HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nam, B.-H. Articles by Aoki, T. Search for Related Content PubMed PubMed Citation Articles by Nam, B.-H. Articles by Aoki, T.

The Four TCR Genes of Teleost Fish: The cDNA and Genomic DNA Analysis of Japanese Flounder (Paralichthys olivaceus) TCR -, -, -, and -Chains¹

Department of Aquatic Biosciences, Tokyo University of Fisheries, Minato, Tokyo, Japan

	Abstract

Top Abstract Introduction Materials and Methods Results and Discussion References

 
We have isolated and identified all four TCR , , , and cDNAs and genomic clones from a Japanese flounder leukocyte cDNA library and bacterial artificial chromosomal genomic library. Numerous TCR transcripts were sequenced to examine the variability against antigenic peptide, and were shown hypervariability on their complementarity-determining region 3 (CDR3) loops. Among CDR3s, CDR3 showed a long and broad length distribution, indicating greater similarity to that of Ig. From cDNA sequences and genomic gene analysis of each chain, we found that flounder TCR , , and have two different C gene segments, while the TCR C region exists as a single segment. The flounder Cs and Cs showed different lengths in the connecting peptide (CP) region between the different types of polypeptides. The C1 gene consists of two exons, one that encodes an extracellular Ig-like domain (exon 1) and the other that encodes either a very short or possibly a lacking CP region, a transmembrane region, and a cytoplasmic tail (exon 2); these are located within TCR gene locus. Southern blot analysis, using the bacterial artificial chromosomal genomic DNA clones, revealed that the C2 gene segment, which has a long CP region and different genomic organization to the C1 gene, exists on same gene locus as the TCR -chain. This suggests that the flounder possesses very unique genomic DNA organization and gene loci for TCR, C/C1, and C/C2.

	Introduction

Top Abstract Introduction Materials and Methods Results and Discussion References

 
T cells play important regulatory roles in the immune responses of all jawed vertebrates. In mammals, TCRs are heterodimeric, consisting of either / or / polypeptide combinations. The T cells are activated when the heterodimer TCR or a TCR, on the surface of a T cell, specifically recognizes an externally presented Ag, in conjunction with the CD3 receptor complex.

There is extensive information on TCR, and their Ag-recognition processes, structure, and genetics; this is due to the fact that T cells comprise 90% of PBLs of humans (1, 2). The second class of T cells, termed T cells, is less well understood, as only 1–10% of human T cells express TCR (1, 2). Nonetheless, in various human tissues (gut, reproductive, and mucosal epithelia) or in the peripheral blood of ungulates, the T cells may comprise one-half of the T cell population (2). Thus, T cells are expected to have a fundamentally different role and function from that of T cells, as they do not recognize MHC-associated peptide Ags, and are therefore not MHC restricted. Moreover, TCRs appear to recognize Ags in a manner similar to the direct Ag recognition processes of Igs, and therefore do not require specialized Ag presentation, as do T cells (3, 4).

The structure and expression of genes encoding molecules homologous to mammalian TCR have been identified from almost all vertebrate classes, including birds (5, 6, 7, 8), amphibians (9, 10, 11), teleosts (12, 13, 14, 15, 16, 17, 18, 19), and elasmobranches (14, 21, 22). However, TCR homologues have not been identified in teleosts. Even though, the molecular structure of TCR proteins, presumed from their cDNA sequences, is very well conserved in all vertebrates, although there is very little information on the genomic organization and the genetic loci that encode the TCR molecules in primitive vertebrates. The organization of TCR -chain locus has been analyzed in the horned shark (22) and the rainbow trout (23), while the TCR locus in Japanese puffer fish (Takifugu rubripes) was characterized by the C gene-containing cosmid clone (15). In humans (24) and mice (25), the TCR locus was found to be located within the locus. However, in puffer fish (15), the locus could not be identified due to the lack of data on other TCR cDNA or genomic DNA (gDNA).³ Recently, the TCR locus of Tetradon nigroviridis has been completely sequenced from a bacterial artificial chromosome (BAC) clone, from within which the TCR locus was discovered (16). However, the genomic organization found in the T. nigroviridis TCR / locus differs from that which has been observed in mammals and birds. The genomic organization of / locus, in which locus is inserted between V and J gene segments of -chain, is conserved in mammals and birds; however, in T. nigroviridis, the locus follows the locus. Furthermore, the size of the / locus of T. nigroviridis is much smaller (<30 kb in length) than that of other vertebrates. It is suggested that cold-blooded vertebrates may have the different and ancestral genomic organization for the expression of all TCR chains; this therefore could provide clues to explain the evolution of Ag receptor genes in all vertebrates.

The aim of this study therefore is the complete sequencing of all teleost TCR genes: , , , and , from a PBL cDNA library and a BAC gDNA library. This will provide important key information for the understanding of fish immune system and evolutionary relationships of TCRs in vertebrates.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results and Discussion References

 
RNA preparation, PCR amplification, cDNA library screening, and sequencing

The general PCR-priming strategy was used for the flounder TCR -, -, and -chains, except -chain gene. TCR cDNA was identified from the analysis of expressed sequence tags (ESTs) of flounder PBL cDNA library (26). Total RNA was prepared from PBLs by TRIzol (Life Technologies, NY). The first stranded cDNA was synthesized by an oligo(dT)12–18 primer. Degenerate primers designed by Rast and Litman (22) corresponding to conserved framework region 2 (FR2) (forward) and FR3 (reverse) residues were used to produce the flounder TCR , , and V regions (Table I). PCR was performed with a denaturation step of 30 s at 95°C, an annealing step for 1 min at 45°C, and an extension step for 1 min at 72°C for 30 cycles in 30 µl of reaction mixture containing 100 ng of PBL cDNA or gDNA, 0.5 µM of each primer, 20 µM dNTP, and Taq DNA polymerase in PCR buffer. The PCR products were purified, cloned into pGEM-T Easy vector (Promega, Madison, WI), and sequenced. The identity of PCR product was analyzed using the BLASTX program in GenBank. The PCR products exhibiting the highest identities with TCRs were chosen as probes to screen the PBL cDNA library (26). Approximately 1 x 10⁶ clones of flounder PBL cDNA library were screened separately with the random prime-labeled putative TCR V probes. The recombinant plasmids isolated from the cDNA library were sequenced on both strands with universal M13 forward and reverse primers.

A flounder genomic BAC library (27) was screened for TCR , , , and individually with specific PCR-derived probes from the TCR C region. The oligonucleotide sequences used in this study are given in Table I. High-density replica filters, containing 49,152 BAC clones, with an average insert size of 165 kb, were hybridized, as previously reported (27). The flounder TCR genomic BAC clones were purified and used for Southern blot and genomic organization analyses of TCRs.

Southern blot hybridization

Approximately 5 µg of BAC DNA and 10 µg of erythrocyte gDNA were digested to completion using restriction enzymes, BamHI, EcoRI, HindIII, PstI, and KpnI, separated by pulse-field electrophoresis, and transferred to Hybond-N⁺ membranes (Amersham Pharmacia Biotech, Piscataway, NJ) by a standard protocol (28). The filters were hybridized in QuikHyb hybridization solution, according to the instruction of the manufacturer (Stratagene, La Jolla, CA), individually with PCR-derived probes that encompassed the C region of flounder TCRs.

Phylogenetic analysis

The amino acid sequences of the four TCR C regions for all reported species were retrieved from GenBank, and aligned using the CLUSTALW program (29). Phylogenetic analysis was based on the use of genetic distance matrices and the neighbor-joining method (30). The phylogenetic trees were calculated using the PHYLIP (version 3.57c) programs PROTDIST and NEIGHBOR, and were calculated based on a bootstrap of 100 separate genetic distance matrices.

	Results and Discussion

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Primary structures of flounder TCRs

-Chain. The primary PCR analysis used against the flounder gDNA template, with degenerate primer set 1 complementary for FR2 and FR3, produced a 800-bp PCR product band, 600 bp over what was expected. The PCR product showed 83% partial nucleotide identity with the rainbow trout TCR V1 chain region, and thus was named gJF; this fragment was found to contain two V segments separated by a 297-nt intron (AB053229). The gJF fragment was used as a probe to isolate the full-length cDNA of TCR -chain from the flounder PBL cDNA library. One positive clone with a 2.2-kb insert was selected for further sequence analysis; this TCR cDNA clone (JFTCR-1) revealed 735 nt of 5' untranslated region, 727 nt of 3' untranslated region, and an open reading frame (ORF) of 269 aa encoded by 807 bp (AB054227). V segments, including the leader peptide sequenced in this study, were aligned and compared with other V segments (Fig. 1, A and B). The flounder V1 exhibited a 57% amino acid identity with the puffer fish Sphoeroides nephelus TCR V region (U22677; designated p.f.V.). Several important amino acid residues of TCR are conserved well in the V1 (G¹⁶, W⁴³, D⁹⁸, A¹⁰⁰, Y¹⁰², and C¹⁰⁴), although C²³ is not found to be conserved. In the flounder V1 and puffer fish Sn191 clone, the first cysteine residue that participates in an internal disulfide bond with C¹⁰⁴ in V chain is found at position 3 (Fig. 1A). The puffer fish Sn191 clone was considered to be a pseudogene, due to the fact that the original analysis was conducted on gDNA. Nevertheless, the flounder V1 is believed to be a functional gene because it has been isolated from a cDNA library and RT-PCR strategy. The V2 group, which was identified by 5' RACE of the TCR , shows conservation of the cysteine residue at position 23, and shows 37.7% amino acid identity with the rainbow trout TCR V (U50991; designated r.t.V in Fig. 1B). The flounder V2.1 exhibits the same leader peptide sequence as that of flounder V; this shows 34.8% amino acid identity between V2.1 and V gene segments (Fig. 1B).

View larger version (34K): [in this window] [in a new window]   FIGURE 1. Alignment of deduced amino acid sequences of TCR V regions. Amino acids are indicated by single-character code. Residues identical with the top sequence are denoted by dots, and spaces introduced to optimize similarity between the aligned sequences are indicated by hyphens. Importantly, conserved amino acid residues are boxed. Percentages of identity between sequences are indicated on the right column. A, Alignment of the TCR -chain V1 group amino acid sequences with closest V of other species. The leader peptide was predicted by the PSORT program (http://psort.nibb.ac.jp) and is indicated thick line above the sequences. B, Alignment of the V2 and V amino acid sequences with each closest V and V of other species. The common leader peptide sequence of the flounder V2 and V is indicated by dotted box. C, Alignment of the V1 and V2 of flounder with each closest V of other species. D, Alignment of the flounder V with closest V of other species. E, Alignment of the flounder V with closest V of other species.

View larger version (82K): [in this window] [in a new window]   FIGURE 2. Alignment of deduced amino acid sequence of TCR C regions, C (A), C (B), C (C), and C (D). Amino acids are indicated by single-character code. Residues identical with the top sequence are denoted by dots, and spaces introduced to optimize similarity between the aligned sequences are indicated by hyphens. Above the sequences are indicated the different regions of C region. A potential N-glycosylation site is boxed. Below the sequences, amino acids conserved in all sequences are indicated by asterisk (*). The numbering of sequences is limited in the C region. The dotted box indicates the core amino acid sequences to form the TCR / heterodimer in B, and repeat sequences on the CP regions in C and D.

-Chain.

The flounder TCR has two C region genes, C1 and C2, which are 179 and 172 aa long, respectively (Fig. 2B). The two flounder C1 and C2 amino acid sequences have 93% identity; however, the sequence analysis of 3' untranslated region of the C1 and C2 transcripts showed completely different nucleotide sequences, thus suggesting the presence of two types of C genes. The flounder Cs vary in the Ig-C domain between the two cysteines that form the disulfide bond. A total of additional 16 aa were found in flounder C1, and additional 11 aa in the flounder C2, within which the putative N-glycosylation sites (NVT and NVT) were identified (Fig. 2B). Two cysteine residues for the intrachain disulfide bond are very well conserved, although a free cysteine residue is found at position 21 in teleost fish. The cysteine residues found in the CP region form an interchain disulfide bond with its counterpart in the TCR C; this is lacking in the CP region of flounder and all other reported teleost TCR C (reviewed in Ref. 33).

It has been recently revealed that a disulfide bond between the TCR - and -chains is not required for / heterodimerization or TM signaling transduction of TCR /-CD3 complexes (34, 35). Arnaud et al. (35) demonstrated that the conserved amino acid motif, Y-(C)-(L)-(S)-S-R-L-R-(V)-(S)-(A), in the Ig-C domain appears to be required to form the TCR / heterodimer. This motif, the S^89c-R^90c-L^91c sequence, is strictly conserved in all vertebrates, including flounder (Fig. 2B). This core sequence is probably involved in the formation of the TCR / heterodimer.

-Chain. TCR is the last TCR chain identified by PCR analysis for the flounder. The Ig superfamily V region was amplified with the degenerate primer set 1 or 2 (Table I) from the PBL first-stranded cDNA. An 200-bp PCR product was inserted into T-vector, sequenced, and analyzed by Blast search; most fragments showed significant homology with V region of TCR and Ig. Among them, clone Ig superfamily-1 showed 31% amino acid identity with the mouse TCR V (M54996); this insert was used as a probe to screen the flounder PBL cDNA library. For elimination of other TCR and Ig molecules, we conducted PCR against the first positively hybridized clones with the C region-specific primer sets (Table I) of TCR , , , and IgM and D, previously identified from flounder (26); 23 negatively selected candidates of flounder TCR -chain were sequenced. Most cDNA clones revealed similarity to the V region of Ig L chains, especially -chain. Among them, cDNA clone 9-4-2 (AB076071), consisting of 1146 bp with an ORF of 333 aa and flanked by a short 3' untranslated region of 114 nt, showed 43% similarity to the skate TCR -chain (U75771) through J-C regions. The flounder V sequence shows 32.2% amino acid identity with the skate V (Fig. 1D). We designed flounder TCR -chain-specific primers based on the 9-4-2 cDNA clone sequence (Table I.) and conducted RT-PCR. The flounder TCR cDNA clones derived from RT-PCR were sequenced, and their deduced amino acid sequences were compared. The isolated clones could be divided into two groups based on sequence identity of the terminal part of C region. The deduced amino acid sequences of the two types of flounder C have 93.5% amino acid identity overall, reflecting the high homology within the assumed Ig-C domain, as well as within the membrane-proximal and the TM region; however, they differ within the CP region (Fig. 2C). The deduced amino acid sequence of C1 (182 aa) is 3 aa residues shorter than that of C2 (185 aa). When aligned to mammalian and other nonmammalian TCR C sequences (7, 21, 36), the flounder C sequences show only limited amino acid sequence similarities (Fig. 2C). The C^30c and C^90c of the Ig-C domain are well conserved through all species reported. The tryptophan located 14 residues downstream to the first C^30c is conserved in all species; however, the tryptophan located 14 positions upstream from the C^90c is not conserved in skate and flounder (Fig. 2C).

As in other species, the flounder C sequences include numerous basic (R, L, H) and acidic (D, E) residues, and may interact strongly with other chains in the TCR/CD3-equivalent complex. The flounder Cs was shown to have different lengths within the CP region, with C2 having an additional 5 aa; moreover, mammalian C chains are shown to differ most obviously in their CP region. Human TCR studies show that the diversity in the CP region between C1 and C2 has arisen by duplication or triplication of the encoding gene segment, with mutation at the cysteine residue (37, 38). This may also have occurred in sheep (39), cow (40), and pig (41) C chains; however, the chicken TCR locus contains only one C gene (7). The flounder C includes the repeated sequences of T-P-S in the assumed CP; this generates the differences in length between the flounder C1 and C2 (Fig. 2C).

-Chain. The flounder TCR -chain was isolated originally as an EST clone (AU057960) from a PBL cDNA library of flounder infected with hirame rhabdovirus (26). The sequence of the cDNA showed 28.4% overall identity at the amino acid level with the skate TCR -chain (U75770), and V-D-J partial sequence had 35% amino acid identical with the sheep TCR V-D-J region (S36301). The flounder TCR -chain (AB076073) contained 972 bp, consisting of an ORF of 260 aa flanked by 83 nt of 5' UTR and 106 nt of 3' untranslated region. Flounder V is found to contain the conserved residues characteristic of TCR/Ig V regions and shows amino acid identities with the sheep V of 34% and skate V of 34.8% (Fig. 1E).

The flounder has two putative D core sequences, GGCTGG and GGGACT, which are predicted by an in-frame glycine codon (data not shown). Of 47 TCR -chain cDNAs examined, 17 cDNA clones were found to have both core sequences, suggesting a V-D-D-J-C structure; however, 7 cDNA clones were found to only have GGCTGG, while another 6 clones only contained GGGACT, thus suggesting a V-D-J-C structure. The remaining 17 cDNA clones do not show putative D core sequences. All of the flounder TCR cDNA sequences in this study do not possess the J segment core consensus sequence (F-G-X-G) that is found in nearly all TCR and Ig L chain J segments (42). The flounder TCR codes noncorresponding amino acid sequences, I-G-E-A at the J sequence motif.

Subsequent experimental analysis by RT-PCR revealed an alternate sequence of TCR that was 100 bp longer on C region than previous C identified from EST analysis. This larger 450-bp PCR fragment showed 84 and 100% respective amino acid identities in the Ig-C domain and the TM and cytoplasmic tail (CYT) regions of the first C (C1); this was considered to be the second type of flounder C (C2). The flounder C1 (118 aa) and C2 (150 aa) also show differences in length in their CP region; these two chains showed 73.3% overall amino acid identity. In contrast, C1 lacks a CP region between the Ig-C domain and TM region, while C2 contains 18 aa residues in the putative CP region. The flounder C2 includes a repeat element, (A/T)DS(C/H)D(N/D)X(H/N)S, in the CP region (Fig. 2D).

Complementarity-determining region 3 (CDR3) loops of flounder TCRs

V regions of TCR and Ig are divided into framework regions (FR) and CDR. An x-ray crystallography study has revealed the interaction between the TCR and the peptide-MHC assemblage (43). The CDR1 and CDR2 appear to be in contact with the MHC helices and the ends of the peptide located in its peptide-binding groove. CDR1 and CDR2 are encoded within the V gene segment itself, and show limited diversity, whereas the CDR3 occurs at the V-(D)-J junction of TCRs. Therefore, the CDR3 is the hypervariable loop, conferring epitope-specific sensitivity to the TCR.

The CDR3 loop is defined as the segment from the 3' end of the V gene segment and the J segment motif, F-G-X-G (44), and made up by V, D (only TCR and ), and J segments together with added N region. We analyzed the V-(D)-J junction region of TCR , , , and to investigate the properties of CDR3 loops of the flounder TCR chain; this included the deduced amino acid sequence analysis of V-(D)-J junction region of TCR (50 transcripts), (37 transcripts), (35 transcripts), and (47 transcripts).

The deduced amino acid sequences of CDR3 loops assessed in this study are shown in Table II. Although the flounder TCR , , , and showed very different sequences and lengths in their CDR3 loops, some sequences are repeated, especially in CDR3 loops. Among 35 TCR cDNA clones, 9 different sequences were repeated, either twice or three times (Table II); however, in TCR , , and , only 1 or 2 CDR3 sequences were found to be repeated. The distribution of the CDR3 loop length of TCR -, -, -, and -chain was assessed. For TCR chains, the length of the CDR3 loops varied from 7 to 15 aa residues, with average 11.2 residues. In TCR, CDR3 are short with a length distribution, 5–10 aa residues (average 8.49 residues), while the CDR3 loops are long with a length distribution from 9 to 17 aa residues (average 13.3 residues).

Hydrophobic amino acids (L, V, A) are found to predominate at position 1, whereas at position 2 there are many polar (Q, N, S, T) and charged (D, E, R, K, H) amino acids (Table II). Additionally, glycine (G) residue providing polypeptide flexibility was detected in the middle of the CDR3 loops of TCR , , , and . Many V family members appear to encode a glycine-containing -turn; such a turn can serve to position the amino acid side chains of hypervariable CDR3 loops with respect to the Ag-binding groove of the MHC molecules (46, 47, 48). Another feature of the flounder CDR3 is the position of proline (P) residue. The presence of a glycine residue confers greater than normal flexibility on the CDR3 loops; however, a proline residue has the converse effect, that of reducing flexibility. In flounder CDR3, the proline residues are found at the N terminus, whereas in CDR3, it is found mainly at the C terminus (Table II); it is therefore hypothesized that TCR - and -chain CDR3 loops are fixed in different orientations when they bind to antigenic peptides.

gDNA organization and gene loci of the flounder TCRs

We investigated the genomic organization of TCR with BAC clones. Four TCR C region fragments, derived from the flounder TCR cDNAs (C-, C-, C-, and C-specific probes), were used to screen the flounder genomic BAC library. Two C-positive clones (26-L-24 and 83-L-6) and four C-positive clones (4-A-8, 34-C-11, 52-E-22, and 85-A-15) were isolated from the BAC library. Interestingly, the C- and C-specific probes were hybridized to the same BAC clones: 15-I-15, 54-E-19, and 88-G-17; therefore, it means that the flounder TCR and genes are located on the same gene locus. To confirm the presence of TCR C regions in each positive BAC clone, we performed Southern blot hybridization and PCR with TCR C region-specific probes or primers, and from which the C region sequences of each TCR chain were analyzed.

Flounder gDNA and BAC26-L-24 were digested by four restriction enzymes (BamHI, EcoRI, HindIII, and PstI), and hybridized with a C-specific probe. As shown in Fig. 3, A and B, the hybridization pattern of the C-specific probe is consistent on the gDNA and BAC26-L-24. Sequence analysis revealed the flounder C to span 1.1 kb. The flounder C gene consists of three exons: an Ig-C domain (exon 1), the CP region (exon 2), followed by the TM region with a short CYT (exon 3) (AB081557).

View larger version (62K): [in this window] [in a new window]   FIGURE 3. Southern blot analysis of the flounder genomic and BAC DNA with the flounder TCR C-specific probes, C (A, B, and E), C (C), C (D), and C (F and G). The flounder TCR C-positive BAC clones (5 µg) and erythrocyte gDNA (10 µg) were digested with various restriction enzymes, BamHI (B), EcoRI (E), HindIII (H), PstI (P), and KpnI (K), separated by pulse-field electrophoresis on 1.0% agarose gels, and transferred to Hybond-N+ membranes. The membranes were hybridized with 32P-labeled probes for the flounder TCR V or C genes. The BAC clone numbers used for analysis are indicated below each picture. /HindIII size marker (sizes in kilobases) is indicated in the right margins.

From the BAC library screening with C1 DNA fragment as a probe, three positive BAC clones (15-I-15, 54-E-19, and 88-G-17) were isolated and subsequently analyzed. We conducted Southern blot hybridization and PCR with BAC88-G-17 and confirmed that C1 and C2 were located on the same gene locus. The results of Southern blot hybridization showed multiple bands on BamHI-, EcoRI-, HindIII-, and PstI-digested BAC88-G-17 clone (Fig. 3D). From the sequencing results of flounder C gDNA, C1 (AB081560) has one cut site for EcoRI, HindIII, and PstI, while C2 (AB081561) has one cut site for HindIII and PstI, and two cut sites for EcoRI. These enzyme cut sites are located on the intron between exons 1 and 2. The genomic organization of flounder Cs consists of two exons: exon 1 of C encodes the Ig-C domain, and exon 2 encodes the remaining regions, the CP, TM, and CYT regions without an independent exon for CP region.

Interestingly, the isolated C-positive BAC clones were identical with those of the C-positive BAC clones, 15-I-15, 54-E-19, and 88-G-17, thus suggesting that C and C genes are linked on the same gene locus. However, it is known that the TCR locus is inserted into the middle of the TCR locus in several reported vertebrates (8, 15, 16, 24, 25). Southern blot analysis was applied to investigate a relationship of TCR gene locus with TCR or TCR gene locus. BAC26-L-24 clone (C) and BAC88-G-17 clone (C and C) were digested with four different restriction enzymes, BamHI, EcoRI, HindIII, and PstI, and were analyzed by the C- and C-specific probes, individually. The C-specific probe revealed specific band on only BAC26-L-24 (Fig. 3E); however, the C-specific probe hybridized on two of both BAC clones, showing different hybridization patterns on BAC26-L-24 and 88-G-17 (Fig. 3F), thus suggesting that the C gene exists as two or more copies and is located on the different gene locus: one is on TCR locus, and the other is on TCR locus.

We then tested genomic organization of TCR / locus with the Southern blot hybridization of BAC88-G-17. BAC88-G-17 was restricted single and double digestion. The combination for the double digestion is as follows: KpnI/BamHI, KpnI/HindIII, KpnI/PstI (Fig. 3H); NotI/KpnI, NotI/XhoI (Fig. 3I); BamHI/EcoRI, EcoRI/HindIII, HindIII/PstI, PstI/BamHI (Fig. 3J). The KpnI digestion generated two fragments of 25 and 23 kb, respectively. Both fragments contain the V, C, and C fragments (Fig. 3H) and appear to have very similar structure (Fig. 4B). Therefore, we speculate that one of two fragments is a primitive linkage unit and it duplicated to generate the other linkage unit. Fig. 4B illustrates our proposed genomic organization for the TCR and TCR 2 locus.

View larger version (18K): [in this window] [in a new window]   FIGURE 4. Schematic illustration of the flounder TCR loci and C gene organization (not to scale). Relevant restriction enzyme sites are indicated. A, Schematic illustration of the flounder TCR C/C1 locus. The diagram does not accurately reflect the number of V and J and the location of C1. B, Schematic illustration of the flounder C2 locus.

The 4.9 kb of DNA fragment derived from BAC26-L-24 clone included one J and Cl. C1 consists of two exons, within which exon 1 encoded the Ig-C domain and exon 2 encoded TM and CYT. The flounder C1 and T. nigroviridis C show the same genomic organization, which consists of two exons and one intron; as such the T. nigroviridis C also probably lacks the CP or is a short form (16). The flounder J segment, located at 900 bp downstream of C exon 1, encodes one J segment possessing I-G-E-A instead of F-G-X-G, as mentioned previously in the primary structure of -chain. The flounder J gene segment is flanked by a 5' DNA recombination signal (GGTTTTTGT-12-bp spacer-CACTGTG) and a 3' RNA splicing site (MAGGTRAG, in which M = A or C and R = A or G). The C2 was found to consist of 5 exons, in which exons 1 and 5 encode the same regions of exons 1 and 2 of C1, respectively. The additional exons 2, 3, and 4 encode 9 aa residues in each exon, confirmed by cDNA sequencing analysis, which represents the 27-aa CP region. The flounder C2 gene was found to exist as two copies, which demonstrates the polymorphism within the second intron, caused by the repeat sequence of CTGTTCCAAACTTTTAAAAA, the intron size being 630 and 811 bp.

Phylogenetic analysis

The phylogenetic analysis of the amino acid sequences of known C, C, C, and C reveals that all flounder TCR C genes conform to other sequences by clustering with their respective groups (Fig. 5). Subclusters within the C and C groups show that the flounder genes are closely related to those of other teleosts reported. Within the C and C clusters, the flounder genes are closely related with elasmobranch genes, although this analysis will be improved with the availability of further teleost sequences.

View larger version (35K): [in this window] [in a new window]   FIGURE 5. Phylogenetic analysis of TCR C region genes. TCR C sequences used in the analysis: catfish Ictalurus punctatus (U58505), Atlantic cod G. morhua L. (AJ133845), rainbow trout Oncorrhynchus mykiss (U50991), pufferfish Sphaeroides nephelus (U22676), skate R. eglanteria (U75768), axolotl Ambystoma mexicanum (U50992), chicken Gallus gallus (U04611), rabbit Oryctolagus cuniculus (M12885), cow Bos taurus (D10394), mouse Mus musculus (X14387), human Homo sapiens (X02592). TCR C sequences used in the analysis: catfish I. punctatus (U39193), rainbow trout O. mykiss (U18122), Atlantic cod G. morhua L (AJ133848), Atlantic salmon Salmo salar (X97435), horned shark Heterodontus francisci (U07624), skate R. eglanteria (U75769), axolotl A. mexicanum (X70168), frog Xenopus labeis (U60424), chicken G. gallus (M37800), cow B. taurus (D90140), rabbit O. cuniculus (M13895), dog Canis familiaris (D16409), mouse M. musculus (M11456), human H. sapiens (M12886). TCR C sequences used in the analysis: skate R. eglanteria (U75771), chicken G. gallus (U22666), rat Rattus norvegicus (S75435), mouse M. musculus (M54996), human H. sapiens (Y00796). TCR C sequences used in the analysis: skate R. eglanteria (U75770), horned shark H. francisci (U22673), chicken G. gallus (AF175433), sheep Ovis aries (AJ290087), rat Rattus norvegicus (AJ249228), mouse M. musculus (B26945), human H. sapiens (M21624).

Recently, the genomic organization of the TCR / locus and the transcription of TCR and TCR have been reported for T. nigroviridis (16). The TCR / locus of T. nigroviridis was determined to link <30 kb in length with overlapping of two BAC clones, BAC A (74.861 kb) and BAC K (20.268 kb). This result corresponds to our analysis of C1, as demonstrated by Southern blot hybridization and sequence analysis in which the gDNA organization of the flounder C1 is similar to that of the T. nigroviridis C. However, we found the C2 isotype from cDNA analysis and determined, by BAC gDNA analysis, that it is located at a different gene locus. The flounder C1 and C2 show significant identity on the Ig-C domain, TM and CYT, although these two molecules show different molecular sizes, caused by presence of the 27-aa CP region in C2. Flounder C1 was found to share the gene locus with C, which is previously reported, while C2 exists on the C gene locus. This result is not consistent with genomic organization of other reported vertebrates; further analysis of other teleost species is required to confirm this finding. In mammals, the TCR locus was discovered during studies on the TCR gene locus as the TCR locus is inserted between the V and the J region of the TCR locus (49). The TCR C and C of humans and mice are contained within 97.6 and 94.6 kb of contiguous sequences, respectively, in which the expression of the TCR locus is conditioned by the excision of the entire TCR locus. In the skate, however, when gDNA is separated using pulse-field gel electrophoresis, the two probes hybridize to one band of 600 kb in NotI digests, and this pattern cannot be resolved under several experimental conditions (21). It implies that C and C of skate are located in larger linkage distance than mammals.

Moreover, two TCR -like genes that have very high homology to each other have been identified in the horned shark (21). It is conceivable that these genes could either be a second TCR C or be representative of another type; this conception can now be resolved, as the presence of two types, C1 and C2, has been identified in a teleost fish, flounder. Presently, fish immunology is forced to make assumptions and provide explanations by making comparisons with mammalian immunology. Although certain aspects of the fish immune system have been found to be highly conserved with their mammalian counterparts, it still remains difficult to interpret and clearly explain fish immunology through the application of assumptions based on the mammalian immune system. Further analysis is therefore specifically required of the fish immune system to establish in its own right the functions and characteristics, which in turn will provide a clear understanding of evolutionary immunology. It still remains that we have to speculate to explain, from the standpoint of fish immunology, the unique characteristics that are found in fish, e.g., the existence of the /1 locus and /2 locus. This will only be resolved with further study; such studies would provide the significant answers to the understanding of the evolution of Ag receptors of vertebrates.

	Footnotes

 
¹ This study was supported in part by a grant from the Research for the Future Program of the Japan Society for the Promotion of Science (JSPS-RFTF97L00902); Grants-in-Aid for Scientific Research (A) from the Ministry of Education, Science, Sports, and Culture of Japan; and Research Grant of the Japan Society for the Promotion of Science.

² Address correspondence and reprint requests to Dr. Takashi Aoki, Department of Aquatic Biosciences, Tokyo University of Fisheries, Konan 4-5-7, Minato, Tokyo 108-8477, Japan. E-mail address: aoki{at}tokyo-u-fish.ac.jp

³ Abbreviations used in this paper: gDNA, genomic DNA; BAC, bacterial artificial chromosome; CDR, complementarity-determining region; CP, connecting peptide; CYT, cytoplasmic tail; EST, expressed sequence tag; FR, framework region; ORF, open reading frame; TM, transmembrane.

Received for publication May 30, 2002. Accepted for publication January 6, 2003.

	References

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1. Haas, W., P. Pereira, S. Tonegawa. 1993. / Cells. Annu. Rev. Immunol. 11:637.[Medline]
2. Kronenberg, M.. 1994. Antigens recognized by T cells. Curr. Opin. Immunol. 6:64.[Medline]
3. Chien, Y.-H., R. Jores, M. P. Crowley. 1996. Recognition by / T cells. Annu. Rev. Immunol. 14:511.[Medline]
4. Hayday, A. C.. 2000. Cells: a right time and a right place for a conserved third way of protection. Annu. Rev. Immunol. 18:975.[Medline]
5. Gobel, T. W. F., C.-L. H. Chen, J. Lahti, T. Kubota, C.-L. Kuo, R. Aebersold, L. Hood, M. D. Cooper. 1994. Identification of T-cell receptor -chain genes in the chicken. Proc. Natl. Acad. Sci. USA 91:1094.[Abstract/Free Full Text]
6. Tjoelker, L. W., L. M. Carlson, K. Lee, J. Lahti, W. T. McCormack, J. M. Leiden, C.-L. H. Chen, M. D. Cooper, C. B. Thompson. 1990. Evolutionary conservation of antigen recognition: the chicken T-cell receptor chain. Proc. Natl. Acad. Sci. USA 87:7856.[Abstract/Free Full Text]
7. Six, A., J. P. Rast, W. T. McCormack, D. Dunon, D. Courtois, Y. Li, C.-L. H. Chen, M. D. Cooper. 1996. Characterization of avian T-cell receptor genes. Proc. Natl. Acad. Sci. USA 93:15329.[Abstract/Free Full Text]
8. Kubota, T., J.-Y. Wang, T. W. F. Gobel, R. D. Hockett, M. D. Cooper, C.-L. H. Chen. 1999. Characterization of an avian (Gallus gallus domesticus) TCR gene locus. J. Immunol. 163:3858.[Abstract/Free Full Text]
9. Fellah, J. S., F. Kerfourn, F. Guillet, J. Charlemagne. 1993. Conserved structure of amphibian T-cell antigen receptor chain. Proc. Natl. Acad. Sci. USA 90:6811.[Abstract/Free Full Text]
10. Chretien, I., A. Marcuz, J. Fellah, J. Charlemagne, L. Du Pasquier. 1997. The T cell receptor genes of Xenopus. Eur. J. Immunol. 27:763.[Medline]
11. Haire, R. N., M. K. K. Haindfield, J. B. Turpen, G. W. Litman. 2002. Structure and diversity of T-lymphocyte antigen receptors and in Xenopus. Immunogenetics 54:431.[Medline]
12. Partula, S., A. de Guerra, J. S. Fellah, J. Charlemagne. 1995. Structure and diversity of the T cell antigen receptor -chain in a teleost fish. J. Immunol. 155:699.[Abstract]
13. Partula, S., A. de Guerra, J. S. Fellah, J. Charlemagne. 1996. Structure and diversity of the TCR -chain in a teleost fish. J. Immunol. 157:207.[Abstract]
14. Rast, J. P., R. N. Haire, R. T. Litman, S. Pross, G. W. Litman. 1995. Identification and characterization of T-cell antigen receptor-related genes in phylogenetically diverse vertebrate species. Immunogenetics 42:204.[Medline]
15. Wang, K., L. Gan, T. Kunisada, I. Lee, H. Yamagishi, L. Hood. 2001. Characterization of the Japanese pufferfish (Takifugu rubripes) T-cell receptor locus reveals a unique genomic organization. Immunogenetics 53:31.[Medline]
16. Fischer, C., L. Bouneau, C. Ozouf-Costaz, T. Crnogorac-Jurcevic, J. Weissenbach, A. Bernot. 2002. Conservation of the T-cell receptor / linkage in the teleost fish Tetraodon nigroviridis. Genomics 79:241.[Medline]
17. Wilson, M. R., H. Zhou, E. Bengten, L. W. Clem, T. B. Stuge, G. W. Warr, N. W. Miller. 1998. T-cell receptors in channel catfish: structure and expression of TCR and genes. Mol. Immunol. 35:545.[Medline]
18. Hordvik, I., A. L. J. Jacob, J. Charlemagne, C. Endresen. 1996. Cloning of T-cell antigen receptor chain cDNAs from Atlantic salmon (Salmo salar). Immunogenetics 45:9.[Medline]
19. Wermenstam, N. E., L. Pilstrom. 2001. T-cell antigen receptors in Atlantic cod (Gadus morhua l.): structure, organization and expression of TCR and genes. Dev. Comp. Immunol. 25:117.[Medline]
20. Kamper, S. M., E. C. MaKinney. 2002. Polymorphism and evolution in the constant region of the T-cell receptor chain in an advanced teleost fish. Immunogenetics 53:1047.[Medline]
21. Rast, J. P., M. K. Andrson, S. J. Strong, C. Luer, R. T. Litman, G. W. Litman. 1997. , , , and T cell antigen receptor genes arose early in vertebrate phylogeny. Immunity 6:1.[Medline]
22. Rast, J. P., D. J. Litman. 1994. T-cell receptor gene homologs are present in the most primitive jawed vertebrates. Proc. Natl. Acad. Sci. USA 91:9248.[Abstract/Free Full Text]
23. De Guerra, A., J. Charlemagne. 1997. Genomic organization of the TCR -chain diversity (D) and joining (J) segments in the rainbow trout: presence of many repeated sequences. Mol. Immunol. 34:653.[Medline]
24. Koop, B. F., L. Rowen, K. Wang, C. L. Kuo, D. Seto, J. A. Lenstra, S. Howard, W. Shan, P. Deshpande, L. Hood. 1994. The human T-cell receptor TCRAC/TCRDC (C/C) region: organization, sequence, and evolution of 97.6 kb of DNA. Genomics 19:478.[Medline]
25. Koop, B. F., R. K. Wilson, K. Wang, B. Vernooij, D. Zaller, C. L. Kuo, D. Seto, M. Toda, L. Hood. 1992. Organization, structure and function of 95 kb spanning the murine T-cell receptor C to C region. Genomics 13:1209.[Medline]
26. Aoki, T., B.-H. Nam, I. Hirono, E. Yamamoto. 1999. Sequence of 596 cDNA clones (565, 977 bp) of Japanese flounder (Paralichthys olivaceus) leukocytes infected with hirame rhabdovirus. Mar. Biotechnol. 1:477.[Medline]
27. Katagiri, T., S. Asakawa, I. Hirono, T. Aoki, N. Shimizu. 2000. Genomic bacterial artificial chromosome library of the Japanese flounder Paralichthys olivaceus. Mar. Biotechnol. 2:571.[Medline]
28. Sambrook, J., E. F. Fritsch, T. Maniatis. 2001. Molecular Cloning: A Laboratory Manual 3rd Ed. Cold Spring Harbor Laboratory Press, Plainview.
29. Higgins, D. G., P. M. Sharp. 1988. CLUSTAL: a package for performing multiple sequence alignments on a microcomputer. Gene 73:237.[Medline]
30. Saitou, N., M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406.[Abstract]
31. Campbell, K. S., T. Backstrom, G. Tiefenthaler, E. Palmer. 1994. CART: a conserved antigen receptor transmembrane motif. Semin. Immunol. 6:393.[Medline]
32. Blumberg, R. S., B. Alarcon, J. Sancho, V. McDermott, P. Lopez, J. Breitmeyer, C. Terhorst. 1990. Assembly and function of the T cell antigen receptor. J. Biol. Chem. 265:14036.[Abstract/Free Full Text]
33. Partula, S.. 1999. Surface markers of fish T-cells. Fish Shellfish Immunol. 9:241.
34. Li, Z.-G., W.-P. Wu, N. Manolios. 1996. Structural mutations in the constant region of the T-cell antigen receptor (TCR) chain and their effect on TCR and chain interaction. Immunology 88:524.[Medline]
35. Arnaud, J., A. Huchenq, M.-C. Vernhes, S. Caspar-Bauguil, F. Lenfant, J. Sancho, C. Terhorst, B. Rubin. 1997. The interchain disulfide bond between TCR heterodimers on human T cells is not required for TCR-CD3 membrane expression and signal transduction. Int. Immunol. 9:615.[Abstract/Free Full Text]
36. Hein, W. R.. 1994. Structural and functional evolution of the extracellular regions of T cell receptors. Semin. Immunol. 6:361.[Medline]
37. Krangel, M. S., H. Band, S. Hata, J. Mclean, M. B. Brenner. 1987. Structurally divergent human T cell receptor proteins encoded by distinct C genes. Science 237:64.[Abstract/Free Full Text]
38. Pelicci, P. G., M. Subar, A. Weiss, R. Dalla-Favera, D. R. Litman. 1987. Molecular diversity of the human T- constant region genes. Science 237:1051.[Abstract/Free Full Text]
39. Hein, W. R., L. Dudler. 1993. Divergent evolution of T cell repertoires: extensive diversity and developmentally regulated expression of the sheep T cell receptor. EMBO J. 12:715.[Medline]
40. Takeuchi, N., N. Ishiguro, M. Shinagawa. 1992. Molecular cloning and sequence analysis of bovine T-cell receptor and chain genes. Immunogenetics 35:89.[Medline]
41. Thome, M., A. Saalmuller, E. Pfaff. 1993. Molecular cloning of porcine T cell receptor , , and chains using polymerase chain reaction fragments of the constant regions. Eur. J. Immunol. 23:1005.[Medline]
42. Kabat, E. A., T. T. Wu, H. M. Perry, K. S. Gottesman, C. Foeller. 1991. Sequences of Proteins of Immunological Interest 5th Ed. U.S. Department of Health and Human Services, Public Health Service, National Institutes of Health, Bethesda, MD.
43. Garcia, K. C., M. Degano, R. L. Standfield, A. Brunmark, M. R. Jackson, P. A. Peterson, L. Teyton, I. A. Wilson. 1996. An T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science 274:209.[Abstract/Free Full Text]
44. Moss, P. A. H., J. I. Bell. 1995. Sequence analysis of the human T-cell receptor CDR3 region. Immunogenetics 42:10.[Medline]
45. Rock, E. P., P. R. Sibbald, M. M. Davis, Y. Chien. 1994. CDR3 length in antigen-specific immune receptors. J. Exp. Med. 179:323.[Abstract/Free Full Text]
46. McCormack, W. T., L. W. Tjoelker, G. Stella, C. E. Postema, C. B. Thompson. 1991. Chicken T-cell receptor -chain diversity: an evolutionarily conserved Db-encoded glycine turn within the hypervariable CDR3 domain. Proc. Natl. Acad. Sci. USA 88:7699.[Abstract/Free Full Text]
47. Bentley, G., R. Mariuzza. 1996. The structure of the T cell antigen recptor. Annu. Rev. Immunol. 14:563.[Medline]
48. Garcia, K. C., L. Teyton, I. A. Wilson. 1999. Structural basis of T cell recognition. Annu. Rev. Immunol. 17:369.[Medline]
49. Chien, Y.-H., M. Iwashima, K. B. Kaplan, J. F. Elliott, M. M. Davis. 1987. A new T-cell receptor gene located within the locus and expressed early in T-cell differentiation. Nature 327:676.

This article has been cited by other articles: