The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brown, W. C.
Right arrow Articles by Palmer, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brown, W. C.
Right arrow Articles by Palmer, G. H.
The Journal of Immunology, 2003, 170: 3790-3798.
Copyright © 2003 by The American Association of Immunologists

The Hypervariable Region of Anaplasma marginale Major Surface Protein 2 (MSP2) Contains Multiple Immunodominant CD4+ T Lymphocyte Epitopes That Elicit Variant-Specific Proliferative and IFN-{gamma} Responses in MSP2 Vaccinates 1

Wendy C. Brown2, Kelly A. Brayton, Cathryn M. Styer and Guy H. Palmer

Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, WA 99164


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Major surface protein 2 (MSP2) is an immunodominant outer membrane protein of Anaplasma marginale and Anaplasma phagocytophilum pathogens that cause bovine anaplasmosis and human granulocytic ehrlichiosis, respectively. MSP2 has a central hypervariable region (HVR) flanked by highly conserved amino and carboxyl termini. During A. marginale infection, dynamic and extensive amino acid sequence variation in MSP2 occurs through recombination of msp2 pseudogenes into the msp2 expression site, followed by sequential segmental gene conversions to generate additional variants. We hypothesized that MSP2 variation leads to significant changes in Th cell recognition of epitopes in the HVR. T cell epitopes were mapped using T cells from native MSP2-immunized cattle and overlapping peptides spanning the most abundant of five different MSP2 HVRs in the immunogen. Several epitopes elicited potent effector/memory Th cell proliferative and IFN-{gamma} responses, including those in three discreet blocks of sequence that undergo segmental gene conversion. Th cell clones specific for an epitope in the block 1 region of the predominant MSP2 variant type failed to respond to naturally occurring variants. However, some of these variants were recognized by oligoclonal T cell lines from MSP2 vaccinates, indicating that the variant sequences contain immunogenic CD4+ T cell epitopes. In competition/antagonism assays, the nonstimulatory variants were not inhibitory for CD4+ T cells specific for the agonist peptide. Dynamic amino acid sequence variation in MSP2 results in escape from recognition by some effector/memory MSP2-specific Th cells. Antigenic variation in MSP2 Th cell and B cell epitopes may contribute to immune evasion that allows long-term persistence of A. marginale in the mammalian reservoir.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Antigenic variation in surface-exposed proteins of vector-borne protozoal and bacterial pathogens is a common strategy used to evade the immune response and to enable organism persistence (1), providing a continual reservoir for transmission. Anaplasma marginale, the type species for the genus, is a tick-transmitted intraerythrocytic rickettsial pathogen of cattle that causes acute anemia, which if resolved results in persistent infection. A. marginale is closely related to Anaplasma phagocytophilum, the agent of the recent emergent human disease human granulocytic ehrlichiosis (2). In both pathogens, antigenic variation in the major surface protein 2 (MSP2) 3 is generated (3, 4, 5, 6, 7, 8, 9, 10, 11), and during persistent infection with A. marginale, variation in MSP2 has been shown to result in the emergence of variants that escape a primary Ab response (6). Alignment of multiple MSP2 variants from A. marginale or A. phagocytophilum reveals highly conserved N- and C-terminal regions that flank a central hypervariable region (HVR), characterized by substitutions, insertions, and deletions (4, 5, 6, 7, 8, 9). Furthermore, comparison of the predicted MSP2 amino acid sequences in A. marginale and A. phagocytophilum has revealed 96% and 87% similarity in the N and C termini (6), consistent with these proteins being structural, and likely functional, orthologues in the two species. Sequence variation in the MSP2 HVR is observed among infected individuals and at a single or multiple time points after infection of an individual (5, 6, 7, 8, 9, 10, 11).

MSP2 is encoded by a polymorphic gene family (3, 7); however, the mechanisms of MSP2 variation have only recently been delineated. A. marginale MSP2 expression is under the control of a single operon consisting of a promoter and four open reading frames, including msp2 (12). The remaining copies of msp2 in the genome consist of pseudogenes truncated at the 5' and 3' ends (13). Antigenic variation is achieved by recombination of whole pseudogenes into the single msp2 operon-linked expression site, followed by a second level of variation in which at least four small segments of pseudogenes sequentially recombine into the expression site by gene conversion (13, 14). The discreet regions undergoing small segmental changes were designated block 1–3, with the block 1 region apparently resulting from two separate conversion events (14). Segmental gene conversion provides the mechanism for Anaplasma to generate remarkable diversity, as the A. marginale genome contains a minimum of nine pseudogenes, which when combined with the four short segmental changes in the HVR could yield up to 94 (6,561) different combinations of pseudogenes being created in the msp2 expression site (14). This dynamic and extensive antigenic variation in MSP2 and other outer membrane proteins (15) is hypothesized to result in life-long persistence in the mammalian host (16).

Persistent A. marginale infection is characterized by the sequential emergence every 6–8 wk of several MSP2 variants that replicate to 106–107 organisms/ml blood levels that are 102- to 103-fold lower than those found during acute infection, before being controlled by the immune response. Control of the emergent variants is concomitant with generation of a primary B cell response against novel epitopes in the surface-exposed HVRs (6). Whereas a memory CD4+ T cell response against conserved epitopes in the N and C regions may provide both B cell help and effect non-Ab mediated immunity that helps limit the magnitude of persistent rickettsemic cycles (17), antigenic variation in Th cell epitopes in the MSP2 HVR may also contribute to long-term persistence. The presence of T cell epitopes in the MSP2 HVR was suggested by the finding that a panel of Th cell clones from a native MSP2 vaccinate did not respond to any of the peptides spanning conserved N and C termini, even though oligoclonal T cell lines from this and other immune calves did recognize multiple epitopes in the conserved regions (17). Variation in Th cell epitopes in the MSP2 HVR could result in diminished Th cell recognition or induction of T cell anergy (18). Therefore, the current study was designed to test the hypotheses that the MSP2 HVR contains Th cell epitopes, and that sequence variation in these epitopes alters the recognition or response of variant specific Th cells. We report that antigenic variation in the block 1 and block 2 regions of A. marginale MSP2 HVR, shown to undergo segmental gene conversion, eliminates or significantly reduces the response by variant-specific memory/effector Th cells. Loss of Th cell and Ab recognition of HVR epitopes, in concert with sustained recognition of conserved epitopes in the N and C regions, could contribute to both the appearance of new antigenic variants and to the control of rickettsemia levels during persistent infection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A. marginale homogenate, MSP2, and MSP2-derived peptides

The Florida (FL) strain of A. marginale was used for all experiments. Anaplasma organisms were isolated from thawed, infected bovine erythrocytes by sonication and differential ultracentrifugation as previously described (19). To prepare Ag for in vitro assays, either homogenate or membranes prepared from the homogenate by sucrose density gradient centrifugation were used (17, 20). MSP2 was affinity purified from A. marginale FL strain organisms and stored at -80°C as described (21). Seventeen MSP2 cDNA clones were isolated from the A. marginale FL blood stabilate from which MSP2 was purified for use in these studies as described (6). Briefly, total RNA was extracted from cyropreserved A. marginale used to prepare MSP2 for immunization. The 5' and 3' primers for amplifying full-length msp2 cDNA clones were ATGAGTGCTGTAAGTAATAG and CTAGAAGGAAACCTAACAC, respectively. PCR products were ligated into pCR2.1 by using a TA cloning kit (Invitrogen, Carlsbad, CA). Competent Escherichia coli XL-1 Blue cells were transformed with the ligated vector and plated with 5 mM isopropyl-1-{beta}-D-thiogalactopyranoside and 5-bromo-4-chloro-3-indolyl-{beta}-D-galactopyranoside for blue/white screening. The presence of msp2 inserts in plasmids from transformed colonies was confirmed by restriction digestion or PCR. Plasmid DNA was extracted from each clone and sequenced in both directions. Five variant MSP2 sequences were identified, designated variants A, B, C, D, and E, which correspond to clones 1-7, 2-h, 4-s, 1-11, and 1-4, respectively, as reported to GenBank (accession numbers AY138954–138958). The most frequently occurring variant (variant A) was selected for peptide synthesis. Peptides of 24–30 aa in length, overlapping by 14–20 aa and spanning the central HVR of MSP2 variant A, were synthesized by G. Munske (Laboratory for Biotechnology and Bioanalysis I, Washington State University, Pullman, WA). Peptides were dissolved in PBS or DMSO and PBS and stored at -20°C. GenBank accession numbers for genomic DNA, representing the South Idaho strain MSP2 pseudogene A3 recombined into the expression site and block 1 variant of this gene, are AF305503 and AF402275, respectively (13).

Cattle used in this study

Holstein steers 59, 60, and 61 were immunized six times with MSP2 using IL-12 and alum as an adjuvant (17, 21). The bovine lymphocyte Ag (BoLA) class II haplotypes were previously determined (17). The BoLA-DQ haplotypes were inferred from BoLA-A class I and DRB3 typing on the basis of haplotypes defined in the Seventh International BoLA Workshop (BoLA nomenclature web site: http://www2.ri.bbsrc.ac.uk/bola/). The class II haplotypes are as follows, for steer 59: DRB3 22/7, DQA 9B/2, DQB 9B/2; for steer 60: DRB3 22/23, DQA 9B/7D, DQB 9B/7A; for steer 61: DRB3 8/8, DQA 12/12, DQB 12/12; and for cow G4: DRB3 18/23 used as a control for APC. For cow G4 (Charolais), the DQ alleles were not inferred because of insufficient information about this breed.

A. marginale-specific T lymphocyte lines and clones

Short-term T lymphocyte lines were established from PBMC of A. marginale MSP2-immunized cattle 59, 60, and 61, from 2 to 3.5 years following the last immunization with MSP2. In all experiments, cell lines were propagated by stimulation with the same batch of A. marginale organisms used to purify the MSP2 immunogen and used to identify the variant msp2 cDNA clones. Similarly, this "homologous" Ag was used for in vitro assays. Briefly, 4 x 106 PBMC were cultured per well in 24-well plates (Costar, Cambridge, MA) in a volume of 1.5 ml complete RPMI 1640 medium with 1–5 µg/ml A. marginale homogenate. After 7 days, and weekly thereafter, cells were subcultured to a density of 5 x 105 cells/well and cultured with 2 x 106 irradiated (3000 rad) autologous PBMC as a source of APC with or without Ag, which was often given on alternate weeks to lower background proliferation. T lymphocyte lines were maintained for up to 3 wk, and cells were assayed for Ag-dependent proliferation 7 days following the last stimulation. In most experiments, {gamma}{delta} and CD8+ T lymphocytes were depleted by incubating the cell lines for 30 min at 4°C with {gamma}{delta} TCR-specific mAb CACT 61A and CD8-specific mAb CACT 80C diluted to 15 µg/ml in PBS, washed once and incubated for 30 min at 37°C with rabbit complement (Sigma-Aldrich, St. Louis, MO) diluted 1/8 in PBS, and washed three times. CD4+ MSP2-specific T lymphocyte clones from animal 60 were previously described (17).

Cell surface phenotypic analysis

Differentiation markers on T lymphocyte lines and clones were analyzed by FACS. The mAb used were specific for bovine CD2 (mAb MUC2A), CD3 (mAb MM1A), CD4 (mAb CACT 138A), CD8 (mAbs CACT 80C and BAT 82B), and the {delta}-chain of the {gamma}{delta} TCR (mAb CACT 61A) purchased from the Washington State University Monoclonal Antibody Center (Pullman, WA).

Lymphocyte proliferation assays

Proliferation assays were conducted in replicate wells of round-bottom 96-well plates (Costar) for 3–4 days when using short-term T lymphocyte lines or T lymphocyte clones, as described (17). T lymphocytes (3 x 104 cells) were cultured in duplicate or triplicate wells in a total volume of 100 µl of complete medium containing 2 x 105 APC and Ag. Ags consisted of 0.2–25.0 µg/ml homogenate prepared from A. marginale native MSP2 protein, and 0.1–10 µg/ml overlapping 24–30 mer peptides spanning the HVR of MSP2. Uninfected RBC membranes were used as a negative control Ag, and peptides in the N- and C-terminal conserved regions of MSP2, previously identified as immunostimulatory for these cattle (17), were used as positive control peptides. Cells were radiolabeled for the last 18 h of culture with 0.25 µCi of [3H]thymidine, harvested using an automated cell harvester, and counted with a liquid scintillation counter. In one experiment with T lymphocyte clones, MSP2 peptides were presented with autologous APC or APC mismatched at one or both DRB3 alleles. In addition, mAb to bovine MHC class II molecules (22, 23) DR{alpha} (mAb TH14B) or DQ{alpha} (mAb TH22A) were used to block presentation of MSP2 peptide. These IgG2a mAb were obtained from the Washington State University Monoclonal Antibody Center and purified by affinity to protein G using the Equilibrate Hi Trap protein G column (Pharmacia Biotech, Piscataway, NJ) according to the manufacturer’s protocol. Before adding T lymphocytes and Ag, APC were incubated for 1 h with 20 µg/ml anti-class II mAb. Results are presented as the mean cpm of replicate cultures ±1 SD, or as the stimulation index, which represents the mean cpm of replicate cultures of cells plus Ag/the mean cpm of replicate cultures of cells plus medium or uninfected RBC. Proliferation was considered significant if the stimulation index was >3.0 and the mean cpm was >1000 (24). The Student t test was used to determine statistically significant differences in proliferation induced in the presence of anti-class II mAb.

Peptide competition/antagonist assays

Some experiments were performed to determine whether nonstimulatory MSP2 peptides representing variants of agonist peptides had any competitive or antagonistic effect on the response of T cell clones and lines stimulated with the agonist peptide. Proliferation assays were performed with T cell clones or short-term cell lines, APC, a suboptimal but stimulatory amount of agonist peptide (0.4–5 µg/ml peptides HV2-3 and HV5), and increasing amounts (0.2–25 µg/ml) of nonstimulatory peptide. The stimulatory and nonstimulatory peptides were added to APC and T lymphocytes simultaneously, or APC were preincubated with nonstimulatory peptides for 2 h before T lymphocytes were added.

Detection of IFN-{gamma} in supernatants of T lymphocyte lines

Just before the addition of [3H]thymidine to proliferation assay wells, supernatants (50 µl/well) were harvested from duplicate or triplicate wells of T lymphocytes stimulated with 10 µg/ml A. marginale Ag or MSP2-derived peptides. Pooled supernatants were stored at -20°C. The bovine IFN-{gamma} assay was performed using an ELISA kit (BOVIGAM; CSL, Parkville, Victoria, Australia) according to the manufacturer’s protocol. The IFN-{gamma} activity in culture supernatants diluted 1/4–1/2000 was determined by comparison with a standard curve obtained with a supernatant from a Mycobacterium bovis purified protein derivative-specific Th lymphocyte clone that contained 440 U of IFN-{gamma} per ml (previously determined by the neutralization of vesicular stomatitis virus). In our assay, 0.6 U corresponds to 1 ng of IFN-{gamma} (25). The results are presented as units per milliliter IFN-{gamma}.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of msp2 variants in the immunogen

To determine the variant types in the MSP2 preparation used for cattle immunization, an aliquot of infected blood used to purify the native MSP2 was analyzed by RT-PCR, as previously described (6). Of 17 msp2 cDNA clones sequenced, 5 variants with unique HVRs were identified (Fig. 1). The relative frequency of variants differed in that variant A was represented 10 times, variants B, D, and E were represented twice, and variant C was represented once. Thus, the dominant MSP2 variant, A, was selected for Th cell epitope mapping studies, and 24 to 30-aa peptides overlapping by 14–20 aa, representing the HVR of this variant, were synthesized. These peptides, together with previously synthesized peptides P9 and P10, representing the N- and C-conserved region that overlaps the ends of the HVR, and additional immunostimulatory C-region peptides 12 and 13 are shown in Table I.



View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 1. Alignment of the HVR of the five MSP2 variants in the MSP2 immunogen. The black background indicates regions of sequence identity, the gray background indicates regions of sequence similarity, and the white background indicates nonconserved amino acids. The HVR extends from aa 190 to 272 in the MSP2 A variant. The block 1, 2, and 3 regions are indicated by arrows.

 

View this table:
[in this window]
[in a new window]
 
Table I. Proliferative responses in MSP2-immunized cattle to peptides spanning the HVR of MSP2 variant A (HV2–HV12)

 
Memory T lymphocyte responses to epitopes in the MSP2 HVR

Peptides spanning the HVR of MSP2 variant A were tested in proliferation assays with short-term T cell lines for elicitation of memory cell responses. The results, summarized in Table I, are representative of at least six assays performed for cell lines cultured for 1–3 wk. Similar results were obtained using either undepleted or {gamma}{delta} T cell- and CD8+ T cell-depleted cell lines, demonstrating that the response was mediated by CD4+ T cells (data not shown). Peptides HV3–HV6 stimulated T lymphocytes from all calves, and, additionally, peptides HV2 and HV7 stimulated T cells from calves 59 and 60. Peptides HV11 and HV12 that overlap in sequence with conserved region peptide 10 also stimulated proliferation of T cells from animal 61. One epitope shared by peptides 10 and HV12, VEGAEVIEVRAI, was mapped using cloned T cells from animal 61 (W. C. Brown, unpublished observations). As a control, MSP2 peptides were tested against T cell lines from three MSP1-immunzized cattle (26), and none of the peptides stimulated proliferation (data not shown).

Comparative proliferative responses of short-term oligoclonal CD4+ T lymphocyte lines to the HVR peptides and peptides previously shown to elicit the strongest proliferative responses in the conserved N and C regions of MSP2 showed that the HVR peptides elicited proliferative responses that were comparable to or greater than those elicited by conserved region peptides. For example, conserved region peptide 12, which elicits strong recall responses by all three immune calves (17), and HVR peptides HV2–HV6 stimulated similar levels of T cell proliferation (Figs. 2 and 3). Furthermore, the stimulatory HVR peptides induced levels of IFN-{gamma} comparable to those induced by stimulatory conserved region peptides (Fig. 3), and as observed previously using conserved region peptides (17), there was a good correlation between proliferative responses and IFN-{gamma} production (r2 = 0.7–0.9 for the three cell lines in Fig. 3).



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 2. Proliferative responses of short-term T lymphocyte lines to peptides spanning the HVR of MSP2 variant A. T lymphocyte lines were established from PBMC from cattle >2 years after immunization with MSP2. T lymphocytes were cultured for 1 wk with the homologous A. marginale organisms used to prepare the immunogen (17 ) and assayed (A, line 59) or rested for an additional week (B and C, lines 60 and 61). T lymphocytes were tested for proliferation against 0.4–10 µg/ml Ag prepared from A. marginale (A.m.) or the indicated peptides.

 


View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 3. Comparison of proliferation and IFN-{gamma} production by MSP2-specific T lymphocyte lines cultured with immunostimulatory conserved region and HVR peptides. T lymphocyte lines were established from PBMC depleted of {gamma}{delta} T cells, stimulated with A. marginale, and tested for proliferation and IFN-{gamma} production after 2 (A and B, lines 59 and 60) or 3 wk (C, line 61). The results are presented as the mean cpm + 1 SD of lymphocytes cultured with 10 µg/ml Ag after subtracting the mean cpm of cells cultured with medium. Mean background proliferative responses were 18,174 cpm (animal 59), 2,838 cpm (animal 60), and 505 cpm (animal 61). IFN-{gamma} production was measured by ELISA in pooled supernatants of the same duplicate wells harvested from the proliferation assay plates before the cells were radiolabelled. The background IFN-{gamma} responses of cells cultured with medium alone were <5 U/ml and were subtracted.

 
Recall responses of T cell lines and clones specific for the MSP2 HVR block 1 region to variants present in the immunogen

T cell lines from calves 59 and 60 responded strongly to HVR peptides HV2 and HV3, which overlap by 20 aa. The overlapping peptide HV2-3(A), corresponding to the predominant variant type A, therefore was tested to verify that this constituted a T cell epitope for these cattle. When short-term T cell lines were assayed, similar levels of proliferation were induced by peptides HV2, HV3, and HV2-3 (data not shown), demonstrating that this latter sequence is in fact a T cell epitope. We then determined whether any of the additional MSP2 variants B–E were stimulatory for T cell lines by synthesizing and testing peptides representing these corresponding variant sequences. Although HV2-3 variant A (peptide HV2-3(A)) stimulated stronger proliferation evidenced by a higher stimulation index and stimulation by lower peptide concentrations, and stimulated greater production of IFN-{gamma}, MSP2 variants represented by peptides HV2-3(B/C) and HV2-3(E) also elicited significant proliferation and IFN-{gamma} production when used at the highest concentration of peptide (10 µg/ml) tested (Table II). In contrast, peptide HV2-3(D) never stimulated a response by cell lines at any concentration tested. We also tested a panel of four MSP2-specific CD4+ T cell clones from animal 60 that did not recognize any of the conserved region peptides (17) against all HVR peptides representing MSP2 variant A. Interestingly, all clones responded to peptides HV2, HV3, and HV2-3 (Table II and data not shown). However, unlike the uncloned short-term cell lines from the responder cattle, the clones recognized only the MSP2 A variant and none of the other variants present in MSP2 B–E. These data indicate that at least for calf 60, the response of T cell lines to the MSP2 HV2-3 epitopes present in variants B/C and E is mediated by T lymphocytes primed against these variant epitopes present in the immunogen.


View this table:
[in this window]
[in a new window]
 
Table II. Response of CD4+ T lymphocytes from MSP2-immunized cattle to A. marginale FL strain MSP2 block 1 variant peptides (HV2-3)

 
The 20-aa HV2-3 sequence corresponds to the block 1 region (Fig. 1) previously shown in the South Idaho strain to undergo gene conversion, which results in a second level of antigenic variation following recombination of a pseudogene into the msp2 expression site (14). It was shown that the A3 pseudogene was used for recombination into the msp2 expression site early after infection with the South Idaho strain (13). In a separate study, analysis of msp2 variants at week 2 of infection again demonstrated recombination of the A3 pseudogene into the expression site, which was followed by three short segmental changes in this HVR (designated BLK 1–BLK 3), which were derived from other pseudogenes (14). The A3 block 1 sequence is nearly identical to the MSP2 HV2-3(A) sequence, differing by 3 aa (Table II). Peptide A3, representing the A3 block 1 sequence, also stimulated strong proliferation by uncloned cell lines from animals 59 and 60. In contrast, the naturally occurring BLK 1 variant of this sequence (14), which is nearly identical to HV2-3(D), elicited either no responses or weaker responses than peptide A3 (Table II). When T cell clones specific for peptide HV2-3(A) were tested, clone 60.2F10 additionally responded to peptide A3, whereas the other three clones, represented by clone 60.2E3, did not (Table II). This differential response by the T cell clones from animal 60 to MSP2 peptides HV2-3(A) and A3 could result from recognition of different epitopes by the T cell clones. In an attempt to address this, studies using APC that were either half matched or mismatched at MHC class II alleles and experiments using mAb to inhibit DR- or DQ-restricted responses were performed. All clones proliferated to peptide presented by autologous APC or APC that shared the DRB3 22 allele, but clones did not respond when using either APC that shared the DRB3 23 allele or APC totally mismatched at class II (Fig. 4, A and B). These data indicated that either the DRB3 22 gene product or a linked set of DQ molecules presented the epitope. Experiments using blocking mAb against DR or DQ showed that both sets of clones were restricted by DQ molecules (Fig. 4, C and D). Without further mapping studies, we cannot conclude that different epitopes are recognized by the two sets of T cell clones.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 4. MHC DQ restriction of CD4+ T lymphocyte clones specific for the block 1 region of MSP2. T cell clones were stimulated with 10 µg/ml MSP2 A variant peptides HV2-3, HV2, and HV3 in the presence of autologous (animal 60), MHC half-matched (animals 59 and G4), or mismatched (animal 61) APC. APC and corresponding DRB3 alleles are indicated on the x-axis (A and B). In a separate experiment, T cell clones were stimulated with 2 µg/ml MSP2 A variant peptide HV2-3 with autologous APC that were precultured for 1 h with no mAb or 20 µg/ml mAb specific for DQ{alpha} or DR{alpha} (C and D). Results are presented for individual clones 60.2E3 and 60.2F10 as the mean cpm + 1 SD.

 
The finding that the T cell clones specific for HV2-3(A) did not respond to the other block 1 variants in the immunogen prompted us to examine whether the variant peptides had any adverse effect on the response of clones 60.2E3 and 60.2F10 to the agonist peptide. To do this, peptides HV2-3(E), HV2-3(D), or BLK 1 were mixed with a stimulatory but suboptimal amount of agonist peptide HV2-3(A) at ratios of nonstimulatory:agonist peptide ranging from 1:20 to 50:1 during the proliferation assay. There was no observed diminution of the response to the agonist peptide HV2-3(A), indicating the lack of an antagonistic effect of the variant peptides on T cells specific for the agonist epitope (data not shown). Similar results were obtained using short-term T cell lines from cattle 59 and 60 and agonist peptides HV2-3(A) and A3 with nonstimulatory peptide HV2-3(D), in that no negative effect on the proliferative response to the stimulatory peptide was observed (data not shown). Together, these data demonstrate that antigenic variation in MSP2 resulting from combinatorial gene conversion affects CD4+ T cell recognition, resulting in a lack of recognition at the clonal level by T cells specific for the A3 sequence. However, the finding that certain naturally occurring variants are stimulatory, and not antagonistic, is compatible with the hypothesis that newly emerging variants of MSP2 can stimulate a primary immune response.

Recall responses of T cell lines specific for the MSP2 HV3-4(A) region to variants present in the MSP2 immunogen

In addition to the block 1–3 regions of the MSP2 HVR shown to undergo sequential segmental gene conversion during infection with the South Idaho strain of A. marginale (14), the MSP2 HVR identified in the FL strain organisms used in this study also displays variation in the region between blocks 1 and 2 (Fig. 1). We determined that this sequence constituted a T cell epitope for animal 61. Short-term T cell lines from animal 61 did not respond to peptide HV2, HV2-3, or to any of the MSP2 block 1 region variants (data not shown). However, animal 61 T lymphocytes did respond to peptides HV3 and HV4 (Figs. 2 and 3), indicating that at least one epitope stimulatory for this animal was present in the overlapping sequence. To test this, a 20-aa peptide corresponding to the overlap between peptides HV3 and HV4 (designated HV3-4) from the A variant was synthesized and shown to stimulate significant T lymphocyte proliferation and IFN-{gamma} production (Table III, Expt. 1). In contrast, CD4+ T lymphocytes from animals 59 and 60 did not respond to peptide HV3-4(A) (data not shown). To map the epitope present in peptide HV3-4(A) for animal 61, a series of 11 peptides truncated sequentially by 1 aa at the N terminus were tested with CD4+ T cell lines. The smallest peptide that still elicited significant responses was the 10-mer GDELSKKVCG, designated peptide HV3-4b(A/B/C) (Table III). Next, MSP2 HV3-4b variant peptides representing types D (GEKVSQNVCG) and E (GQTVSQKVCG) were synthesized and tested in proliferation assays using CD4+ T cell lines. Neither of these peptides was able to elicit a response (Table III, Expt. 2). When peptide competition/antagonism assays were performed, there was no inhibition of the response to agonist peptide HV3-4(A/B/C) by nonstimulatory peptides HV3-4(D) or HV3-4(E) (data not shown). These data show that two naturally occurring variants of the Th cell epitope defined for animal 61 (GDELSKKVCG), found between the block 1 and block 2 regions of MSP2 HVR, were neither stimulatory for CD4+ T cells nor antagonistic for T cells specific for the epitope in the predominant variant(s).


View this table:
[in this window]
[in a new window]
 
Table III. Response of CD4+ T lymphocytes from MSP2-immunized animal 61 to A. marginale FL strain MSP2 HV3-4 variant peptides

 
Proliferative responses of T cell lines specific for the MSP2 HVR block 2 and block 3 regions

We have shown that the block 1 region and 10-aa sequence immediately C terminal to block 1 comprise Th cell epitopes for animals 59/60 and 61, respectively. Therefore, it was of interest to determine whether the regions in the FL strain MSP2 HVR variant A corresponding to the block 2 and block 3 regions in the South Idaho strain, which have also been shown to undergo segmental gene conversion, contained T cell epitopes. The 20-aa MSP2 HVR block 2 region in the FL strain is contained within immunostimulatory overlapping peptides HV5–HV7, whereas the block 3 region is contained within peptides HV7–HV9 (Fig. 1 and Table I). Of these, peptides HV5 and HV6 stimulated CD4+ T cell responses from all three MSP2-immunized cattle, whereas peptide HV7 was stimulatory for only animals 59 and 60 (Figs. 2 and 3), and HV8 and HV9 were not stimulatory for any animals. Block 2 is completely contained within peptide HV5, which also contains the CD4+ T cell epitope GDELSKKCVG recognized by animal 61 (Table III) but not by animals 59 and 60. Therefore, peptide HV5(A/B/C) and the naturally occurring variants HV5(D) and HV5(E) in the MSP2 immunogen were tested for stimulation of short-term T cell lines from all three MSP2 vaccinates to see whether changes in this block 2 region affected T lymphocyte recognition. Similar studies were performed for peptide HV-7, which contains the last 10 aa of block 2 and the first 17 aa of the block 3 region. In the first experiment, the naturally occurring variants (peptides (HV5(E) and HV5(D)) of immunostimulatory peptide HV5(A/B/C) did not stimulate T cell lines from animals 59 and 61 and were weakly stimulatory for T cells from animal 60 (Table IV, Expt. 1). Although peptide HV5 contains the epitope GDELSKKVCG recognized by animal 61 T cells, an additional epitope is present in this peptide that overlaps with peptide HV6 and comprises the entire block 2 region. This sequence, different from epitope GDELSKKVCG, is also stimulatory for animals 59, 60, and 61 (Table I and Figs. 2 and 3). As shown for other nonstimulatory variant peptides, HV5(E) and HV5(D) did not inhibit the proliferative responses of T cell lines from any of the cattle in antagonism/competition assays (data not shown). Finally, stimulatory peptide HV7(A/E) that contains parts of block 2 and block 3 regions and the naturally occurring variants (HV7(B/C) and HV7(D)) were tested, and the variants were unable to elicit proliferation of T cells from animals 59 and 60 (Table IV, Expt. 2). In summary, the corresponding variant sequences of the block 2 and block 2–3 regions of immunostimulatory peptides HV5(A) and HV7(A/E) were either weakly stimulatory or not recognized by MSP2-primed T cells.


View this table:
[in this window]
[in a new window]
 
Table IV. Response of CD4+ T lymphocytes from MSP2-immunized cattle to A. marginale FL strain MSP2 block 2 variant peptides (HV5) and block 2–3 variant peptides (HV7)

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Antigenic variation involving even single amino acid changes in an epitope may result in immune evasion via a loss of T lymphocyte recognition or induction of T cell antagonism or anergy (18, 27, 28). Consequently, the process of segmental gene conversion that generates MSP2 variants with unique combinations of oligopeptide blocks provides a structural basis for T cell immune evasion. In this study, we have established that the MSP2 HVR does contain CD4+ T cell epitopes and that segmental changes result in antigenic variation and lack of Th cell recognition. Furthermore, the (HV3-4) sequence variation documented in the FL strain MSP2 sequence between blocks 1 and 2 indicates an additional "block" or position in the HVR that can undergo change. The requirement for CD4+ Th cells in generating MSP2-specific IgG and their importance in clearing rickettsial infection by IFN-{gamma} mediated macrophage activation and consequent production of toxic molecules such as NO (29, 30, 31) illustrates the potential significance of MSP2 Th cell epitope variation during infection.

Proliferation assays with CD4+ T lymphocyte clones established from MSP2-immunized animal 60 (17), using HVR peptides spanning MSP2 variant A, demonstrated specific recognition of peptides HV2, HV3, and the HV2-3 overlapping sequence. Furthermore, oligoclonal T lymphocyte lines from three MSP2 vaccinates established at least 2 years after immunization and stimulated ex vivo with A. marginale had strong proliferation and IFN-{gamma} production in response to multiple peptides spanning the most common MSP2 variant (type A). The finding that T cell lines and T cell clones stimulated with unfractionated A. marginale responded strongly to HVR peptides derived from the MSP2 A variant support the finding that this was the most abundant variant identified and demonstrate that this variant was immunogenic in the immunizing MSP2.

The minimal numbers of Th cell epitopes recognized by individual vaccinates is based on the recognition patterns of MSP2 variant A peptides that overlap by 19–20 aa. Animal 61 recognized at least two HVR epitopes: GDELSKKVCG, shared by peptides HV3, HV4, and HV5 and a second undefined epitope shared by peptides HV5 and HV6. Animals 59 and 60 recognized a minimum of three different epitopes, including the HV2-3 overlapping sequence TKGEAKKWGNAIESATGTTS, a second epitope potentially shared by peptides HV3, HV4, and HV5, and a third epitope potentially shared by peptides HV6 and HV7. Thus, the MSP2 HVR contains at least four distinct T cell epitopes capable of eliciting memory CD4+ T cell responses, because epitope GDELSKKVCG was not recognized by animals 59 and 60.

The patterns of response to the different HVR peptides by animals 59 and 60 vs animal 61 reflect differences in their MHC class II alleles. Animals 59 and 60 share one set of DRB3 and DQ alleles (DRB3 22, DQA 9B, DQB 9B), whereas animal 61 has a unique haplotype. Importantly, although the animals express different MHC class II haplotypes, all responded to peptides HV3–HV6, indicating that this is an immunodominant region in the HVR. In this region, T cell epitope clustering is observed, as there is a defined epitope recognized by animals 59 and 60 (peptide HV2-3, TKGEAKKWGNAIESATGTTS) immediately N terminal to the epitope recognized by animal 61 (peptide HV3-4b, GDELSKKVCG (Fig. 1)).

Sequence variation in MSP2 HVR T cell epitopes alters the recognition or response of variant-specific CD4+ T cells. In the block 1 region of MSP2 HVR shown to undergo segmental gene conversion (14) and represented by HV2-3 peptides, the HV2-3(A) variant was recognized, but HV2-3(B/C, D, and E) variants were not recognized by Th cell clones 60.2E3 and 60.2F10. Importantly, when the South Idaho strain MSP2 A3 variant of this epitope and its naturally occurring BLK 1 variant (14) were tested, clone 60.2F10 recognized the A3 variant but not the BLK 1 variant of this epitope, demonstrating the significance of a documented in vivo change in MSP2 HVR on T lymphocyte recognition at the clonal level. Additional evidence for the importance of HVR sequence changes is demonstrated by the lack of recognition of variant peptides HV2-3(D), HV3-4(D and E), HV5(D and E), and HV7(D and E) by some or all cell lines from the MSP2 vaccinates that responded to the respective variant A peptide. Importantly, T cell activation by stimulatory peptides was not antagonized by the nonstimulatory MSP2 variant peptides, suggesting that effector cell responses to stimulatory variants would not be suppressed in vivo should those variants be encountered again.

Although many of the variant epitopes in the immunizing MSP2 did not elicit proliferation of T cell lines that responded to the A variant epitopes, several variant epitopes were stimulatory. The potential immunogenicity of other MSP2 variants during priming is indicated by the finding that T cell lines from animals 59 or 60, but not T cell clones from animal 60, responded to the HV2-3 peptides representing variants B/C and E (Table II). Similarly, HV5 variants D and E stimulated significant proliferation of T cell lines from animal 60 (Table IV). However, we cannot rule out the possibility that some or all of these stimulatory variant peptides are recognized by cross-reactive clonal populations of variant A-specific T cells in the cell lines with TCR distinct from those T cell clones tested that responded to peptide MSP2 variant 2-3(A).

In summary, this study demonstrates the immunologic significance of MSP2 segmental gene conversion for HVR-specific Th cell responses in MSP2-vaccinates. Strong Th cell responses are induced against epitopes in both the HVR as well as in the highly conserved N and C regions (17) in MSP2 vaccinates. The magnitude of the response to HVR peptides and the most immunostimulatory conserved region peptides was similar, indicating that following multiple immunizations, no region is immunodominant. An effective immune response against a complex organism, such as A. marginale, likely consists of both T cell and Ab responses against multiple Ags and epitopes within a single Ag. However, the identification of CD4+ T cell epitopes in both conserved and HVRs of MSP2 contributes to our understanding of persistent infection. First, T cells specific for epitopes in the HVR that undergo dynamic changes during acute infection could be unresponsive or hyporesponsive to new variants, facilitating their expansion. Second, T cells specific for conserved determinants could provide accelerated Th memory responses to B cells specific for novel emerging variants, resulting in rapid variant-specific Ab production and control of rickettsemia below levels associated with clinical disease (17). Third, primary T cell responses to novel, emergent MSP2 variants could continually develop during persistent infection and contribute to the termination of infection with such variants by Ab and non-Ab (i.e., IFN-{gamma}) mediated mechanisms. The combination of such T cell and Ab responses against multiple epitopes in MSP2 and other outer membrane proteins, including those that undergo antigenic variation such as MSP3 (15), could explain the cyclical low-level rickettsemia observed during persistent anaplasmosis (5, 6, 32, 33). Studies are planned to determine which Th cell epitopes are immunodominant during acute and persistent infection.


    Acknowledgments
 
We thank Bev Hunter, Emma Karel, Kim Kegerreis, and Shelley Whidbey for excellent technical assistance, and Harris Lewin and Colleen Olmstead for MHC class II typing.


    Footnotes
 
1 This work was supported by Grant R01-AI44005 from the National Institute of Allergy and Infectious Diseases, National Institutes of Health and by U.S. Department of Agriculture Cooperative Agreement 58-5348-8-044. Back

2 Address correspondence and reprint requests to Dr. Wendy C. Brown, Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, WA 99164. E-mail address: wbrown{at}vetmed.wsu.edu Back

3 Abbreviations used in this paper: MSP2, major surface protein 2; HVR, hypervariable region; BoLA, bovine lymphocyte Ag; FL, Florida. Back

Received for publication October 24, 2002. Accepted for publication January 16, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Deitsch, K. W., E. R. Moxon, T. E. Wellems. 1997. Shared themes of antigenic variation and virulence in bacterial, protozoal, and fungal infections. Microbiol. Mol. Biol. Rev. 61:281.[Abstract]
  2. Dumler, J. S., A. F. Barbet, C. P. J. Becker, G. A. Dasch, G. H. Palmer, S. C. Ray, Y. Rikihisa, F. R. Rurangirwa. 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and "HGE agent" as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51:2145.[Abstract]
  3. Palmer, G. H., G. Eid, A. F. Barbet, T. C. McGuire, T. F. McElwain. 1994. The immunoprotective Anaplasma marginale major surface protein 2 (MSP-2) is encoded by a polymorphic multigene family. Infect. Immun. 62:3803.
  4. Eid, G., D. M. French, A. M. Lundgren, A. F. Barbet, T. F. McElwain, G. H. Palmer. 1996. Expression of major surface protein 2 antigenic variants during acute Anaplasma marginale rickettsemia. Infect. Immun. 64:836.[Abstract]
  5. French, D. F., T. F. McElwain, T. C. McGuire, G. H. Palmer. 1998. Expression of Anaplasma marginale major surface protein 2 variants during persistent cyclic rickettsemia. Infect. Immun. 66:1200.[Abstract/Free Full Text]
  6. French, D. F., W. C. Brown, G. H. Palmer. 1999. Emergence of Anaplasma marginale antigenic variants during persistent rickettsemia. Infect. Immun. 67:5834.[Abstract/Free Full Text]
  7. Murphy, C. I., J. R. Storey, J. Recchia, L. A. Doros-Richert, C. Gingrich-Baker, K. Munroe, J. S. Bakken, R. T. Coughlin, G. A. Beltz. 1998. Major antigenic proteins of the agent of human granulocytic ehrlichiosis are encoded by members of a multigene family. Infect. Immun. 66:3711.[Abstract/Free Full Text]
  8. Ijdo, J. W., W. Sun, Y. Zhang, L. A. Magnarelli, E. Fikrig. 1998. Cloning of the gene encoding the 44-kilodalton antigen of the agent of human granulocytic ehrlichiosis and characterization of the response. Infect. Immun. 66:3264.[Abstract/Free Full Text]
  9. Zhi, N., N. Ohashi, Y. Rikihisa, H. W. Horowitz, G. P. Wormser, K. Hechemy. 1998. Cloning and expression of the 44-kilodalton major outer membrane protein gene of the human granulocytic ehrlichiosis agent and application of the recombinant protein to serodiagnosis. J. Clin. Microbiol. 36:1666.[Abstract/Free Full Text]
  10. Lin, Q., N. Zhi, N. Ohashi, H. W. Horowitz, M. E. Aguero-Rosefeld, J. Raffalli, G. P. Wormser, Y. Rikihisa. 2002. Analysis of sequences and loci of p44 homologs expressed by Anaplasma phagocytophila in acutely infected patients. J. Clin. Microbiol. 40:2981.[Abstract/Free Full Text]
  11. Ijdo, J. W., C. Wu, S. R. Telford, III, E. Fikrig. 2002. Differential expression of the p44 gene family in the agent of human granulocytic ehrlichiosis. Infect. Immun. 70:5295.[Abstract/Free Full Text]
  12. Barbet, A. F., A. Lundgren, J. Yi, F. R. Rurangirwa, G. H. Palmer. 2000. Antigenic variation of the Ehrlichia Anaplasma marginale by expression of MSP2 sequence mosaics. Infect. Immun. 68:6133.[Abstract/Free Full Text]
  13. Brayton, K. A., D. P. Knowles, T. C. McGuire, G. H. Palmer. 2001. Efficient use of a small genome to generate antigenic diversity in tick-borne ehrlichial pathogens. Proc. Natl. Acad. Sci. USA 98:4130.[Abstract/Free Full Text]
  14. Brayton, K. A., G. H. Palmer, A. Lundgren, J. Yi, A. F. Barbet. 2002. Antigenic variation of Anaplasma marginale msp2 occurs by combinatorial gene conversion. Mol. Microbiol. 43:1151.[Medline]
  15. Meeus, P. F. M., K. A. Brayton, G. H. Palmer, A. F. Barbet. 2003. Conservation of a gene conversion mechanism in two distantly related paralogs of Anaplasma marginale. Mol. Microbiol. 47:633.[Medline]
  16. Palmer, G. H., W. C. Brown, F. R. Rurangirwa. 2000. Antigenic variation in the persistence and transmission of the ehrlichia Anaplasma marginale. Microbes Infect. 2:167.[Medline]
  17. Brown, W. C., T. C. McGuire, D. Zhu, H. A. Lewin, J. Sosnow, G. H. Palmer. 2001. Highly conserved regions of the immunodominant major surface protein 2 of the genogroup II ehrlichial pathogen Anaplasma marginale are rich in naturally derived CD4+ T lymphocyte epitopes that elicit strong recall responses. J. Immunol. 166:1114.[Abstract/Free Full Text]
  18. Sloan-Lancaster, J., P. M. Allen. 1996. Altered peptide ligand-induced partial T cell activation: molecular mechanisms and role in T cell biology. Annu. Rev. Immunol. 14:1.[Medline]
  19. Palmer, G. H., T. C. McGuire. 1984. Immune serum against Anaplasma marginale initial bodies neutralizes infectivity for cattle. J. Immunol. 133:1010.[Abstract]
  20. Brown, W. C., V. Shkap, D. Zhu, T. C. McGuire, W. Tuo, T. F. McElwain, G. H. Palmer. 1998. CD4+ T-lymphocyte and immunoglobulin G2 responses in calves immunized with Anaplasma marginale outer membranes and protected against homologous challenge. Infect. Immun. 66:5406.[Abstract/Free Full Text]
  21. Tuo, W., G. H. Palmer, T. C. McGuire, D. Zhu, W. C. Brown. 2000. Interleukin-12 as an adjuvant promotes immunolglobulin G and type 1 cytokine recall responses to major surface protein 2 of the ehrlichial pathogen Anaplasma marginale. Infect. Immun. 68:270.[Abstract/Free Full Text]
  22. Ababou, A., W. C. Davis, D. Levy. 1993. The DA-147 monoclonal antibody raised against the HLA-DR{alpha} chain identifies a cryptic epitope on the BoLA-DR{alpha} chain. Ann. Rech. Vet. 24:402.
  23. Dutia, B. M., L. MacCarthy-Morrogh, E. K. Glass, G. Knowles, R. L. Spooner, J. Hopkins. 1995. Discrimination between major histocompatibility complex class II DQ and DR locus products in cattle. Anim. Genet. 26:111.[Medline]
  24. Bennett, S., E. M. Riley. 1992. The statistical analysis of data from immunoepidemiological studies. J. Immunol. Methods 146:229.[Medline]
  25. Beyer, J. C., R. W. Stich, W. C. Brown, W. P. Cheevers. 1998. Cloning and expression of caprine interferon-{gamma}. Gene 210:103.[Medline]
  26. Brown, W. C., T. C. McGuire, W. Mwangi, K. A. Kegerreis, H. Macmillan, H. A. Lewin, G. H. Palmer. 2002. Major histocompatibility complex class II-derived DR-restricted memory CD4+ T lymphocytes recognize conserved immunodominant epitopes of Anaplasma marginale major surface protein 1a. Infect. Immun. 70:5521.[Abstract/Free Full Text]
  27. Plebanski, M., E. A. M. Lee, A. V. S. Hill. 1997. Immune evasion in malaria: altered peptide ligands of the circumsporozoite protein. Parasitology 115:S55.
  28. McMichael, A.. 1998. T cell responses and viral escape. Cell 93:673.[Medline]
  29. Park, J., Y. Rikihisa. 1992. L-Arginine-dependent killing of intracellular Ehrlichia risticii by macrophages treated with {gamma} interferon. Infect. Immun. 60:3504.[Abstract/Free Full Text]
  30. Akkoyunlu, M., E. Fikrig. 2000. {gamma} interferon dominates the murine cytokine response to the agent of human granulocytic ehrlichiosis and helps to control the degree of early rickettsemia. Infect. Immun. 68:1827.[Abstract/Free Full Text]
  31. Banerjee, R., J. Anguita, E. Fikrig. 2000. Granulocytic ehrlichiosis in mice deficient in phagocyte oxidase or inducible nitric oxide synthase. Infect. Immun. 68:4361.[Abstract/Free Full Text]
  32. Eriks, I. S., G. H. Palmer, T. C. McGuire, D. R. Allred, A. F. Barbet. 1989. Detection and quantitation of Anaplasma marginale in carrier cattle by using a nucleic acid probe. J. Clin. Microbiol. 27:279.[Abstract/Free Full Text]
  33. Kieser, S. T., I. S. Eriks, G. H. Palmer. 1990. Cyclic rickettsemia during persistent Anaplasma marginale infection of cattle. Infect. Immun. 58:1117.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
A. F. Barbet, B. Byrom, and S. M. Mahan
Diversity of Ehrlichia ruminantium Major Antigenic Protein 1-2 in Field Isolates and Infected Sheep
Infect. Immun., June 1, 2009; 77(6): 2304 - 2310.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Han, J. Norimine, G. H. Palmer, W. Mwangi, K. K. Lahmers, and W. C. Brown
Rapid Deletion of Antigen-Specific CD4+ T Cells following Infection Represents a Strategy of Immune Evasion and Persistence for Anaplasma marginale
J. Immunol., December 1, 2008; 181(11): 7759 - 7769.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
D. G. Scorpio, C. Leutenegger, J. Berger, N. Barat, J. E. Madigan, and J. S. Dumler
Sequential Analysis of Anaplasma phagocytophilum msp2 Transcription in Murine and Equine Models of Human Granulocytic Anaplasmosis
Clin. Vaccine Immunol., March 1, 2008; 15(3): 418 - 424.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
B. Nandi, K. Hogle, N. Vitko, and G. M. Winslow
CD4 T-Cell Epitopes Associated with Protective Immunity Induced following Vaccination of Mice with an Ehrlichial Variable Outer Membrane Protein
Infect. Immun., November 1, 2007; 75(11): 5453 - 5459.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N. Ismail, E. C. Crossley, H. L. Stevenson, and D. H. Walker
Relative Importance of T-Cell Subsets in Monocytotropic Ehrlichiosis: a Novel Effector Mechanism Involved in Ehrlichia-Induced Immunopathology in Murine Ehrlichiosis
Infect. Immun., September 1, 2007; 75(9): 4608 - 4620.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. R. Abbott, G. H. Palmer, K. A. Kegerreis, P. F. Hetrick, C. J. Howard, J. C. Hope, and W. C. Brown
Rapid and Long-Term Disappearance of CD4+ T Lymphocyte Responses Specific for Anaplasma Marginale Major Surface Protein-2 (MSP2) in MSP2 Vaccinates following Challenge with Live A. marginale
J. Immunol., June 1, 2005; 174(11): 6702 - 6715.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. K. Lahmers, J. Norimine, M. S. Abrahamsen, G. H. Palmer, and W. C. Brown
The CD4+ T cell immunodominant Anaplasma marginale major surface protein 2 stimulates {gamma}{delta} T cell clones that express unique T cell receptors
J. Leukoc. Biol., February 1, 2005; 77(2): 199 - 208.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. A. Brayton, L. S. Kappmeyer, D. R. Herndon, M. J. Dark, D. L. Tibbals, G. H. Palmer, T. C. McGuire, and D. P. Knowles Jr.
Complete genome sequencing of Anaplasma marginale reveals that the surface is skewed to two superfamilies of outer membrane proteins
PNAS, January 18, 2005; 102(3): 844 - 849.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. R. Abbott, G. H. Palmer, C. J. Howard, J. C. Hope, and W. C. Brown
Anaplasma marginale Major Surface Protein 2 CD4+-T-Cell Epitopes Are Evenly Distributed in Conserved and Hypervariable Regions (HVR), Whereas Linear B-Cell Epitopes Are Predominantly Located in the HVR
Infect. Immun., December 1, 2004; 72(12): 7360 - 7366.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
W. C. Brown, G. H. Palmer, K. A. Brayton, P. F. M. Meeus, A. F. Barbet, K. A. Kegerreis, and T. C. McGuire
CD4+ T Lymphocytes from Anaplasma marginale Major Surface Protein 2 (MSP2) Vaccinees Recognize Naturally Processed Epitopes Conserved in MSP3
Infect. Immun., June 1, 2004; 72(6): 3688 - 3692.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. A. Brayton, P. F. M. Meeus, A. F. Barbet, and G. H. Palmer
Simultaneous Variation of the Immunodominant Outer Membrane Proteins, MSP2 and MSP3, during Anaplasma marginale Persistence In Vivo
Infect. Immun., November 1, 2003; 71(11): 6627 - 6632.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Q. Lin, Y. Rikihisa, N. Ohashi, and N. Zhi
Mechanisms of Variable p44 Expression by Anaplasma phagocytophilum
Infect. Immun., October 1, 2003; 71(10): 5650 - 5661.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brown, W. C.
Right arrow Articles by Palmer, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brown, W. C.
Right arrow Articles by Palmer, G. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS