis chamber (NeuroProbe) above lower wells containing 1 nM SDF-1 as described in Materials and Methods. Chemotaxis across a 5-µm membrane was determined after a 2-h incubation at 37°C in 5% CO2. Results are presented as the percent inhibition of maximal chemotaxis for each clone. Data are the mean ± SEM of at least four separate experiments. Data were analyzed by ANOVA, followed by Student’s t test to compare responses in the presence and the absence of Tet at individual concentrations of SDF-1. ***, p < 0.001; **, p < 0.01; **, p < 0.05.

 


View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 7. {Delta}p85 and KD-PI3K{gamma} inhibition of SDF-1-mediated chemotaxis is further inhibited by pertussis toxin. Tet-Off Jurkat clones (2 x 104 cells/ml) stably transfected with KD-PI3K{gamma} clone 3 and {Delta}p85 clone 2 were incubated in the presence ({blacksquare}) or the absence ({square}) of 2 µg/ml tetracycline for 48 h (as indicated), washed, and resuspended in RPMI/0.1% BSA. Cells were preincubated with 100 ng/ml pertussis toxin or vehicle for 6 h as indicated. Cells (2 x 105 cells/200 µl) were added to the upper wells of a chemotaxis chamber (NeuroProbe), above lower wells containing 1 nM SDF-1 as described in Materials and Methods. Chemotaxis across a 5-µm membrane was determined after a 2-h incubation at 37°C in 5% CO2. Results are presented as the number of cells migrating to the lower wells for each clone. Data are the mean ± SEM of at least four separate experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study has focused on the exclusive SDF-1/CXCR4 chemokine/receptor pair to investigate the regulation of chemotaxis and chemokine signaling by class I PI 3-kinases in human T cells. The use of the Tet-Off inducible gene system (56) to regulate the expression of dominant negative PI 3-kinases has allowed the relative roles of individual class I PI 3-kinase isoforms in SDF-1-mediated chemotaxis and signaling to be accurately assessed. Specific inhibition of class IA or class IB PI 3-kinases by the inducible expression of {Delta}p85 and KD-PI3K{gamma}, respectively, resulted in a partial inhibition of SDF-1-mediated chemotaxis that could be further inhibited by the PI 3-kinase inhibitor, LY294002. Taken together, these results provide evidence for the requirement of both class IA and class IB PI 3-kinase isoforms in the coordination of optimal SDF-1-induced chemotaxis.

The idea that multiple isoforms of PI 3-kinase are required for chemokine signaling is beginning to receive credence as more studies demonstrate the involvement of different PI 3-kinase isoforms in chemokine-mediated responses (35, 47, 57). Earlier studies (33, 47) presenting apparently conflicting results, implicating either class IB or class IA PI 3-kinases downstream of SDF-1 merely reflect differences in the methods used to measure PI 3-kinase activity and, in fact, independently demonstrate the importance of both PI 3-kinase isoforms. Several lines of evidence strongly support the involvement of the G{beta}{gamma}-dependent PI3K{gamma} in mediating PtdIns(3,4,5)P3 accumulation. Firstly, the importance of a functional PI3K{gamma} in chemokine-mediated chemotaxis has been demonstrated in studies of PI3K{gamma}-/- mice, where chemotaxis in response to a range of chemoattractants was partially inhibited in PI3K{gamma}-/- leukocytes (35, 36, 37). Secondly, neutrophils from PI3K{gamma}-/- mice are unable to produce PtdIns(3,4,5)P3 in response to the CXC chemokine IL-8 (35). Finally, the accumulation of PtdIns(3,4,5)P3 in cell lines stimulated by SDF-1 and MCP-1 can be completely inhibited by pretreatment with the G protein inhibitor pertussis toxin (47, 57, 58, 59). However, there is also compelling evidence for the involvement of class IA in chemokine signaling. For example, chemokine-mediated chemotaxis in leukocytes from PI3K{gamma}-/- was only partially abrogated (35), while chemoattractant-induced actin polymerization was not inhibited (36). Similarly, the pertussis toxin sensitivity of chemokine-stimulated PtdIns(3,4,5)P3 accumulation does not necessarily exclude the involvement of class IA PI 3-kinases. Indeed, the activation of class IA PI 3-kinases downstream of G protein-coupled receptors in a variety of leukocytes has been shown (60, 61), and class IA PI 3-kinases can be synergistically activated by G{beta}{gamma} subunits and tyrosine phosphoproteins at least under in vitro conditions (30, 31). It has also been postulated that activation of class 1B PI 3-kinases may influence the activation of class IA PI 3-kinases (3, 62). In this respect we have previously shown that activation of PI3K{gamma} and that of class IA PI 3-kinases following chemokine stimulation exhibit distinct kinetics, with PI3K{gamma} activity peaking within 15–30 s, while p85/p110 PI 3-kinase activation occurs within minutes after exposure to chemokine (3). The most likely route for chemokine-mediated activation of class IA PI 3-kinases is via G protein-mediated activation of tyrosine kinase activity and the subsequent recruitment and activation of p85/p110 heterodimers via phosphotyrosine interactions. In fact, several chemokines stimulate tyrosine kinase activity (4, 59), and one study has demonstrated the direct activation of Src kinases by GTP-bound Gi{alpha} (63). Furthermore, in vitro assays indicate that class IA PI 3-kinases are activated by SDF-1 and RANTES in T cells (47, 57), and in vivo, the use of a dominant negative class IA construct, indicates that they are indeed necessary for chemokine-induced chemotaxis in T cells (33).

The data presented in this report demonstrate partial inhibition of SDF-1-mediated chemotaxis by the expression of dominant-negative forms of either class IA or IB PI 3-kinases in human T cells. The inhibition of residual chemotactic activity in both {Delta}p85- and KD-PI3K{gamma}-expressing clones by a pharmacological inhibitor of PI 3-kinase further supports the role of multiple PI 3-kinase isoforms in chemokine-mediated responses. Alternatively, there is a small possibility that incomplete inhibition of migration by the individual mutants may simply reflect their inability to induce complete inhibition of the respective PI 3-kinases. This possibility cannot be entirely ruled out, and certainly the degree of inhibition of chemotaxis varies with the level of expression of mutants observed in different PI 3-kinase-expressing clones. In addition, there is evidence that different p85 regulatory subunits are able to associate with distinct proteins (64, 65, 66). Thus, {Delta}p85 (a deletion mutant of p85{alpha}) may not be an effective competitor for some substrates recognized specifically by other class IA regulatory subunits and hence be unable to completely inhibit catalytic subunit recruitment and activation. Another possibility is that overexpression of {Delta}p85 may inhibit chemotaxis indirectly by its ability to sequester adapter proteins with its SH2, SH3, and proline-rich domains. However, this is unlikely as this study has demonstrated that overexpression of {Delta}p85 specifically inhibits SDF-1-mediated PKB activation, but does not have any effect on SDF-1-induced ERK1/2 activation. It should be emphasized that even in the presence of a single dominant negative PI 3-kinase and optimal concentrations of PI 3-kinase inhibitor, cell migration was not completely abrogated. This suggests that other PI 3-kinase-independent pathways may contribute to the chemotactic response. Another possibility is the involvement of class II PI 3-kinases, which are less sensitive to PI 3-kinase inhibitors and are known to be activated by monocyte chemoattractant protein-1 (57) and SDF-1 (unpublished observation).

The expression of class IA and IB dominant-negative PI 3-kinases inhibited SDF-1-stimulated activation of PKB, not only confirming the inhibition of their respective endogenous PI 3-kinase activities, but also suggesting a role for PKB downstream of chemokine signaling. In Dictyostelium, PKB membrane localization and activation are crucial steps in the detection of chemotactic gradients, and mutants deficient in PKB are unable to polarize and migrate very inefficiently toward the chemotactic agent (67). Evidence for a similar role for PKB in mammalian cells is beginning to emerge, where PKB is recruited to the leading edge, by interaction with PtdIns(3,4,5)P3 and PtdIns(3,4)P2 via its PH domain, and colocalizes with filamentous actin (12, 13).

Interestingly, the expression of dominant negative class I PI 3-kinases did not interfere with SDF-1-induced activation of ERK1/2. Previously, we and others have shown that chemokine-stimulated ERK1/2 activation in various leukocytes is inhibited by PI 3-kinase inhibitors, suggesting a PI 3-kinase-dependent activation of the MAPK pathway (47, 55, 68). However, in other studies chemokine-mediated activation of ERK1/2 has proven to be refractory to PI 3-kinase inhibition (69). These discrepancies may be explained in terms of different chemokines coupling to MAPK activation via distinct signaling pathways or the involvement of other PI 3-kinase isoforms, for example, class II PI 3-kinase {alpha}, which, incidentally, is insensitive to concentrations of wortmannin and LY294002 that are routinely used to inhibit class I PI 3-kinases (57, 70).

Studies using PI3K{gamma}-/- knockout mice have shown that neutrophils exhibit differing degrees of inhibition of chemotaxis in response to different chemoattractants (35). This study highlights the fact that class IA PI 3-kinases can make a significant contribution to the chemotactic response mediated by chemokines. However, since the {Delta}p85 construct is able to interact with either p110{alpha}, -{beta}, and -{delta}, these studies do not give us any insight into which catalytic domains are involved in SDF-1-mediated chemotaxis. The challenge now is to determine whether different chemokine receptors couple to distinct PI 3-kinase isoforms and, furthermore, whether the context of stimulation, i.e., specific ligands and/or cell type, dictates which PI 3-kinase isoform(s) is used. With regard to this, there is evidence that different p110 isoforms regulate distinct cellular processes in response to a single agonist, while different agonists can couple to the same response via distinct p110 catalytic subunits. For example, CSF-1 stimulation of macrophages promotes a p110{alpha}-dependent mitogenic response, while chemotaxis is mediated by p110{beta} and p110{delta} PI 3-kinase catalytic subunits (71). In another study it was shown that actin reorganization in endothelial cells in response to insulin was dependent on p110{beta}, while platelet-derived growth factor-stimulated actin rearrangements were p110{alpha} dependent (72).

These data concur with an emerging model for the regulation of chemotaxis, where the detection, polarization, and movement of a cell toward a chemotactic gradient are controlled by the sequential polarization and activation of key signaling molecules at the leading edge and the posterior and lateral sides of the cell, enabling remodeling of the actin cytoskeleton and ultimately directional cell movement (27, 28, 62, 73). Although much work is required to fully elucidate the molecular mechanisms involved, it is clear that PI 3-kinases, PKB (and very likely other PH domain-containing molecules), Rho family GTPases (Rac, Rho, and Cdc42), and the inositol phosphatases, phosphatase and tensin homologue deleted on chromosome 10 (PTEN) and SH2 domain-containing inositol polyphosphate phosphatase (SHIP), play key roles in the initial detection and polarization of a cell toward a chemotactic gradient (11, 12, 13, 14, 15, 27, 28, 74, 75, 76).


    Footnotes
 
1 This work was supported by the Biotechnology and Biological Sciences Research Council (Grant C12884, to S.G.W.). Back

2 A.P.C. and Y.S. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Stephen G. Ward, Department of Pharmacy and Pharmacology, University of Bath, Claverton Down, Bath, U.K. BA2 7AY. E-mail address: s.g.ward{at}bath.ac.uk Back

4 Abbreviations used in this paper: PI 3-kinase, phosphoinositide 3-kinase; H2B, histone 2B; IGF-I, insulin-like growth factor I; KD-PI3K{gamma}, kinase-dead phosphoinositide 3-kinase-{gamma}; MAPK, mitogen-activated protein kinase; PH, pleckstrin homology; PKB, protein kinase B; PtdIns, phosphatidylinositol lipids; PtdIns(3,4)P2, phosphatidylinositol 3,4-bisphosphate; PtdIns(3,4,5)P3, phosphatidylinositol 3,4,5-trisphosphate; PI3K{gamma}, phosphoinositide 3-kinase-{gamma}; Tet-Off, tetracycline off; WT, wild type. Back

Received for publication July 20, 2002. Accepted for publication February 10, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zlotnik, A., O. Yoshie. 2000. Chemokines: a new classification system and their role in immunity. Immunity 12:121.[Medline]
  2. Baggiolini, M.. 1998. Chemokines and leukocyte traffic. Nature 392:565.[Medline]
  3. Sotsios, Y., S. G. Ward. 2002. Phosphoinositide 3-kinase: a key biochemical signal for cell migration in response to chemokines. Immunol. Rev. 17:217.
  4. Ward, S. G., J. Westwick. 1998. Chemokines: understanding their role in T-lymphocyte biology. Biochem. J. 333:457.
  5. Loetscher, P., B. Moser, M. Baggiolini. 2000. Chemokines and their receptors in lymphocyte traffic and HIV infection. Adv. Immunol. 74:127.[Medline]
  6. von Andrian, U. H., C. R. Mackay. 2000. T-cell function and migration: two sides of the same coin. N. Engl. J. Med. 343:1020.[Free Full Text]
  7. Moser, B., P. Loetscher. 2001. Lymphocyte traffic control by chemokines. Nat. Immunol. 2:123.[Medline]
  8. Muller, A., B. Homey, H. Soto, N. Ge, D. Catron, M. E. Buchanan, T. McClanahan, E. Murphy, W. Yuan, S. N. Wagner, et al 2001. Involvement of chemokine receptors in breast cancer metastasis. Nature 410:50.[Medline]
  9. Reif, K., C. D. Nobes, G. Thomas, A. Hall, D. A. Cantrell. 1996. Phosphatidylinositol 3-kinase signals activate a selective subset of Rac/Rho-dependent effector pathways. Curr. Biol. 6:1445.[Medline]
  10. Ma, A. D., A. Metjian, S. Bagrodia, S. Taylor, C. S. Abrams. 1998. Cytoskeletal reorganization by G protein-coupled receptors is dependent on phosphoinositide 3-kinase{gamma}, a Rac guanosine exchange factor, and Rac. Mol. Cell. Biol. 18:4744.[Abstract/Free Full Text]
  11. Rickert, P., O. D. Weiner, F. Wang, H. R. Bourne, G. Servant. 2000. Leukocytes navigate by compass: roles of PI3K{gamma} and its lipid products. Trends Cell. Biol. 10:466.[Medline]
  12. Servant, G., O. D. Weiner, P. Herzmark, T. Balla, J. W. Sedat, H. R. Bourne. 2000. Polarization of chemoattractant receptor signaling during neutrophil chemotaxis. Science 287:1037.[Abstract/Free Full Text]
  13. Hannigan, M., L. Zhan, Z. Li, Y. Ai, D. Wu, C. K. Huang. 2002. Neutrophils lacking phosphoinositide 3-kinase{gamma} show loss of directionality during N-formyl-Met-Leu-Phe-induced chemotaxis. Proc. Natl. Acad. Sci. USA 99:3603.[Abstract/Free Full Text]
  14. Wang, F., P. Herzmark, O. D. Weiner, S. Srinivasan, G. Servant, H. R. Bourne. 2002. Lipid products of PI(3)Ks maintain persistent cell polarity and directed motility in neutrophils. Nat. Cell. Biol. 4:513.[Medline]
  15. Weiner, O. D., P. O. Neilsen, G. D. Prestwich, M. W. Kirschner, L. C. Cantley, H. R. Bourne. 2002. A PtdIns(3)P- and Rho GTPase-mediated positive feedback loop regulates neutrophil polarity. Nat. Cell. Biol. 4:509.[Medline]
  16. Vanhaesebroeck, B., S. J. Leevers, K. Ahmadi, J. Timms, R. Katso, P. C. Driscoll, R. Woscholski, P. J. Parker, M. D. Waterfield. 2001. Synthesis and function of 3-phosphorylated inositol lipids. Annu. Rev. Biochem. 70:535.[Medline]
  17. Hemmings, B. A.. 1997. PtdIns(3,4,5)P3 gets its message across. Science 277:534.[Abstract/Free Full Text]
  18. Rameh, L. E., L. C. Cantley. 1999. The role of phosphoinositide 3-kinase lipid products in cell function. J. Biol. Chem. 274:8347.[Free Full Text]
  19. Cantley, L. C.. 2002. The phosphoinositide 3-kinase pathway. Science 296:1655.[Abstract/Free Full Text]
  20. Antonetti, D. A., P. Algenstaedt, C. R. Kahn. 1996. Insulin receptor substrate 1 binds two novel splice variants of the regulatory subunit of phosphatidylinositol 3-kinase in muscle and brain. Mol. Cell. Biol. 16:2195.[Abstract]
  21. Fruman, D. A., L. C. Cantley, C. L. Carpenter. 1996. Structural organization and alternative splicing of the murine phosphoinositide 3-kinase p85{alpha} gene. Genomics 37:113.[Medline]
  22. Inukai, K., M. Anai, E. Van Breda, T. Hosaka, H. Katagiri, M. Funaki, Y. Fukushima, T. Ogihara, Y. Yazaki, M. Kikuchi, et al 1996. A novel 55-kDa regulatory subunit for phosphatidylinositol 3-kinase structurally similar to p55PIK is generated by alternative splicing of the p85{alpha} gene. J. Biol. Chem. 271:5317.[Abstract/Free Full Text]
  23. Inukai, K., M. Funaki, T. Ogihara, H. Katagiri, A. Kanda, M. Anai, Y. Fukushima, T. Hosaka, M. Suzuki, B. C. Shin, et al 1997. p85{alpha} gene generates three isoforms of regulatory subunit for phosphatidylinositol 3-kinase (PI 3-kinase), p50{alpha}, p55{alpha}, and p85{alpha}, with different PI 3-kinase activity elevating responses to insulin. J. Biol. Chem. 272:7873.[Abstract/Free Full Text]
  24. Stephens, L., A. Smrcka, F. T. Cooke, T. R. Jackson, P. C. Sternweis, P. T. Hawkins. 1994. A novel phosphoinositide 3 kinase activity in myeloid-derived cells is activated by G protein {beta}{gamma} subunits. Cell 77:83.[Medline]
  25. Stoyanov, B., S. Volinia, T. Hanck, I. Rubio, M. Loubtchenkov, D. Malek, S. Stoyanova, B. Vanhaesebroeck, R. Dhand, B. Nurnberg, et al 1995. Cloning and characterization of a G protein-activated human phosphoinositide-3 kinase. Science 269:690.[Abstract/Free Full Text]
  26. Stephens, L. R., A. Eguinoa, H. Erdjument-Bromage, M. Lui, F. Cooke, J. Coadwell, A. S. Smrcka, M. Thelen, K. Cadwallader, P. Tempst, et al 1997. The G {beta}{gamma} sensitivity of a PI3K is dependent upon a tightly associated adaptor, p101. Cell 89:105.[Medline]
  27. Funamoto, S., R. Meili, S. Lee, L. Parry, R. A. Firtel. 2002. Spatial and temporal regulation of 3-phosphoinositides by PI 3-kinase and PTEN mediates chemotaxis. Cell 109:611.[Medline]
  28. Iijima, M., P. Devreotes. 2002. Tumor suppressor PTEN mediates sensing of chemoattractant gradients. Cell 109:599.[Medline]
  29. Krugmann, S., M. A. Cooper, D. H. Williams, P. T. Hawkins, L. R. Stephens. 2002. Mechanism of the regulation of type IB phosphoinositide 3-OH-kinase by G-protein {beta}{gamma} subunits. Biochem. J. 362:725.[Medline]
  30. Okada, T., O. Hazeki, M. Ui, T. Katada. 1996. Synergistic activation of PtdIns 3-kinase by tyrosine-phosphorylated peptide and {beta}{gamma}-subunits of GTP-binding proteins. Biochem. J. 317:475.
  31. Kurosu, H., T. Maehama, T. Okada, T. Yamamoto, S. Hoshino, Y. Fukui, M. Ui, O. Hazeki, T. Katada. 1997. Heterodimeric phosphoinositide 3-kinase consisting of p85 and p110{beta} is synergistically activated by the {beta}{gamma} subunits of G proteins and phosphotyrosyl peptide. J. Biol. Chem. 272:24252.[Abstract/Free Full Text]
  32. Turner, L., S. G. Ward, J. Westwick. 1995. RANTES-activated human T lymphocytes: a role for phosphoinositide 3-kinase. J. Immunol. 155:2437.[Abstract]
  33. Vicente-Manzanares, M., M. Rey, D. R. Jones, D. Sancho, M. Mellado, J. M. Rodriguez-Frade, M. A. del Pozo, M. Yanez-Mo, A. M. de Ana, A. C. Martinez, et al 1999. Involvement of phosphatidylinositol 3-kinase in stromal cell-derived factor-1{alpha} induced lymphocyte polarization and chemotaxis. J. Immunol. 163:4001.[Abstract/Free Full Text]
  34. Ganju, R. K., S. A. Brubaker, J. Meyer, P. Dutt, Y. Yang, S. Qin, W. Newman, J. E. Groopman. 1998. The {alpha}-chemokine, stromal cell-derived factor-1{alpha}, binds to the transmembrane G-protein-coupled CXCR-4 receptor and activates multiple signal transduction pathways. J. Biol. Chem. 273:23169.[Abstract/Free Full Text]
  35. Hirsch, E., V. L. Katanaev, C. Garlanda, O. Azzolino, L. Pirola, L. Silengo, S. Sozzani, A. Mantovani, F. Altruda, M. P. Wymann. 2000. Central role for G protein-coupled phosphoinositide 3-kinase {gamma} in inflammation. Science 287:1049.[Abstract/Free Full Text]
  36. Li, Z., H. Jiang, W. Xie, Z. Zhang, A. V. Smrcka, D. Wu. 2000. Roles of PLC-{beta}2 and -{beta}3 and PI3K{gamma} in chemoattractant-mediated signal transduction. Science 287:1046.[Abstract/Free Full Text]
  37. Sasaki, T., J. Irie-Sasaki, R. G. Jones, A. J. Oliveira-dos-Santos, W. L. Stanford, B. Bolon, A. Wakeham, A. Itie, D. Bouchard, I. Kozieradzki, et al 2000. Function of PI3K{gamma} in thymocyte development, T cell activation, and neutrophil migration. Science 287:1040.[Abstract/Free Full Text]
  38. Fruman, D. A., S. B. Snapper, C. M. Yballe, L. Davidson, J. Y. Yu, F. W. Alt, L. C. Cantley. 1999. Impaired B cell development and proliferation in the absence of PI3K p85{alpha}. Science 253:393.
  39. Suzuki, H., Y. Terauchi, M. Fujiwara, S. Aizawa, Y. Yazaki, T. Kadowaki, S. Koyasu. 1999. Xid-like immunodeficiency in mice with disruption of the p85{alpha} subunit of phosphoinositide 3-kinase. Science 283:390.[Abstract/Free Full Text]
  40. Ueki, K., C. M. Yballe, S. M. Brachmann, D. Vicent, J. M. Watt, C. R. Kahn, L. C. Cantley. 2002. Increased insulin sensitivity in mice lacking p85{beta} subunit of phosphoinositide 3-kinase. Proc. Natl. Acad. Sci. USA 99:419.[Abstract/Free Full Text]
  41. Carpenter, C. L., L. C. Cantley. 1996. Phosphoinositide 3-kinase and the regulation of cell growth. Biochim. Biophys. Acta 1288:M11.[Medline]
  42. Hawkins, P. T., H. Welch, A. McGregor, A. Eguinoa, S. Gobert, S. Krugmann, K. Anderson, D. Stokoe, L. Stephens. 1997. Signalling via phosphoinositide 3-OH kinases. Biochem. Soc. Trans. 25:1147.[Medline]
  43. Takeda, H., T. Matozaki, T. Takada, T. Noguchi, T. Yamao, M. Tsuda, F. Ochi, K. Fukunaga, K. Inagaki, M. Kasuga. 1999. PI 3-kinase {gamma} and protein kinase C-{zeta} mediate RAS-independent activation of MAP kinase by a Gi protein-coupled receptor. EMBO J. 18:386.[Medline]
  44. Reif, K., B. M. Burgering, D. A. Cantrell. 1997. Phosphatidylinositol 3-kinase links the interleukin-2 receptor to protein kinase B and p70 S6 kinase. J. Biol. Chem. 272:14426.[Abstract/Free Full Text]
  45. Parry, R. V., K. Reif, G. Smith, D. M. Sansom, B. A. Hemmings, S. G. Ward. 1997. Ligation of the T cell co-stimulatory receptor CD28 activates the serine-threonine protein kinase protein kinase B. Eur. J. Immunol. 27:2495.[Medline]
  46. Vanhaesebroeck, B., D. R. Alessi. 2000. The P13K-PDK1 connection: more than just a road to PKB. Biochem. J. 346:561.-576.
  47. Sotsios, Y., G. C. Whittaker, J. Westwick, S. G. Ward. 1999. The CXC chemokine stromal cell-derived factor activates a Gi-coupled phosphoinositide 3-kinase in T lymphocytes. J. Immunol. 163:5954.[Abstract/Free Full Text]
  48. Tilton, B., L. Ho, E. Oberlin, P. Loetscher, F. Baleux, I. Clark-Lewis, M. Thelen. 2000. Signal transduction by CXC chemokine receptor 4: stromal cell-derived factor 1 stimulates prolonged protein kinase B and extracellular signal-regulated kinase 2 activation in T lymphocytes. J. Exp. Med. 192:313.[Abstract/Free Full Text]
  49. Weber, K. S., G. Ostermann, A. Zernecke, A. Schroder, L. B. Klickstein, C. Weber. 2001. Dual role of H-Ras in regulation of lymphocyte function antigen-1 activity by stromal cell-derived factor-1{alpha}: implications for leukocyte transmigration. Mol. Biol. Cell 12:3074.[Abstract/Free Full Text]
  50. Freeburn, R. W., K. L. Wright, S. J. Burgess, E Astoul, D. A. Cantrell, S. G. Ward. 2002. Evidence that SHIP-1 contributes to phosphatidylinositol 3,4,5-trisphosphate metabolism in T lymphocytes and can regulate novel phosphoinositide 3-kinase effectors. J. Immunol. 169:5441.[Abstract/Free Full Text]
  51. Astoul, E., C Edmunds, D. A. Cantrell, S. G. Ward. 2001. PI3K and T cell activation: limitations of T leukemic cell lines as signalling models. Trends Immunol. 22:490.[Medline]
  52. Suzuki, Y., M. Rahman, H. Mitsuya. 2001. Diverse transcriptional response of CD4+ T cells to stromal cell-derived factor (SDF)-1: cell survival promotion and priming effects of SDF-1 on CD4+ T cells. J. Immunol. 167:3064.[Abstract/Free Full Text]
  53. Sullivan, S. K., D. A. McGrath, F. Liao, S. A. Boehme, J. M. Farber, K. B. Bacon. 1999. MIP-3{alpha} induces human eosinophil migration and activation of the mitogen-activated protein kinases (p42/p44 MAPK). J. Leukocyte Biol. 66:674.[Abstract]
  54. Boehme, S. A., S. K. Sullivan, P. D. Crowe, M. Santos, P. J. Conlon, P. Sriramarao, K. B. Bacon. 1999. Activation of mitogen-activated protein kinase regulates eotaxin-induced eosinophil migration. J. Immunol. 163:1611.[Abstract/Free Full Text]
  55. Knall, C., G. S. Worthen, G. L. Johnson. 1997. Interleukin 8-stimulated phosphatidylinositol-3-kinase activity regulates the migration of human neutrophils independent of extracellular signal-regulated kinase and p38 mitogen-activated protein kinases. Proc. Natl. Acad. Sci. USA 94:3052.[Abstract/Free Full Text]
  56. Gossen, M., H. Bujard. 1992. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89:5547.[Abstract/Free Full Text]
  57. Turner, S. J., J. Domin, M. D. Waterfield, S. G. Ward, J. Westwick. 1998. The CC chemokine monocyte chemotactic peptide-1 activates both the class I p85/p110 phosphatidylinositol 3-kinase and the class II PI3K-C2{alpha}. J. Biol. Chem. 273:25987.[Abstract/Free Full Text]
  58. Rossi, D., A. Zlotnik. 2000. The biology of chemokines and their receptors. Annu. Rev. Immunol. 18:217.[Medline]
  59. Ward, S. G., K. Bacon, J. Westwick. 1998. Chemokines and T lymphocytes: more than an attraction. Immunity 9:1.[Medline]
  60. Stephens, L., A. Eguinoa, S. Corey, T. Jackson, P. T. Hawkins. 1993. Receptor stimulated accumulation of phosphatidylinositol (3,4,5)-trisphosphate by G-protein mediated pathways in human myeloid derived cells. EMBO J. 12:2265.[Medline]
  61. Ptasznik, A., A. Traynor-Kaplan, G. M. Bokoch. 1995. G protein-coupled chemoattractant receptors regulate Lyn tyrosine kinase: Shc adapter protein signaling complexes. J. Biol. Chem. 270:19969.[Abstract/Free Full Text]
  62. Stephens, L., C. Ellson, P. Hawkins. 2002. Roles of PI3Ks in leukocyte chemotaxis and phagocytosis. Curr. Opin. Cell Biol. 14:203.[Medline]
  63. Ma, Y. C., J. Huang, S. Ali, W. Lowry, X. Y. Huang. 2000. Src tyrosine kinase is a novel direct effector of G proteins. Cell 102:635.[Medline]
  64. Reif, K., I. Gout, M. D. Waterfield, D. A. Cantrell. 1993. Divergent regulation of phosphatidylinositol 3-kinase p85{alpha} and p85{beta} isoforms upon T cell activation. J. Biol. Chem. 268:10780.[Abstract/Free Full Text]
  65. Baltensperger, K., L. M. Kozma, S. R. Jaspers, M. P. Czech. 1994. Regulation by insulin of phosphatidylinositol 3'-kinase bound to {alpha}- and {beta}-isoforms of p85 regulatory subunit. J. Biol. Chem. 269:28937.[Abstract/Free Full Text]
  66. Shepherd, P. R., B. T. Nave, J. Rincon, L. A. Nolte, A. P. Bevan, K. Siddle, J. R. Zierath, H. Wallberg-Henriksson. 1997. Differential regulation of phosphoinositide 3-kinase adapter subunit variants by insulin in human skeletal muscle. J. Biol. Chem. 272:19000.[Abstract/Free Full Text]
  67. Meili, R., C. Ellsworth, S. Lee, T. B. Reddy, H. Ma, R. A. Firtel. 1999. Chemoattractant-mediated transient activation and membrane localization of Akt/PKB is required for efficient chemotaxis to cAMP in Dictyostelium. EMBO J. 18:2092.[Medline]
  68. Knall, C., S. Young, J. A. Nick, A. M. Buhl, G. S. Worthen, G. L. Johnson. 1996. Interleukin-8 regulation of the Ras/Raf/mitogen-activated protein kinase pathway in human neutrophils. J. Biol. Chem. 271:2832.[Abstract/Free Full Text]
  69. Shyamala, V., H. Khoja. 1998. Interleukin-8 receptors R1 and R2 activate mitogen-activated protein kinases and induce c-fos, independent of Ras and Raf-1 in Chinese hamster ovary cells. Biochemistry 37:15918.[Medline]
  70. Arcaro, A., M. J. Zvelebil, C. Wallasch, A. Ullrich, M. D. Waterfield, J. Domin. 2000. Class II phosphoinositide 3-kinases are downstream targets of activated polypeptide growth factor receptors. Mol. Cell. Biol. 20:3817.[Abstract/Free Full Text]
  71. Vanhaesebroeck, B., G. E. Jones, W. E. Allen, D. Zicha, R. Hooshmand-Rad, C. Sawyer, C. Wells, M. D. Waterfield, A. J. Ridley. 1999. Distinct PI3Ks mediate mitogenic signalling and cell migration in macrophages. Nat. Cell. Biol. 1:69.[Medline]
  72. Hooshmand-Rad, R., L. Hajkova, P. Klint, R. Karlsson, B. Vanhaesebroeck, L. Claesson-Welsh, C. H. Heldin. 2000. The PI 3-kinase isoforms p110{alpha} and p110{beta} have differential roles in PDGF- and insulin-mediated signaling. J. Cell Sci. 113:207.[Abstract]
  73. Weiner, O. D.. 2002. Regulation of cell polarity during eukaryotic chemotaxis: the chemotactic compass. Curr. Opin. Cell Biol. 14:196.[Medline]
  74. Helgason, C. D., J. E. Damen, P. Rosten, R. Grewal, P. Sorensen, S. M. Chappel, A. Borowski, F. Jirik, G. Krystal, R. K. Humphries. 1998. Targeted disruption of SHIP leads to hemopoietic perturbations, lung pathology, and a shortened life span. Genes Dev. 12:1610.[Abstract/Free Full Text]
  75. Liliental, J., S. Y. Moon, R. Lesche, R. Mamillapalli, D. Li, Y. Zheng, H. Sun, H. Wu. 2000. Genetic deletion of the PTEN tumor suppressor gene promotes cell motility by activation of Rac1 and Cdc42 GTPases. Curr. Biol. 10:401.[Medline]
  76. Gardiner, E. M., K. N. Pestonjamasp, B. P. Bohl, C Chamberlain, K. M. Hahn, G. M. Bokoch. 2002. Spatial and temporal analysis of Rac activation during live neutrophil chemotaxis. Curr. Biol. 12:2029.[Medline]



This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
S. Chen, F. Lin, M. E. Shin, F. Wang, L. Shen, and H. E. Hamm
RACK1 Regulates Directional Cell Migration by Acting on G{beta}{gamma} at the Interface with Its Effectors PLC{beta} and PI3K{gamma}
Mol. Biol. Cell, September 1, 2008; 19(9): 3909 - 3922.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. T. Murooka, R. Rahbar, L. C. Platanias, and E. N. Fish
CCL5-mediated T-cell chemotaxis involves the initiation of mRNA translation through mTOR/4E-BP1
Blood, May 15, 2008; 111(10): 4892 - 4901.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Pinho, R. de Castro Russo, F. A. Amaral, L. P. de Sousa, M. M. Barsante, D. G. de Souza, J. C. Alves-Filho, D. C. Cara, J. S. Hayflick, C. Rommel, et al.
Tissue- and Stimulus-Dependent Role of Phosphatidylinositol 3-Kinase Isoforms for Neutrophil Recruitment Induced by Chemoattractants In Vivo
J. Immunol., December 1, 2007; 179(11): 7891 - 7898.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. P. Matheu, J. A. Deane, I. Parker, D. A. Fruman, and M. D. Cahalan
Class IA Phosphoinositide 3-Kinase Modulates Basal Lymphocyte Motility in the Lymph Node
J. Immunol., August 15, 2007; 179(4): 2261 - 2269.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Tan, D. Martin, and J. S. Gutkind
The G{alpha}13-Rho Signaling Axis Is Required for SDF-1-induced Migration through CXCR4
J. Biol. Chem., December 22, 2006; 281(51): 39542 - 39549.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Z. Zeng, I. J. Samudio, M. Munsell, J. An, Z. Huang, E. Estey, M. Andreeff, and M. Konopleva
Inhibition of CXCR4 with the novel RCP168 peptide overcomes stroma-mediated chemoresistance in chronic and acute leukemias
Mol. Cancer Ther., December 1, 2006; 5(12): 3113 - 3121.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. G. Cronshaw, A. Kouroumalis, R. Parry, A. Webb, Z. Brown, and S. G. Ward
Evidence that phospholipase C-dependent, calcium-independent mechanisms are required for directional migration of T lymphocytes in response to the CCR4 ligands CCL17 and CCL22
J. Leukoc. Biol., June 1, 2006; 79(6): 1369 - 1380.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Akekawatchai, J. D. Holland, M. Kochetkova, J. C. Wallace, and S. R. McColl
Transactivation of CXCR4 by the Insulin-like Growth Factor-1 Receptor (IGF-1R) in Human MDA-MB-231 Breast Cancer Epithelial Cells
J. Biol. Chem., December 2, 2005; 280(48): 39701 - 39708.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Kouroumalis, R. J. Nibbs, H. Aptel, K. L. Wright, G. Kolios, and S. G. Ward
The Chemokines CXCL9, CXCL10, and CXCL11 Differentially Stimulate G{alpha}i-Independent Signaling and Actin Responses in Human Intestinal Myofibroblasts
J. Immunol., October 15, 2005; 175(8): 5403 - 5411.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Gao, R. L. Wange, N. Zhang, J. J. Oppenheim, and O. M. Z. Howard
Negative regulation of CXCR4-mediated chemotaxis by the lipid phosphatase activity of tumor suppressor PTEN
Blood, October 15, 2005; 106(8): 2619 - 2626.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Fukuda, H. E. Broxmeyer, and L. M. Pelus
Flt3 ligand and the Flt3 receptor regulate hematopoietic cell migration by modulating the SDF-1{alpha}(CXCL12)/CXCR4 axis
Blood, April 15, 2005; 105(8): 3117 - 3126.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. Kryczek, A. Lange, P. Mottram, X. Alvarez, P. Cheng, M. Hogan, L. Moons, S. Wei, L. Zou, V. Machelon, et al.
CXCL12 and Vascular Endothelial Growth Factor Synergistically Induce Neoangiogenesis in Human Ovarian Cancers
Cancer Res., January 15, 2005; 65(2): 465 - 472.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Reif, K. Okkenhaug, T. Sasaki, J. M. Penninger, B. Vanhaesebroeck, and J. G. Cyster
Cutting Edge: Differential Roles for Phosphoinositide 3-Kinases, p110{gamma} and p110{delta}, in Lymphocyte Chemotaxis and Homing
J. Immunol., August 15, 2004; 173(4): 2236 - 2240.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. M. Fuhler, K. A. Cadwallader, G. J. Knol, E. R. Chilvers, A. L. Drayer, and E. Vellenga
Disturbed granulocyte macrophage-colony stimulating factor priming of phosphatidylinositol 3,4,5-trisphosphate accumulation and Rac activation in fMLP-stimulated neutrophils from patients with myelodysplasia
J. Leukoc. Biol., July 1, 2004; 76(1): 254 - 262.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. G. Cronshaw, C. Owen, Z. Brown, and S. G. Ward
Activation of Phosphoinositide 3-Kinases by the CCR4 Ligand Macrophage-Derived Chemokine Is a Dispensable Signal for T Lymphocyte Chemotaxis
J. Immunol., June 15, 2004; 172(12): 7761 - 7770.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
B.-C. Lee, T.-H. Lee, S. Avraham, and H. K. Avraham
Involvement of the Chemokine Receptor CXCR4 and Its Ligand Stromal Cell-Derived Factor 1{alpha} in Breast Cancer Cell Migration Through Human Brain Microvascular Endothelial Cells
Mol. Cancer Res., June 1, 2004; 2(6): 327 - 338.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
C. Gomez-Mouton, R. A. Lacalle, E. Mira, S. Jimenez-Baranda, D. F. Barber, A. C. Carrera, C. Martinez-A., and S. Manes
Dynamic redistribution of raft domains as an organizing platform for signaling during cell chemotaxis
J. Cell Biol., March 1, 2004; 164(5): 759 - 768.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. J. Brown, R. Nijhara, J. A. Hallam, M. Gignac, K. M. Yamada, S. L. Erlandsen, J. Delon, M. Kruhlak, and S. Shaw
Chemokine stimulation of human peripheral blood T lymphocytes induces rapid dephosphorylation of ERM proteins, which facilitates loss of microvilli and polarization
Blood, December 1, 2003; 102(12): 3890 - 3899.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Curnock, A. P.
Right arrow Articles by Ward, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Curnock, A. P.
Right arrow Articles by Ward, S. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS