|
|
||||||||
2V
2 T Cells1



* Division of Rheumatology, Department of Internal Medicine and Interdisciplinary Group in Immunology, University of Iowa College of Medicine, Iowa City, IA 52442;
Division of Rheumatology, Immunology, and Allergy, Department of Medicine, Brigham and Womens Hospital, and
Division of Viral Pathogenesis, Beth Israel Hospital, Harvard Medical School, Boston, MA 02115;
Structural and Cell Biology Program, Department of Biomedical Sciences, Wadsworth Center, New York State Department of Health, Albany, NY 12201; and
¶ Center for Advanced Research in Biotechnology, University of Maryland Biotechnology Institute, Rockville, MD 20850
| Abstract |
|---|
|
|
|---|
2V
2+ T cells mount adaptive immune responses in response to Mycobacterium bovis bacillus Calmette-Guérin infections. We have now analyzed rhesus monkey 
T cell responses to nonpeptide Ags and superantigens. Like human V
2V
2+ T cells, rhesus monkey 
T cells are stimulated when exposed to prenyl pyrophosphate, bisphosphonate, and alkylamine Ags. Responsiveness was limited to 
T cells expressing V
2V
2 TCRs. Rhesus monkey V
2V
2+ T cells also responded to the superantigen, staphyloccocal enterotoxin A. Sequencing of the rhesus monkey V
2V
2 TCR revealed a strong sequence homology to human V
2V
2 TCR that preserves important sequence motifs. Moreover, chimeric TCRs that pair human V
2 with monkey V
2 and monkey V
2 with human V
2 retain reactivity to nonpeptide Ags and B cell lymphomas. A molecular model of the rhesus monkey V
2V
2 TCR has a basic region in the complementarity-determining region 3 binding groove that is similar to that seen in the human V
2V
2 TCR and preserves the topology of the complementarity-determining region loops. Thus, recognition of nonpeptide prenyl pyrophosphate, bisphosphonate, and alkylamine Ags is conserved in primates suggesting that primates can provide an animal model for human 
T cell Ag responses. | Introduction |
|---|
|
|
|---|

) T cells are a second subset of T cells with unique functional and recognition properties (1). Murine 
T cells play important roles in immunity to infections and tumors (2), tissue homeostasis (3), immunoregulation (4), and in controlling autoimmune 
T cell responses (5). In so doing, 
T cells likely function as a bridge between the innate and adaptive immune systems. Although few Ags have been defined for murine 
T cells, human 
T cells can recognize nonpeptide Ags. 
T cells expressing V
1 TCRs can recognize self and foreign lipids presented by CD1 (6) and the nonclassical MHC class Ib protein, MHC class I-related chain A/MHC class I-related chain B (7). Most human 
T cells express V
2V
2 TCRs that recognize nonpeptide prenyl pyrophosphates (8, 9, 10), bisphosphonates (11, 12, 13), and alkylamines (14). The recognition of these nonpeptide Ags requires the pairing of V
2 (also termed V
9) with V
2 (15). Although cell-cell contact is required for recognition (16), recognition does not require classical MHC class I or class II molecules (16), prior antigenic exposure (8, 17, 18), or Ag processing (16).
Large expansions of V
2V
2+ T cells occur during some bacterial and parasitic infections (reviewed in Ref. 1). In some patients, these 
T cell expansions can be extremely large such that almost all (in erhlichiosis) or half (in salmonellosis and tularemia) of peripheral blood T cells are 
T cells. The 
T cell expansion can occur rapidly after infection (as early as 7 days; Ref. 19) and can persist for up to a year (20). V
2V
2+ T cells recognize cells infected with bacteria (21, 22, 23) and can reduce bacterial viability through the release of granulysin (6, 24). V
2V
2+ T cells also produce large amounts of the inflammatory TNF-
and IFN-
cytokines when stimulated by nonpeptide Ags (25). Moreover, V
2V
2+ T cells activated by nonpeptide Ags protect SCID mice from in vivo bacterial infections by reducing bacterial numbers (26). These results suggest that human 
T cells have important roles in immunity to these pathogens similar to and perhaps greater than the roles played by 
T cells in mice.
Determining the importance of 
T cells in human immunity has been hampered by the lack of an experimental animal model system to study this T cell subset. Few foreign Ags have been discovered for 
T cells from other species. Other nonprimate animals, including mice and rats, do not have V genes homologous to V
2 and V
2 genes and do not respond to nonpeptide Ags that stimulate human V
2V
2+ T cells. Recently, we demonstrated that V
2V
2+ T cells in rhesus monkeys can expand in response to infection with Mycobacterium bovis bacillus Calmette-Guérin (BCG)4 (27). Monkey V
2V
2+ T cells mounted adaptive (memory) responses because reinfection of the monkeys with BCG resulted in earlier and larger 
T cell expansions. Importantly, this capacity to rapidly expand coincided with a clearance of BCG bacteremia and immunity to fatal tuberculosis in BCG-vaccinated rhesus monkeys.
To extend our study of rhesus monkey 
T cells, we have analyzed rhesus monkey 
T cell responses to the described nonpeptide Ags and superantigens. Like human 
T cells, rhesus monkey 
T cells expanded when exposed to prenyl pyrophosphates and other phosphoantigens and to alkylamine Ags. These expansions were limited to 
T cells expressing V
2V
2 TCRs. Rhesus monkey V
2V
2+ T cells also responded to the superantigen, staphylococcal enterotoxin A (SEA), and to an unknown Ag expressed by the B cell lymphoma, RPMI 8226. The amino acid sequence of the rhesus monkey V
2V
2 TCR has strong homology to human V
2V
2 TCR. A molecular model of the rhesus monkey V
2V
2 TCR shows a basic region in the complementarity-determining region (CDR)3 binding groove that is similar to that seen in the human V
2V
2 TCR. These data demonstrate that recognition of nonpeptide prenyl pyrophosphate and alkylamines is conserved in primates providing an animal model for human 
T cell responses.
| Materials and Methods |
|---|
|
|
|---|
Prenyl pyrophosphates and alkylamines were purchased from Sigma-Aldrich (St. Louis, MO). Phosphoantigens including monoethyl phosphate (MEP) and nucleotide-conjugated compounds were synthesized as described (10, 28). The SEA superantigen was produced as a recombinant protein as described (29).
Expansion of 
T cells by exposure to nonpeptide Ags
Mononuclear cells were prepared from heparinized rhesus monkey blood by centrifugation over density gradients of Ficoll-Hypaque (Pharmacia Fine Chemicals, Piscataway, NJ). PBMC were incubated with media, isopentenyl pyrophosphate (IPP) (50 µM), or partially purified (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMBPP) (1/1000 dilution of a concentrated, <1 kDa Mycobacterium fortuitum supernatant). IL-2 was added to 1 nM on day 3. The cells were harvested on days 710 and stained with the indicated mAbs for flow cytometric analysis as detailed below. For the alkylamines, 1 million PBMC in 1 ml of medium were cultured for 10 days with 400 µM sec- or iso-butylamine, followed by double-staining with anti-V
2/J
2 (15D) and anti-V
2 (7A5) mAbs and analysis by flow cytometry. Four monkeys were tested.
Derivation and maintenance of T cell lines and clones
Rhesus monkey 
T cell clones were derived from the blood of a normal rhesus monkey. PBMC were stimulated with a mycobacterial supernatant from M. fortuitum (8). After 2 wk, 
T cells comprised 96% of T cells. 
T cells were cloned by limiting dilution at 5 cells/well. T cell clones were maintained by periodic restimulation with PHA-P (30).
T cell proliferation assay
For proliferation assays, T cells were plated in triplicate in round-bottom 96-well plates at 510 x 104 T cells per well with 1 x 105 irradiated (7000 rad) human PBMC feeder cells, the EBV-transformed B cell line, DG.EBV, PBMC, or glutaraldehyde-fixed Va-2 tumor cells with various Ags. Prenyl pyrophosphates in ammonium hydroxide and methanol were dried by N2 gas and dissolved in media by sonicating in an ultrasonic water bath for 5 min. The cultures were pulsed with 1 µCi [3H]thymidine (2 Ci/mmol) on day 1 and harvested 1618 h later.
Monoclonal Abs
mAbs reactive with human 
TCR were tested to identify those that cross-react with rhesus monkey 
T cells using either rhesus monkey PBMC or rhesus monkey V
2V
2 T cell lines. The cross reactivity for mAbs for 
TCR are detailed in Table I. Based on these results, the following anti-TCR mAbs were used: anti-TCR
1 (pan anti-TCR
),
TCS1 or TS8 (anti-V
1/J
1/2), 15D (anti-V
2/J
2/3), 7A5 (anti-V
2 (V
2 is also called V
9)), 23D12 (anti-V
1.2, 1.3, and 1.4), and 4A11 (anti-V
1.4). mAb to surface molecules were FN18 (anti-monkey CD3), OKT4 (anti-CD4), OKT8 (anti-CD8
), and OKT11 (anti-CD2). Isotype-matched control mAbs were used as controls.
|
Mononuclear cells were prepared from heparinized rhesus monkey blood by centrifugation over density gradients of Ficoll-Hypaque (Pharmacia Fine Chemicals). Isolated mononuclear cells, T cell lines, and T cell clones were analyzed by one- or two-color immunofluorescence after staining with the appropriate mAb as described (31). Cells were incubated with mouse mAbs on ice for 30 min, washed, and stained with FITC-conjugated F(ab')2 goat anti-mouse IgG and IgM antisera (Tago Scientific, Burlingame, CA) for an additional 30 min on ice. After washing, the cells were resuspended in propidium iodide and analyzed by flow cytometry. To prevent background staining of rhesus monkey B cells by anti-mouse Ig antisera, 2% monkey serum was included in the staining buffer. Flow cytometry was performed with a FACScan flow cytometer using CellQuest software (BD Biosciences, Palo Alto, CA).
Sequencing of rhesus monkey V
2V
2 TCR
RNA was isolated from rhesus monkey T cell lines (Micro RNA isolation kit; Stratagene, La Jolla, CA) followed by cDNA synthesis using SuperScript II reverse transcriptase and random hexamers (SuperScript first-strand synthesis system for RT-PCR; Life Technologies, Gaithersburg, MD). PCR was done with Platinum Taq High Fidelity DNA polymerase (Life Technologies). PCR primers used to derive full-length V
2C
and V
2C
chains were as described previously (6) except that for the V
2C
chain the following primer was used to introduce a KpnI restriction site into the 5' region of the V
2C
2 chain for cloning: 5'-gggggtaccCAGGCAGAAGGTGGTTGAGAG-3' V
2 5' untranslated region. The V
2C
and V
2C
PCR products were cloned into pREP7 and pREP9 vectors through KpnI-XhoI and KpnI-BamHI sites (Invitrogen, Carlsbad, CA), respectively. Sequencing was done using an automated sequencer using the pREP forward and reverse primers along with the following reverse primers: C
, 3'UT ATGGCCTCCTTGTGCCACCG; C
internal, TGTGTCGTTAGTCTTCATGG; C
, 3'UT GGAGTGTAGCTTCCTCATGC; and C
internal, GACAATAGCAGGATCAAACT. Nucleotide sequences have been deposited into GenBank under the accession numbers of AY190025 (RM.2.32
), AY190026 (RM.2.32
), AY190027 (RM.2.14
), and AY190028 (RM.2.14
).
Derivation of human/rhesus monkey V
2V
2 TCR transfectants
Chimeric rhesus monkey V
2/human V
2 TCR transfectants were derived by electroporation of the Jurkat mutant, J.RT3-T3.5 with the rhesus monkey RM2.14 TCR-
chain cDNA (cloned in the pREP-7 vector) and the human DG.SF68 TCR-
chain cDNA (cloned in the pREP-9 vector) as described previously (32). Chimeric human V
2/rhesus monkey V
2 TCR transfectants were derived using a similar strategy with human DG.SF13 TCR-
chain cDNA and rhesus monkey RM2.32 TCR-
chain cDNA except that human C
was substituted for rhesus monkey C
(see below). Human V
2 and V
2 TCR cDNAs were inserted into pREP-7 and pREP-9, respectively (15). In initial experiments, neither rhesus monkey V
2V
2 TCRs nor chimeric human V
2/rhesus monkey V
2 TCRs were expressed when transfected into J.RT3-T3.5, presumably due to the inability of rhesus monkey C
to associate with the human CD3 complex. To allow expression of a chimeric receptor, human C
was substituted for rhesus monkey C
. A rhesus monkey V
2 fragment from the RM2.32 T cell clone and a human C
fragment were produced by PCR using V
2 forward with rhesus monkey V
2 5' UT reverse primers and human C
forward with C
3' UT reverse primers, respectively. PCR primers were as above except for: rhesus monkey V
2, 5' UT reverse, CAGTCACACGGGTCCCTTTTCCAAAGATG; human C
forward, CATCTTTGGAAAAGGAACCCGTGTGACTG.
A complete cDNA from the fragments was then produced by annealing PCR under the following conditions: a 5-min denaturation step at 94°C followed by five cycles of annealing (94°C for 1 min, 50°C for 4 min, 72°C for 1.5 min), 40 cycles of amplification (94°C for 30 s, 55°C for 1 min, 72°C for 1 min), and a final extension at 72°C for 10 min. The rhesus monkey V
2/human C
cDNA was then cloned into pREP-9.
IL-2 release and assay
Stimulation of TCR transfectants for IL-2 release was performed as described (16). Briefly, 1 x 105 transfectants were cultured in triplicate with the indicated Ag in the presence of 1 x 105 glutaraldehyde-fixed Va-2 cells and 10 ng/ml PMA. After 24 h, supernatants were harvested, frozen, thawed, and used at a 1/8 dilution to stimulate the proliferation of the IL-2-dependent cell line, HT-2.
Modeling of the rhesus monkey V
2V
2 TCR
A model of the rhesus monkey V
2V
2TCR was built using homology modeling as described for the V
2 chain (29) using the coordinates for the human V
2V
2TCR (kindly provided by Dr. D. Garboczi, National Institutes of Health, Bethesda, MD). The sequences of monkey and human V
2V
2 TCRs were aligned using a GeneMine package (Molecular Applications Group, Palo Alto, CA). Because they show >85% sequence identity, the CARA module of LOOK homology modeling package (33) was used to generate the model of the monkey V
2V
2 TCR using the coordinates of the crystal structure of human V
2V
2 TCR as the initial template. There are two insertions in the TCR CDR3. To model this loop, the SEGMOD module of GeneMine (34) was used. The figures were generated by Molscript (35) and Raster3D (36) (see Fig. 7, AC) and GRASP (see Fig. 7D).
|
| Results |
|---|
|
|
|---|

T cell repertoire of rhesus monkey blood resembles human neonatal blood

T cells in humans at birth are present at low levels with a predominance of V
1+ cells. Between the ages of 3 and 10 years, V
2V
2+ T cells expand in response to environmental factors resulting in the predominance of V
2V
2+ T cells that is found in most adults. To determine whether rhesus monkeys maintained in closed, specific pathogen-free colonies also exhibit a predominance of V
2V
2+ T cells, PBMC from rhesus monkeys were analyzed for V gene segment expression by flow cytometry. Unlike most human adults, adolescent and adult rhesus monkeys exhibited a predominance of V
1+ T cells (Table II and Fig. 1). This pattern of V gene expression is seen in human newborns and in human infants <310 years of age (31, 37). Because the change in the proportion of V
1+ to V
2+ T cells in humans is due to an environmental influence, this suggests that rhesus monkeys maintained in closed colonies may not be exposed to the same pathogens or natural flora as humans.
|
|
2V
2+ T cells
To determine whether 
T cells from rhesus monkeys respond to nonpeptide Ags, PBMC from rhesus monkeys were stimulated with the major bacterial phosphoantigen, HMBPP, from M. fortuitum and the alkylamines, sec-butylamine and iso-butylamine. Exposure of monkey PBMC to HMBPP resulted in an expansion of V
2V
2+ T cells to between 20 and 97% of CD3+ T cells (Fig. 2A). Similarly, exposure of PBMC from other rhesus monkeys to sec-butylamine and iso-butylamine resulted in V
2V
2+ T cell expansions of between 10 and 43% and 32 and 46% of CD3+ T cells, respectively (Fig. 2B). Note that one monkey did not respond to sec-butylamine and a second different monkey did not respond to iso-butylamine. A similar lack of response to nonpeptide Ags has been observed in
1020% of human adults (17). Thus, rhesus monkey V
2V
2+ cells, like human V
2V
2+ T cells, proliferate in response to nonpeptide phosphoantigens and alkylamine Ags.
|
2V
2+ T cell clones
Human V
2V
2+ T cells respond to nonpeptide phosphoantigens and the superantigen, SEA. To determine the response of rhesus monkey V
2V
2+ T cells at the clonal level, rhesus monkey V
2V
2+ T cell clones were derived and tested for recognition of the MEP prenyl pyrophosphate analog and the SEA superantigen. A rhesus monkey V
2V
2+ T cell line was derived by stimulating PBMC with HMBPP followed by limited dilution cloning. 
T cells expressed CD8
homodimers (CD8
staining was 88% whereas CD8
was 0.9%) and CD2 (99%) (data not shown). Ninety-four percent (51 of 54 clones) of the monkey V
2V
2+ T cell clones derived from this line responded to the prenyl pyrophosphate analog, MEP. Like human 
T cells (29), the rhesus monkey V
2V
2+ T cell clones also responded to the superantigen, SEA (representative examples are shown in Fig. 3).
|
2C
V
2C
TCR sequence
To determine whether the conservation of nonpeptide Ag reactivity reflects conservation of the V
2V
2 TCR sequence, we cloned and sequenced full-length V
2 and V
2 cDNA from several rhesus monkey clones. The V
2 gene segment was highly conserved showing 88% similarity to the human V
2 gene segment (Fig. 4A). Few amino acid changes were noted in CDR1 and CDR2. The J
1 and J
2 segments were highly conserved with no amino acid differences noted. Some V
2V
2+ T cell clones did not react with the 15D mAb that is specific for V
2 in humans (data not shown and Ref. 38). Sequencing the V
2 chain from these clones revealed that clones with weak or absent reactivity with the 15D mAb expressed the V
2 gene segment in conjunction with the J
1 junctional segment (Fig. 4B). V
2V
2+ T cell clones strongly reactive with the 15D mAb expressed the V
2 gene segment in conjunction with the J
2 junctional segment. This suggests that the 15D mAb has a restricted reactivity with rhesus monkey 
T cells preferentially reacting with V
2J
2 and possibly J
3 chains. Other anti-human V
2 mAbs lack reactivity to the rhesus monkey V
2 gene segment (eight of nine V
2-specific mAbs; Table I) suggesting that they may react with the same epitope(s) that are lost in rhesus monkeys.
|
2 gene segment revealed 91% similarity between the rhesus monkey and human sequence (Fig. 4C). The CDR1 and CDR2 of V
2 had three and two amino acid differences, respectively, that were mostly conservative amino acid changes (Fig. 4E). The CDR3 region showed at least four amino acid differences in the J
1.2 segment that were all conservative changes, including an arginine for lysine difference (Fig. 4D). We and others have proposed that basic residues in the J
1.2 segment may constitute contact residues for pyrophosphate binding (28, 39). The rhesus monkey V
2 TCR also showed conservation in V
2 CDR3 length with all three V
2 CDR3s within two amino acids in length (Fig. 4D). This is similar to human V
2 TCR where 98% of adult V
2V
2 TCR have V
2 CDR3 lengths of ±1 of a modal value (40).
The C
and C
gene segments were also highly conserved. The C
segment showed 87% similarity with the human C
segment (Fig. 4F) and the C
segment showed 93% similarity with the human C
segment (Fig. 4G). Thus, rhesus monkey and human V
2V
2 TCRs are highly conserved in amino acid sequence with only minor differences noted in CDRs.
Fine phosphoantigen specificity of rhesus monkey V
2V
2+ T cells is similar to human V
2V
2+ T cells
Because human and monkey V
2V
2 TCR differ in their CDRs (Fig. 4), we sought to determine whether these changes affect the fine Ag specificity of rhesus monkey V
2V
2+ T cells. A variety of different prenyl pyrophosphate Ags and analogs were used to stimulate human and rhesus monkey V
2V
2+ T cell clones. Despite the CDR differences between human and rhesus monkey V
2V
2 TCR, the relative potency of different analogs was identical such that the hierarchy of phosphoantigen bioactivity did not change (Fig. 5). For example, similar strong reactivity to IPP and ethyl pyrophosphate (EPP) and low reactivity to phenylethyl- and iso-amyl pyrophosphate was noted for both monkey and human V
2V
2+ T cells (Fig. 5). The rhesus monkey V
2V
2+ T cell clones shown were more sensitive to Ag stimulation as compared with human V
2V
2+ T cell clones but this was not a consistent finding with all monkey clones (such variation is also seen with human clones). Thus, despite differences in CDR sequence between human and monkey V
2V
2+ T cells, fine phosphoantigen specificity was unchanged suggesting that these differences do not affect nonpeptide Ag recognition.
|
To further study the conservation in recognition of nonpeptide Ag between rhesus monkey and human V
2V
2 TCR, human/monkey chimeric 
TCR transfectants were derived by cotransfection and tested for their response to nonpeptide Ags by IL-2 release. TCR transfectants expressing either monkey V
2 paired with human V
2 or human V
2 paired with monkey V
2 were found to respond to HMBPP, EPP, and the bisphosphonate, risedronate, in a similar manner (Fig. 6A). Detailed testing of the TCR transfectant expressing human V
2 paired with monkey V
2 revealed responsiveness to all of the major Ags defined for human V
2V
2+ T cells including prenyl pyrophosphate Ags and analogs, alkylamines, bisphosphonates, the bacterial phosphoantigen, HMBPP, and the B cell lymphoma, RPMI 8226 (Fig. 6B). Moreover, the rank order of the response to the different prenyl pyrophosphate Ags and analogs was similar (compare Fig. 6B, top panel, with Fig. 5). Thus, the rhesus monkey and human V
2 and V
2 gene segments can be interchanged without loss or major alteration in reactivity to any of the known nonpeptide Ags recognized by the V
2V
2 TCR.
|
2V
2 TCR and the human V
2V
2 TCR
Because there was close sequence similarity between the rhesus monkey and the human V
2V
2 TCR (Fig. 4), we made a homology model of the rhesus monkey V
2V
2 TCR based on the crystal structure of the human V
2V
2 TCR (39). Consistent with their close sequence similarities, there were few differences between the two TCRs when the carbon backbone was superimposed (Fig. 7, A and B). Despite the differences in the sequence of the CDRs, the position of the CDR loops showed little variation. The amino acid differences (colored red) in the CDR1 and CDR2 of the monkey and human V
2 chain are located in areas that are not the highest points on the CDR loops (Fig. 7C). Moreover, when the surface potential of the two receptors was compared, both have similar basic (positively charged) regions in the CDR3 groove encoded by a lysine (K109) from the J
1.2 region of the CDR3 of V
2 and an arginine (R51) from the CDR2 loop of V
2. These two basic residues are conserved between rhesus monkeys, humans, and Aotus monkeys and are postulated to form a potential binding site for the pyrophosphate residues of phosphoantigens (28, 39). Consistent with this hypothesis, this region is required for Ag recognition because alterations in the CDR3 of the V
2 chain or direct mutation of the K109 lysine results in the loss of Ag recognition (41, 42). Another basic lysine residue, K108, that is required for phosphoantigen recognition (our unpublished observation and Ref. 42), exhibits a conservative change because the corresponding residue is an arginine in the rhesus monkey TCR. Thus, close similarities are noted in the structure of the rhesus monkey and human V
2V
2 TCRs with conservation of the CDR loop topology and in a basic region in the CDR3 groove.
| Discussion |
|---|
|
|
|---|

T cells. Like in humans, phosphoantigens, bisphosphonates, and alkylamines stimulate the rhesus monkey V
2V
2+ T cell subset. Moreover, even the fine specificity for phosphoantigens exhibited by rhesus monkey V
2V
2+ T cells is identical to that of human V
2V
2+ T cells. Comparison of the primary amino acid sequence of rhesus monkey V
2 and V
2 gene segments revealed close similarities with amino acid conservation in all of the CDRs. This sequence similarity was sufficient to allow the expression of chimeric human/monkey V
2V
2 TCRs that recognized phosphoantigens identically to human V
2V
2 TCRs. Modeling of the rhesus monkey V
2V
2 TCR, revealed a similar topology to the CDR loops with identical amino acids in the highest points of the loops. These results suggest that the conservation of 
T cell recognition extends to lower primates allowing their use as an animal model for human 
T cells responses.
Rhesus monkey V
2V
2+ T cells showed complete conservation of nonpeptide Ag, lymphoma, and superantigen reactivity. Thus, responses were noted to prenyl pyrophosphates and analogs including IPP, EPP, and HMBPP. Moreover, there were minimal differences in the relative potency of the different analogs such that the hierarchy of reactivity did not significantly differ between rhesus monkey and human V
2V
2+ T cell clones. Similarly, reactivity to the other nonpeptide Ags, the alkylamines and the bisphosphonates (Figs. 2B and 6, A and B) was conserved as was reactivity to the superantigen, SEA (Fig. 3). The conservation of Ag and superantigen reactivity probably reflects the conservation of the amino acid sequence of the V
2 CDR1, CDR2, and HV4 regions (Fig. 4E) where there are few changes in the predicted critical contact residues (29). Reactivity to the uncharacterized Ag on the B cell lymphomas, Daudi (43), and RPMI 8226 (Fig. 6B), was also conserved. Thus, reactivity to all of the known Ags for V
2V
2+ T cells was conserved in rhesus monkeys.
The V
2 and V
2 variable regions are highly conserved between the rhesus monkey and humans (91 and 88%, respectively). V
genes show a similar level of amino acid similarity because 17 different V
genes averaged 88% similarity to their human counterparts (44). The amino acid differences noted in the CDR1 and CDR2 of V
2 and V
2 variable regions are mainly conservative changes that are localized to less exposed regions of the TCR on our structural model (Fig. 7C). Thus, the basic arginine residue (residue 43) from the CDR2 of the V
2 gene and the lysine residue from the J
1.2 region that makes up the basic region located in the groove of the V
2V
2 TCR are conserved in the three primates (Fig. 4E). Rhesus (Fig. 4B and Ref. 45) and Aotus monkeys (46) also express a hydrophobic residue at codon 109 in the CDR3 of the V
2 gene that is found in most human V
2V
2+ T cells (47).
Despite the importance of the CDR3 of the V
2 gene in determining reactivity to nonpeptide Ags (41, 42), the rhesus monkey J
1.2 gene differs at a number of amino acid residue from human and Aotus J
1.2 genes (Fig. 4 and Ref. 45). The first basic residue in the rhesus monkey J
1.2 gene segment is an arginine rather than the lysine found in humans and Aotus monkeys. This residue is located near the basic region composed of the second lysine residue of the J
1.2 gene with a basic residue from the CDR2 of V
2 (28, 39). Both of the basic residues in the human J
1.2 gene segment are critical for nonpeptide Ag recognition (42) and thus have been conserved in rhesus monkeys. Three other residues exhibit conservative replacements whereas a fourth residue, the aspartic acid found in the third position, is not present in rhesus monkeys. Although differing in amino acid sequence, rhesus monkey V
2V
2+ T cells are similar to human V
2V
2+ T cells (40, 47) in that they conserve the length of the CDR3 (Fig. 4D and Refs. 45, 48). Thus, the length of the CDR3 may be more important than certain CDR3 amino acid residues.
The similarities in rhesus monkey and human V
2V
2 TCRs also extend to their fine specificity to phosphoantigens. Different analogs of IPP showed similar or identical hierarchies of potencies when different rhesus monkey V
2V
2 clones were compared with human V
2V
2 clones. Therefore, 
T cell recognition of phosphoantigens differs from 
T cell recognition of nonpeptide haptens and drugs presented by MHC class I and class II molecules. These 
T cells commonly show differences in fine specificity for Ag between clones (49, 50) as well as specificity to the peptide conjugated to the hapten (51). In contrast, the differences in the CDR1, CDR2, and CDR3 seen between rhesus monkey and human V
2V
2 TCRs do not affect the fine Ag specificity. We speculate that if an Ag-presenting element for prenyl pyrophosphate Ags exists, it is relatively nonpolymorphic and may bind to the V
2V
2 TCR such that the Ag contacts a relatively small portion of a germline encoded region of the TCR. In this way, amino acid differences in the CDR3 and in other CDRs would not affect fine Ag specificity.
The conservation of nonpeptide Ag recognition in primates suggests that this type of recognition plays an important role in primate immune systems. Like rhesus monkeys, reactivity to phosphoantigens is conserved in Aotus monkeys (46) and recognition of the B cell lymphoma, Daudi, is conserved in chimpanzees (52). Thus, both Old World (Catarrhini) and New World (Platyrrhini) monkeys that separated
60 million years ago, as well as higher primates (chimpanzees and humans), are able to recognize nonpeptide Ags.
We recently demonstrated that, unlike innate immune cells, V
2V
2+ T cells can mount adaptive immune responses in response to infection with M. bovis BCG (27). We now show that the majority of 
T cells from adolescent and adult rhesus monkeys from the New England Primate Center (Southborough, MA) express TCRs using V
1 (Fig. 1 and Table II). A similar predominance of V
1 T cells is seen in children before an environmentally driven expansion of V
2V
2+ T cells that occurs in most people between ages 3 and 10 (31). This expansion is presumably due to a common bacterial infection(s) that occurs in humans but that does not occur in the closed monkey colony. When the rhesus monkeys were infected with BCG, V
2V
2+ T cells expanded peaking at days 2030 post infection. Secondary infection with BCG lead to a rapid expansion (as early as 5 days) that peaked earlier and with higher numbers of cells (up to 2535% of all peripheral blood T cells). Accompanying this expansion of 
T cells in the blood were higher levels of V
2V
2+ T cells in the pulmonary alveoli and intestinal mucosa and higher levels of expansion in vitro to IPP and mycobacterial prenyl pyrophosphate Ags. Importantly, the expansion of V
2V
2+ T cells correlated with the clearance of BCG organisms from the blood. Moreover, when monkeys were vaccinated with BCG, they could survive aerosol infection with Mycobacterium tuberculosis that rapidly killed unvaccinated monkeys. Protection was associated with earlier increases in alveolar V
2V
2+ T cells as compared with naive animals.
The rapid expansion of V
2V
2+ T cells upon infection of rhesus monkeys is identical to that seen in many human bacterial and protozoal parasitic infections (reviewed in Ref. 1). This broad reactivity of V
2V
2+ T cells is likely due to their recognition of a common metabolic intermediate, HMBPP. HMBPP is an intermediate in the deoxyxylulose synthetic pathway for IPP (our unpublished data and Ref. 53) that is highly active. This pathway is found only in Eubacteria, Apicomplexan parasites, and the chloroplasts of plants. Thus, the presence of this Ag in the blood or tissue is a strong indication of an infection. Because almost all adult V
2V
2+ T cells respond to nonpeptide Ags, a remarkably high precursor frequency of 1 T cell in 20 to 1 in 50 can respond to the prenyl pyrophosphates and alkylamines produced by bacteria or parasites. This type of recognition shares great similarities with innate immune recognition (54, 55) and suggest that 
T cells are using their Ag receptors like pattern recognition receptors (1).
The advantage of this innate T cell recognition is the ability to focus T cell responses earlier in immune responses and more broadly than would be normally possible. Although the function of V
2V
2+ T cells is difficult to assess, V
2V
2+ T cells can kill infected cells and bacteria (22, 23) and secrete large amounts of TNF-
and IFN-
, two important type 1 cytokines (25, 56). Human V
2V
2+ T cells stimulated with nonpeptide Ags protect "humanized" SCID mice from several species of bacteria including Staphylococcus aureus, Morganella morganii, and Escherichia coli (26). V
2V
2+ T cells can recognize a potential nonpeptide Ag in B cell lymphomas (57, 58) suggesting a role for these cells in tumor immunity. V
2V
2+ T cells also express NK receptors (59, 60), including NKG-2D (61), that may allow V
2V
2+ T cells to play a similar role to NK cells in antitumor and antiviral immunity including immunity to HIV/SIV (43, 62, 63). Furthermore, although few Ags for murine 
T cells have been discovered, murine 
T cells are required for optimal protection from infection with several bacterial species including Klebsiella pneumoniae (64), M. tuberculosis (65), Listeria monocytogenes (66), and Nocardia asteroides (67). Murine 
T cells also decrease the severity of several autoimmune diseases (5) and inflammatory responses to infections (68, 69). Therefore, these studies suggest a role for 
T cells in immunity to infection, tumors, and in autoimmunity.
The development of an animal model for V
2V
2+ T cells would greatly help the development of nonpeptide Ag vaccines that target these cells for their broad antibacterial and antiparasitic effects. Mice, rats, rabbits, guinea pigs, and ruminants do not appear to recognize known nonpeptide Ags because there is no reactivity seen in direct testing and because none of these animal species have V genes homologous to primate V
2 or V
2 genes. Our results show that rhesus monkeys can serve as animal models to study all facets of nonpeptide Ag recognition and V
2V
2+ T cell function in vivo. Indeed, i.v. infusion of rhesus monkeys with the weak phosphoantigen diphosphoglycerate is reported to increase in vitro expansions and production of IFN-
and TNF-
by V
2V
2+ T cells upon IPP stimulation although this effect only persisted for 60 days (70). A more potent nonpeptide Ag vaccine that stimulates an adaptive V
2V
2+ T cell response could play an important role in a multicomponent vaccine for tuberculosis, leprosy, or anthrax infections or for protection from drug-resistant bacteria.
| Acknowledgments |
|---|
2V
2 TCR, G115. | Footnotes |
|---|
2 Current address: Laboratory of Development and Differentiation, Division of Functional Biology, Korea Research Institute of Bioscience and Biotechnology, Yusong, Daejeon, Korea. ![]()
3 Address correspondence and reprint requests to Dr. Craig T. Morita, Division of Rheumatology, Department of Internal Medicine and the Interdisciplinary Group in Immunology, University of Iowa College of Medicine, John W. Eckstein Medical Research Building 340F, Iowa City, IA 52242. E-mail address: Craig-Morita{at}uiowa.edu ![]()
4 Abbreviations used in this paper: BCG, bacillus Calmette-Guérin; SEA, staphylococcal enterotoxin A; CDR, complementarity-determining region; MEP, monoethyl phosphate; IPP, isopentenyl pyrophosphate; HMBPP, (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate; EPP, ethyl pyrophosphate. ![]()
Received for publication November 26, 2002. Accepted for publication January 31, 2003.
| References |
|---|
|
|
|---|

T cells: pattern recognition by the adaptive immune system. Springer Semin. Immunopathol. 22:191.[Medline]
1.1J
4C
4 transgenic mice. Nature 375:241.[Medline]

T cells in wound repair. Science 296:747.
T cells. Adv. Immunol. 71:77.[Medline]

T cells. J. Immunol. 157:5689.[Abstract]

T cells: implications for innate immunity. J. Exp. Med. 191:937.
T cells. Science 279:1737.
T cells. Proc. Natl. Acad. Sci. USA 91:8175.
T cells by nonpeptidic mycobacterial ligands. Science 264:267.
T cells. Nature 375:155.[Medline]
/
T-cell stimulation by pamidronate. N. Engl. J. Med. 340:737.
T cells by aminobisphosphonates and induction of antiplasma cell activity in multiple myeloma. Blood 96:384.
2V
2 T-cell receptor-mediated recognition of aminobisphosphonates. Blood 98:1616.
T cells recognize alkylamines derived from microbes, edible plants, and tea: implications for innate immunity. Immunity 11:57.[Medline]
2V
2 TCR-dependent recognition of non-peptide antigens and Daudi cells analyzed by TCR gene transfer. J. Immunol. 154:998.[Abstract]

T cells. Immunity 3:495.[Medline]
2/V
2 subset in human mycobacteria-responsive T cells suggests germline gene encoded recognition. J. Immunol. 147:3360.[Abstract]

T cells reactive to Mycobacterium tuberculosis are encoded by specific V genes but diverse V-J junctions. J. Immunol. 147:3353.[Abstract]
9V
2 T cells is triggered by Francisella tularensis-derived phosphoantigens in tularemia but not after tularemia vaccination. Infect. Immun. 66:2107.
T cells increases after the first week of onset of tularaemia and remains elevated for more than a year. Clin. Exp. Immunol. 120:280.[Medline]

T cells by monocytes infected with live Mycobacterium tuberculosis. J. Clin. Invest. 87:729.
9/V
2 T lymphocytes reduce the viability of intracellular Mycobacterium tuberculosis. Eur. J. Immunol. 30:1512.[Medline]
9V
2 T cells impair intracellular multiplication of Brucella suis in autologous monocytes through soluble factor release and contact-dependent cytotoxic effect. J. Immunol. 165:7133.
9/V
2 T lymphocytes. J. Infect. Dis. 184:1082.[Medline]

T cell responses to nonpeptide mycobacterial antigens. J. Immunol. 159:1328.[Abstract]
2V
2 T cells in vivo. J. Clin. Invest. 108:1349.[Medline]
2V
2+ T cells during mycobacterial infections. Science 295:2255.
T cells. J. Immunol. 167:36.
T cells: SEA recognition site for human V
2 T cell receptors. Immunity 14:331.[Medline]
/
T cells. Eur. J. Immunol. 21:2999.[Medline]
/
repertoire. J. Exp. Med. 171:1597.
T cells at birth. J. Immunol. 153:3979.[Abstract]

T cell repertoire and function in patients with pulmonary tuberculosis. J. Immunol. 157:4222.[Abstract]

T-cell antigen receptor. Nature 411:820.[Medline]
9-JP rearrangements in unstimulated human
/
T lymphocytes. Eur. J. Immunol. 22:2437.[Medline]
chain junctional region in prenyl pyrophosphate antigen recognition by 
T cells. J. Immunol. 161:286.
1.2 segment to the recognition of nonpeptide antigens by human 
T cells. J. Immunol. 167:6773.
T cells in rhesus monkeys and their response to simian immunodeficiency virus (SIV) infection. Clin. Exp. Immunol. 102:251.[Medline]
chain genes. Immunogenetics 35:75.[Medline]
2 TCR repertoire overlap in different anatomical compartments of healthy, unrelated rhesus macaques. J. Immunol. 166:2296.
9V
2 T cells in humans and Aotus monkeys, a primate infection model for Plasmodium falciparum malaria. J. Immunol. 167:6421.
subset. Eur. J. Immunol. 23:804.[Medline]

T cell receptor repertoire in blood and colonic mucosa of rhesus macaques. J. Med. Primatol. 29:387.[Medline]
-lactam antibiotics. J. Immunol. 157:1071.[Abstract]
/
: comparison of gene configurations and function between humans and chimpanzees. Immunogenetics 36:294.[Medline]

T cells in Escherichia coli. FEBS Lett. 509:317.[Medline]
9V
2 T cell broad cytotoxicity and TNF production by nonpeptidic mycobacterial ligands. J. Immunol. 154:5986.[Abstract]
9/V
2 T cells of a GroEL homolog on Daudi Burkitts lymphoma cells. Science 250:1269.
T cells induced by the tumour cell line RPMI 8226: functional heterogeneity of clonal populations and role of GroEL heat shock proteins. Scand. J. Immunol. 36:107.[Medline]

T cells expressing NK cell receptors. J. Immunol. 159:3723.[Abstract]
/
stimulated by nonpeptidic ligands. J. Exp. Med. 186:1769.
2V
2 T cells enhances their antigen-dependent effector function. Immunity 15:83.[Medline]
9V
2 T lymphocytes suppress in vitro human immunodeficiency virus type 1 replication by cell-released antiviral factors including CC chemokines. J. Infect. Dis. 180:858.[Medline]

T cells in generating antiviral factors and
-chemokines in protection against mucosal simian immunodeficiency virus infection. Eur. J. Immunol. 30:2245.[Medline]

-T cells are critical for survival and early proinflammatory cytokine gene expression during murine Klebsiella pneumonia. J. Immunol. 165:2643.
/
T cells and
/
T cells in tuberculosis. Eur. J. Immunol. 25:2877.[Medline]

and 
T cells in immunity against an intracellular bacterial pathogen. Nature 365:53.[Medline]

T lymphocytes. J. Immunol. 162:5033.
T cells cytotoxic for activated macrophages. J. Exp. Med. 191:2145.
/
T cells after infection with Listeria monocytogenes. Infect. Immun. 69:7213.
T cell priming to mycobacterial antigens by primary Mycobacterium tuberculosis infection and exposure to nonpeptidic ligands. Mol. Med. 5:471.[Medline]
subunit. Science 238:682.
/
detected on viable T cells by a monoclonal antibody. J. Exp. Med. 167:1625.
heterodimers. J. Biol. Chem. 268:15455.
/
recognize different subsets of CD3+WT31- T lymphocytes. Eur. J. Immunol. 19:57.[Medline]
/
+ peripheral lymphocyte subset: the V
1 gene segment is expressed with either C
or C
. J. Exp. Med. 171:1171.
/
T cell antigen receptor with a novel mitogenic anti-
antibody. J. Immunol. 141:1476.[Abstract]

T-cell receptor. Immunol. Rev. 120:137.[Medline]

TCR using a novel set of TCR
and
chain-specific monoclonal antibodies generated against soluble 
TCR: evidence for a specific conformation adopted by the J
2 region and for a V
1 polymorphism. J. Immunol. Methods 189:25.[Medline]
/
directly activates CD3+WT31- lymphocytes to express their functional program(s). J. Exp. Med. 168:1.
/
T cell receptor, the CD8 accessory molecule and preferentially uses the V
1 gene segment. Eur. J. Immunol. 21:1053.[Medline]
/
T cells. J. Exp. Med. 173:1311.
elements of the human 
T cell receptor: 23D12+ cells comprise a major subpopulation of 
T cells in postnatal thymus. J. Immunol. 152:3128.[Abstract]
repertoire by flow cytometry. Int. Immunol. 9:1065.
8 is a shared feature of human 
T cells in the epithelium of the gut and in the inflamed synovial tissue. J. Immunol. 152:6017.[Abstract]
complex. J. Exp. Med. 166:1192.
+ T cells. J. Immunol. 146:35.[Abstract]This article has been cited by other articles:
![]() |
H. Wei, D. Huang, X. Lai, M. Chen, W. Zhong, R. Wang, and Z. W. Chen Definition of APC Presentation of Phosphoantigen (E)-4-Hydroxy-3-methyl-but-2-enyl Pyrophosphate to V{gamma}2V{delta}2 TCR J. Immunol., October 1, 2008; 181(7): 4798 - 4806. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, L. Shao, Z. Ali, J. Cai, and Z. W. Chen NSOM/QD-based nanoscale immunofluorescence imaging of antigen-specific T-cell receptor responses during an in vivo clonal V{gamma}2V{delta}2 T-cell expansion Blood, April 15, 2008; 111(8): 4220 - 4232. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Holderness, L. Jackiw, E. Kimmel, H. Kerns, M. Radke, J. F. Hedges, C. Petrie, P. McCurley, P. M. Glee, A. Palecanda, et al. Select Plant Tannins Induce IL-2R{alpha} Up-Regulation and Augment Cell Division in {gamma}{delta} T Cells J. Immunol., November 15, 2007; 179(10): 6468 - 6478. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Casetti, G. Perretta, A. Taglioni, M. Mattei, V. Colizzi, F. Dieli, G. D'Offizi, M. Malkovsky, and F. Poccia Drug-Induced Expansion and Differentiation of V{gamma}9V{delta}2 T Cells In Vivo: The Role of Exogenous IL-2 J. Immunol., August 1, 2005; 175(3): 1593 - 1598. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Hedges, J. C. Graff, and M. A. Jutila Transcriptional Profiling of {gamma}{delta} T Cells J. Immunol., November 15, 2003; 171(10): 4959 - 4964. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |