The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hemmi, H.
Right arrow Articles by Akira, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hemmi, H.
Right arrow Articles by Akira, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2003, 170: 3059-3064.
Copyright © 2003 by The American Association of Immunologists

The Roles of Toll-Like Receptor 9, MyD88, and DNA-Dependent Protein Kinase Catalytic Subunit in the Effects of Two Distinct CpG DNAs on Dendritic Cell Subsets1

Hiroaki Hemmi*,{dagger}, Tsuneyasu Kaisho*,{dagger},{ddagger}, Kiyoshi Takeda*,{dagger} and Shizuo Akira2,*,{dagger}

* Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, and {dagger} Solution-Oriented Research for Science and Technology, Japan Science and Technology Corp., Suita, Osaka, Japan; and {ddagger} RIKEN Research Center for Allergy and Immunology, Yokohama, Kanagawa, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Oligodeoxynucleotides containing unmethylated CpG motifs (CpG DNAs) can function as powerful immune adjuvants by activating APC. Compared with conventional phosphorothioate-backbone CpG DNAs, another type of CpG DNAs, called an A or D type (A/D-type), possesses higher ability to induce IFN-{alpha} production. Conventional CpG DNAs can exert their activity through Toll-like receptor 9 (TLR9) signaling, which depends on a cytoplasmic adapter, MyD88. However, it remains unknown how A/D-type CpG DNAs exhibit their immunostimulatory function. In this study we have investigated murine dendritic cell (DC) responses to these two distinct CpG DNAs. Not only splenic, but also in vitro bone marrow-derived, DCs could produce larger amounts of IFN-{alpha} in response to A/D-type CpG DNAs compared with conventional CpG DNAs. This IFN-{alpha} production was mainly due to the B220+ DC subset. On the other hand, the B220- DC subset responded similarly to both CpG DNAs in terms of costimulatory molecule up-regulation and IL-12 induction. IFN-{alpha}, but not IL-12, induction was dependent on type I IFN. However, all activities of both CpG DNAs were abolished in TLR9- and MyD88-, but were retained in DNA-PKcs-deficient DCs. This study demonstrates that the TLR9-MyD88 signaling pathway is essential for all DC responses to both types of CpG DNAs.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial DNA can stimulate innate immunity in mammals (1, 2, 3). This immunostimulatory activity depends on the unmethylated CpG motif, which is abundantly present in microbes. Synthetic oligodeoxynucleotides containing the unmethylated CpG motif (CpG DNAs) are equivalent to bacterial DNA in the immunostimulatory activity. CpG DNAs can induce splenic B cell proliferation, dendritic cell (DC)3 maturation, and cytokine production from a variety of immune cells (1, 2, 3). These CpG DNAs are phosphorothioate-modified oligodeoxynucleotides called K-type CpG DNAs or CpG-B (conventional CpG DNAs). Through the screening of a variety of CpG DNAs, another type of CpG DNAs with a distinct function was identified (4, 5, 6, 7). These are termed D-type CpG DNAs or CpG-A (A/D-type CpG DNAs) and are structurally different from conventional CpG DNAs because they carry a phosphorothioate-modified polyguanosine (polyG) stretch at the 5' and 3' ends and a phosphodiester backbone CpG motif at the central position. The function of A/D-type CpG DNAs has been extensively characterized in the human system (4, 5). A/D-type CpG DNAs can induce cytokine production in a variety of cells, but exhibit weaker ability to induce proliferation and IgM production of splenocytes than conventional CpG DNAs (4). Notably, A/D-type CpG DNAs have greater ability to induce IFN-{alpha} production from plasmacytoid DC (PDC) and IFN-{gamma} from NK cells (5, 6).

We previously demonstrated that Toll-like receptor 9 (TLR9) is essential for CpG DNA-induced immune responses based on the fact that TLR9-deficient (TLR9-/-) mice are refractory to CpG DNAs (8). In addition, TLR9 expression is sufficient to confer responsiveness to CpG DNA on a human kidney cell line (9, 10). Some CpG DNAs can activate human immune cells more efficiently than murine ones, while others can activate murine cells more effectively than human ones. This species-specific response is reconstituted by the expression of human or murine TLR9 on an otherwise refractory cell line, suggesting that TLR9 is also critical for the species-specific function of CpG DNAs (9). However, because all these experiments were performed with conventional CpG DNAs, the cellular and molecular mechanisms of how immune cells are activated by A/D-type CpG DNAs remain unelucidated.

In this study we have investigated how these CpG DNAs activate DCs, which play crucial roles in host defense by linking innate and adaptive immunities. Both types of CpG DNAs could induce IL-12 secretion from DCs. However, compared with conventional CpG DNAs, A/D-type CpG DNAs could induce greater amounts of IFN-{alpha} production from DCs. A B220+ DC subset, which is considered to be a murine counterpart of human PDC, was mainly responsible for IFN-{alpha} production induced by CpG DNAs. Both conventional and A/D-type CpG DNAs required the TLR9 signaling system and could induce IFN regulatory factor 7 (IRF7) mRNA up-regulation at similar levels. Thus, common signaling pathways are involved in the effects of distinct types of CpG DNAs on murine DC subsets.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

C57BL/6J mice were purchased from CLEA Japan, Inc. (Tokyo, Japan). MyD88-deficient (MyD88-/-) mice were established as described previously (11) and backcrossed over eight times with C57BL/6 mice. TLR9-/- mice were generated as described previously (8). DNA-dependent protein kinase catalytic subunit-deficient (DNA-PKcs-/-) mice were provided by Dr. F. W. Alt (Harvard Medical School, Boston, MA) (12). IFN-{alpha}/{beta}R-deficient (IFN-{alpha}/{beta}R-/-) mice were purchased from B&K Universal Ltd. (Hull, U.K.).

Reagents and Abs

Synthesized oligodeoxynucleotides were purchased from Hokkaido System Science (Sapporo, Japan). The sequences and backbones of oligodeoxynucleotides are: ODN1668, tccatgacgttcctgatgct (13); D19, ggTGCATCGATGCAgggggG (4); and control D, ggTGCATGCATGCAgggggG (4). Capital and lowercase letters in parentheses indicate bases with phosphodiester and phosphorothioate-modified backbones, respectively. Abs against mouse CD11c (clone HL3), CD40 (clone 3/23), CD86 (clone GL1), and B220 (clone RA3-6B2) were purchased from BD PharMingen (San Diego, CA)

Preparation of DCs

To prepare splenocytes containing DCs, spleens were cut unto small fragments and incubated with RPMI 1640 medium containing 400 U/ml collagenase (Wako Pure Chemical Industries, Osaka, Japan) and 15 µg/ml DNase (Sigma-Aldrich, St. Louis, MO) at 37°C for 20 min. For the last 5 min, EDTA was added at 5 mM. Single-cell suspensions were prepared after RBC lysis. CD11c+ cells were purified by MACS with anti-CD11c microbeads and used as splenic DCs. Enriched cells contained >90% CD11c+ cells.

To prepare in vitro bone marrow-derived DCs (BMDCs), BM cells were prepared from femora and tibia and passed through nylon mesh. Then cells were cultured in RPMI 1640 medium supplemented with 10% FCS, 100 µM 2-ME, and 100 ng/ml human Flt3 ligand (Flt3L; PeproTech EC, London, U.K.). After 6–8 days, the cells were used as Flt3L-induced BMDCs (Flt3L-BMDCs) for additional experiments. Flt3L-BMDCs on days 6–8 contained 80–90% CD11c+ cells, as described previously (14).

Flow cytometry

Splenic CD11c+DCs or Flt3L-BMDCs were first incubated with biotinylated anti-CD11c and then with PE-conjugated anti-B220 and CyChrome-conjugated streptavidin. As indicated in Fig. 2, B220+ and B220- cells were sorted using a FACSVantage (BD Bioscience, Mountain View, CA).



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 2. B220+CD11c+ and B220-CD11c+ cells differentially respond to two types of CpG DNAs. Splenic B220+CD11cdull and B220-CD11chigh cells (A) were purified by FACS. Sorted cells were cultured at 4 x 104 cells/well with or without 3 µM CpG DNAs for 24 h. Concentrations of IFN-{alpha} or IL-12 p40 were measured by ELISA and are shown as the mean ± SD. Surface expression of costimulatory molecules was analyzed by flow cytometry. Flt3L-BMDCs (B) were also sorted by B220 expression and analyzed similarly to splenic DCs. Reanalysis of sorted cells verified that >95% cells exhibited the expected FACS profiles.

 
To evaluate surface expression levels of costimulatory molecules, cells were stained with biotinylated anti-CD40 and FITC-labeled anti-CD86, developed with PE-conjugated streptavidin, and analyzed on a FACSCalibur (BD Bioscience).

Measurement of cytokine production

Cells were seeded into 96-well plates at 2 x 106 cells/ml, or as otherwise indicated, in RPMI 1640 with 10% FCS and stimulated with various doses of synthesized oligodeoxynucleotides for 24 h. Culture supernatants were collected and analyzed for cytokine production. Cytokine concentrations in the supernatants were measured with ELISA. ELISA kits for mouse IFN-{alpha} were purchased from PBL Biomedical Laboratories (New Brunswick, NJ). ELISA kits for mouse TNF-{alpha} and IL-12 p40 were obtained from TECHNE Corp. (Minneapolis, MN).

Northern blot analysis

Total RNAs were isolated using Sepazol-RNA I (Nacalai Tesque, Kyoto, Japan), electrophoresed, and transferred to nylon membranes. Hybridization was performed with the indicated cDNA probes as described previously (11). cDNA probes specific for IFN-{beta}, IL-12 p40, and IRF7 were obtained though the previously published subtractive screenings (15). The IFN-{alpha} probe is an EcoRI-HindIII fragment of the murine IFN-{alpha}4 and detects multiple IFN-{alpha} subtypes (16).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytokine production of splenic DCs in response to CpG DNAs

We first evaluated CpG DNA-induced production of cytokines in splenic CD11c+ DCs (Fig. 1A). D19 and ODN1668 were chosen as representatives of A/D-type and conventional CpG DNAs, respectively. Both increased the production of TNF-{alpha} and IL-12 p40 from splenic DCs in a dose-dependent manner, although D19 needed higher concentrations than ODN1668 to achieve comparable levels of cytokine production (Fig. 1).



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 1. Cytokine production by splenic CD11c+ cells (A) and Flt3L-BM DCs (B) in response to CpG DNAs. Splenic CD11c+ cells were enriched by MACS and stimulated with the indicated concentrations of synthetic oligodeoxynucleotides for 24 h. Control D carries GpC instead of the CpG dinucleotide sequence of D19. Concentrations of IFN-{alpha}, TNF-{alpha}, and IL-12 p40 in the culture supernatants were measured by ELISA. Data are shown as the mean ± SD.

 
We next measured IFN-{alpha} production of CpG DNA-stimulated splenic DCs. D19-induced IFN-{alpha} secretion was detected above a concentration of 0.1 µM and increased in a dose-dependent manner. ODN1668 could also induce IFN-{alpha}, but the production was only detected at concentrations of 0.01–0.3 µM and was abolished at higher concentrations. Furthermore, the maximal induction was much less than that of D19-stimulated DCs. Thus, ODN1668 and D19 have differential activities on mouse DCs in terms of IFN-{alpha} production.

In the presence of Flt3L, CD11c+ cells, including IFN-{alpha}-producing cells, can be generated in vitro from BM cells (14). We next tested the responses of Flt3L-BMDCs to D19 and ODN1668. These DCs could also produce TNF-{alpha} and IL-12p40 in response to D19 or ODN1668. Similar to splenic DCs, Flt3L-BMDCs also responded better to ODN1668 than to D19. D19 could induce Flt3L-BMDCs to produce IFN-{alpha} in a dose-dependent manner, while ODN1668 induced small amounts of IFN-{alpha} only at 0.01–0.3 µM. Taken together, not only splenic CD11c+, but also in vitro DCs, differentially responded to the two types of CpG DNAs in a similar manner.

B220+ CD11c+ cells are major IFN-{alpha}-producing cells in response to D19

DCs can be divided into subsets according to their surface molecule expression profiles (17). Among splenic DC subsets, B220+CD11cdull cells show a unique ability to produce IFN-{alpha} upon viral infection (18, 19, 20, 21). To characterize the cell population involved in cytokine production from CpG DNA-stimulated splenic DCs, we purified B220+CD11cdull and B220-CD11chigh cells by cell sorting and analyzed their responses to ODN1668 or D19 (Fig. 2A). In response to ODN1668, both B220+CD11cdull and B220-CD11chigh cells produced IL-12 and enhanced their surface expression of CD40 and CD86. Neither population produced detectable levels of IFN-{alpha} in response to 3 µM ODN1668. In the case of D19 stimulation, both populations showed increased expression of costimulatory molecules. However, B220-CD11chigh cells produced IL-12, but not IFN-{alpha}, whereas B220+CD11cdull cells produced IFN-{alpha}, but not IL-12.

Flt3L-BMDCs can also be divided into two subsets according to B220 expression (14). We next tested the responses of these subpopulations to CpG DNAs. The B220+ and B220- cells in Flt3L-BMDCs responded to the two types of CpG DNAs in a manner similar to that of splenic B220+CD11cdull and B220-CD11chigh cells, respectively (Fig. 2B). Thus, ODN1668 could activate both populations indistinguishably, whereas D19 showed differential cytokine-inducing ability in the two populations.

IFN-{alpha} production in response to D19 is dependent on TLR9 and MyD88

TLR9 or its cytoplasmic adapter, MyD88, is essential for conventional CpG DNA signaling (8, 22, 23). We next investigated whether the two types of CpG DNAs show any differences in their dependency on TLR9 or MyD88. Among splenocytes, CD11c+ cells were mainly involved in IFN-{alpha} production in response to D19 (Fig. 3A). This IFN-{alpha} production was completely abolished in the absence of TLR9 or MyD88. Furthermore, whole and CD11c+ splenocytes from TLR9-/- or MyD88-/- mice lacked both ODN1668- and D19-induced IL-12 production (Fig. 3A).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 3. TLR9-/- or MyD88-/- cells lack any cytokine production in response to either type of CpG DNA. Splenic CD11c+ DCs (A) and Flt3L-BMDCs (B) were prepared from wild-type, TLR9-/-, or MyD88-/- mice. Cells were stimulated with the indicated concentrations of D19 or ODN1668 for 24 h. Concentrations of IFN-{alpha} and IL-12 p40 were measured by ELISA. Data are shown as the mean ± SD of one representative experiment.

 
Next, we investigated the cytokine-producing ability of CpG DNA-stimulated Flt3L-BMDCs. IL-12 production in response to both types of CpG DNAs was abolished in Flt3L-BMDCs derived from both TLR9-/- and MyD88-/- mice (Fig. 3B). Furthermore, IFN-{alpha} production in response to D19 as well as that to 0.03 µM ODN1668 were completely abolished in the mutant Flt3L-BMDCs. Thus, the ability of both conventional and A/D-type CpG DNAs to induce cytokine production from in vivo and in vitro DCs was dependent on TLR9 and MyD88.

DNA-PKcs is not essential for responses to CpG DNA

It has been reported that DNA-PKcs is necessary for cytokine production in response to CpG DNAs, because DNA-PKcs-/- cells lacked the response (24). We next examined cytokine production of DNA-PKcs-/- cells in response to CpG DNAs. DNA-PKcs-/- mice lack mature B and T cell population due to defective DNA recombination (12, 25). Therefore, CD11c+ cells were isolated by MACS from wild-type and mutant splenocytes. Splenic CD11c+ cells were stimulated with D19 or ODN1668 for 24 h and analyzed for their cytokine production (Fig. 4A). DNA-PKcs-/- CD11c+ cells retained the ability to produce IFN-{alpha} and IL-12 in response to CpG DNAs.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 4. DNA-PKcs-/- cells normally respond to CpG DNAs. Splenic CD11c+ DCs (A) and Flt3L-BMDCs (B) from wild-type or DNA-PKcs-/- mice were stimulated with 3 µM D19 or ODN1668 (1668) for 24 h. Concentrations of IFN-{alpha} and IL-12 p40 in the culture supernatants were measured by ELISA. Data are shown as the mean ± SD. Surface expression of CD40 on Flt3L-BMDCs was analyzed by flow cytometry (C). Similar results were obtained from three independent experiments.

 
We also analyzed the effects of both CpG DNAs on wild-type and DNA-PKcs-/- Flt3L-BMDCs. FACS analysis revealed that the population ratio of B220+CD11c+ and B220-CD11c+ cells in Flt3L-BMDCs from DNA-PKcs-/- mice was comparable to that from wild-type mice (data not shown). DNA-PKcs-/- Flt3L-BMDCs augmented IL-12 production and surface expression of CD40 and CD86 in response to ODN1668 (Fig. 4, B and C, and data not shown). These responses were also observed in D19-stimulated DNA-PKcs-/- Flt3L-BMDCs. Furthermore, the mutant BMDCs produced IFN-{alpha} in response to D19 (Fig. 4B). Thus, these results clearly indicated that DNA-PKcs are dispensable for all immunostimulatory effects of both types of CpG DNAs.

Northern blot analysis of CpG DNA-stimulated DCs

IRF7 expression is induced by type I IFNs or viral infection and involved in type I IFN production (16, 26, 27). Therefore, we examined whether the IRF7 mRNA is differentially induced by the two types of CpG DNAs. As shown in Fig. 5A, IRF7 mRNA induction was observed in D19-stimulated Flt3L-DCs. ODN1668 also up-regulated IRF7 mRNA expression at both low and high concentrations with similar kinetics and levels as D19, although induction of IFN-{alpha} and IFN-{beta} mRNA was abolished in DCs stimulated with high concentrations of ODN1668.



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 5. Northern blot analysis of Flt3L-BMDCs stimulated with D19 or ODN1668. Flt3L-BMDCs from wild-type or IFN-{alpha}/{beta}R-/- mice were stimulated with CpG DNAs for the indicated periods. Total RNAs were extracted and subjected to Northern blot analysis.

 
It has been reported that in viral infections, IRF7 mRNA induction is dependent on IFN-{alpha}/{beta} (27). Therefore, we analyzed gene expression of CpG DNA-stimulated IFN-{alpha}/{beta}R-deficient (IFN-{alpha}/{beta}R-/-) DCs. IL-12p40 mRNA induction by both CpG DNAs was retained in IFN-{alpha}/{beta}R-/- DCs (Fig. 5B). However, IFN-{alpha}/{beta} mRNA up-regulation by D19 was abolished in the absence of IFN-{alpha}/{beta}R (Fig. 5B), indicating the critical involvement of type I IFN signaling in type I IFN production induced by D19. Furthermore, IRF7 mRNA induction by D19 as well as by ODN1668 was abolished in the absence of IFN-{alpha}/{beta}R. This suggests that type I IFN signaling is essential for IRF7 mRNA induction even in ODN1668-stimulated DCs. These data, however, indicate that the loss of IFN-{alpha} mRNA induction at higher doses of ODN1668 may not be due to a decrease in IRF7 induction.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study we analyzed cellular and molecular basis for the actions of two types of CpG DNAs. Conventional CpG DNAs can activate murine DCs to produce IL-12 and enhance the surface expression of costimulatory molecules. A/D-type CpG DNAs can also activate murine DCs in a similar manner as conventional CpG DNAs and, moreover, can induce IFN-{alpha} production from CD11c+ cells. Splenic CD11c+ cells can be divided into two populations, B220+CD11cdull and B220-CD11chigh cells. The former cells were identified as IFN-{alpha}-producing cells during viral infection (18, 19, 20). We found that A/D-type CpG DNAs also stimulated B220+CD11cdull cells to induce IFN-{alpha} production. B220+CD11cdull cells could also produce significant, but smaller, amounts of IFN-{alpha} by conventional CpG DNAs only at low doses, while B220-CD11chigh cells did not (data not shown). Interestingly, although B220-CD11chigh cells secreted similar amounts of IL-12 in response to the two types of CpG DNAs, B220+CD11cdull cells produced smaller amounts of IL-12 when stimulated with A/D-type CpG DNAs than with conventional CpG DNAs. Meanwhile, costimulatory molecule expression in B220+CD11cdull and B220-CD11chigh cells was comparatively up-regulated by both types of CpG DNAs. These results suggest that differential responses to conventional or A/D-type CpG DNAs are observed in cytokine-producing ability, but not in the ability to enhance costimulatory molecule expression. Notably, B220-CD11chigh cells, which cannot produce IFN-{alpha}, responded to the two types of CpG DNAs in an indistinguishable manner. Thus, the differential ability of DCs to produce cytokines in response to conventional or A/D-type CpG DNAs is based on the characteristics of B220+CD11cdull cells.

At present we do not know how TLR9 can transduce such differential activity depending on the ligand. Klinman et al. (7) have shown that TLR9 overexpression can render a human kidney cell line responsive to conventional CpG DNAs, but not to A/D-type CpG DNAs. This suggests that TLR9 is not sufficient for transducing the A/D-type CpG DNA signal, and that another molecule(s) cooperatively functions to induce IFN-{alpha} production with TLR9. It is assumed that oligodeoxynucleotides are incorporated into cells through a pathway not requiring any specific sequences and that only CpG DNAs can bind to TLR9 and trigger TLR9 signaling in the endosome (10, 28). However, confocal microscopic analysis revealed that conventional and A/D-CpG DNAs are destined for different cell compartments (29). Such differential behavior of CpG DNAs might lead to the induction of distinct cytokines. It is also possible that differential TLR9 responses are caused by coligation of other transmembrane proteins. In this context, it is noteworthy that scavenger receptor A (SR-A) can bind to the polyG stretch and that SR-A ligands can inhibit the binding of CpG DNAs containing the polyG stretch to splenic CD11c+ DCs (30). However, it remains unknown whether SR-A is involved in DC responses caused by A/D-type CpG DNAs.

DNA-PKcs was suggested as a signaling molecule for CpG DNA-induced immune responses (24). However, a recent report has shown that DNA-PKcs is not essential for CpG DNA responses (31). Our present results are consistent with the latter report and further show that the enzyme is dispensable not only for conventional, but also for A/D-type, CpG DNAs-induced signaling. In addition, MyD88-/- and TLR9-/- cells lacked any response to either type of CpG DNAs (Fig. 3). Thus, CpG DNAs can manifest their multiple immunostimulatory functions through the TLR9-MyD88-dependent pathway.

Viral infection can induce type I IFN production that is vigorously amplified by type I IFN itself (32, 33). IFN-{alpha}/{beta}R-/- cells decreased their ability to produce IFN-{alpha} in response to A/D-type CpG DNAs, indicating that type I IFN signaling is also involved in TLR9-induced IFN-{alpha} production. IRF7 mRNA can be induced by type I IFN. The induction was suggested to be critical for IFN-{alpha} production through the analysis of IRF-9-deficient mice that lack IRF7 mRNA induction (27). However, wild-type DCs could produce similarly increased levels of IRF7 mRNA expression in response to 3 µM ODN1668, although IFN-{alpha} production was profoundly decreased (Fig. 5). Thus, IRF7 mRNA induction is not sufficient for TLR9-induced IFN-{alpha} production.

In response to 3 µM ODN1668, low levels of type I IFN mRNA expression can be induced at 1 h, but the induction rapidly declines at later time points. Meanwhile, at 0.03 µM ODN1668 the induction comes later and reaches comparable levels as with D19. These results suggest the possibility that a high concentration of ODN1668 induces unknown negative feedback mechanism resulting in the abolishment of type I IFN gene expression. Further studies are necessary to clarify how TLR9 induces differential responses depending on its ligands.

Among TLR family members, TLR7 is closely related to TLR9 based on their molecular structures. In humans, TLR7 and TLR9 are expressed on a subset of DCs, PDC. Activation of TLR7 or TLR9 enhances the survival of DCs and the expression of surface molecules, such as costimulatory molecules and MHC class II. Thus, TLR7 and TLR9 have common features in their molecular structures and functions. While TLR9 is expressed exclusively on PDC, TLR7 is also expressed on another subset, myeloid DC. Experiments with TLR7 ligands clarified that TLR7 signaling can differentially induce IFN-{alpha} and IL-12 from PDC and myeloid DC, respectively (34). The mechanism is unknown at present, but it is intriguing that murine TLR9 and the human TLR7 systems are well conserved in differential cytokine inducibility depending on DC subsets. Another intriguing point is that murine B220+CD11cdull cells do not produce high levels of IL-12 in response to D19, although they can in response to ODN1668. This is in contrast to the human TLR7 system, because human PDC cannot produce IL-12 in response to any stimuli. IFN-{alpha} can inhibit IL-12 production (35), but that cannot account for the inability of A/D-type CpG DNA-stimulated B220+CD11cdull cells to produce IL-12, because costimulation with IFN-{alpha} and ODN1668 did not decrease IL-12 production from B220-CD11chigh cells (data not shown). Furthermore, type I IFN-neutralizing Abs could not increase IL-12 production from D19-treated B220+CD11cdull cells (data not shown). Thus, it is unlikely that IFN-{alpha} production induced by D19 prevents B220+CD11cdull cells from producing IL-12.

The present study has revealed subset-dependent responses of murine DCs to distinct types of CpG DNA. Further clarification of the underlying molecular mechanisms should contribute to elucidating how DCs are activated by CpG DNAs and to developing efficient vaccination strategies with CpG DNAs.


    Acknowledgments
 
We thank Dr. Koujiro Nakamura (Osaka University, Osaka, Japan) for cell sorting; Dr. Masaaki Murakami (Osaka University) for useful suggestions; Drs. Frederick W. Alt (Harvard Medical School, Boston, MA) and Masumi Abe (National Institute for Radiological Sciences, Chiba, Japan) for providing DNA-PKcs-/- mice; Nana Iwami, Yuri Fukuda, and Naoko Okita for technical assistance; and Emi Horita for secretarial assistance.


    Footnotes
 
1 This work was supported by grants from the Ministry of Education, Culture, Sports, Science, and Technology in Japan, and SORST of Japan Science and Technology Corp. H.H. is a Research Fellow of the Japan Society for the Promotion of Science. Back

2 Address correspondence and reprint requests to Dr. Shizuo Akira, Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan. E-mail address: sakira{at}biken.osaka-u.ac.jp Back

3 Abbreviations used in this paper: DC, dendritic cell; BM, bone marrow; CpG DNA, oligodeoxynucleotides containing the unmethylated CpG motif; DNA-PKcs, DNA-dependent protein kinase catalytic subunit; Flt3L, Flt3 ligand; IRF7, IFN regulatory factor 7; PDC, plasmacytoid DC; polyG, polyguanosine; SR-A, scavenger receptor A; TLR, Toll-like receptor. Back

Received for publication November 8, 2002. Accepted for publication January 15, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wagner, H.. 1999. Bacterial CpG DNA activates immune cells to signal infectious danger. Adv. Immunol. 73:329.[Medline]
  2. Yamamoto, S., T. Yamamoto, T. Tokunaga. 2000. The discovery of immunostimulatory DNA sequence. Springer Semin. Immunopathol. 22:11.[Medline]
  3. Kreig, A. M.. 2002. CpG motifs in bacterial DNA and their immune effects. Annu. Rev. Immunol. 20:709.[Medline]
  4. Verthelyi., D., K. J. Ishii, M. Gursel, F. Takeshita, D. M. Klinman. 2001. Human peripheral blood cells differentially recognize and respond to two distinct CpG motifs. J. Immunol. 166:2372.[Abstract/Free Full Text]
  5. Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdorfer, S. Blackwell, Z. K. Ballas, S. Endres, A. M. Krieg, G. Hartmann. 2001. Identification of CpG oligonucleotide sequences with high induction of IFN-{alpha}/{beta} in plasmacytoid dendritic cells. Eur. J. Immunol. 31:2154.[Medline]
  6. Ballas, Z. K., A. M. Krieg, T. Warren, G. L. Weiner. 2001. Divergent therapeutic and immunological effects of oligonucleotides with distinct CpG motifs. J. Immunol. 167:4878.[Abstract/Free Full Text]
  7. Klinman, D. M., F. Takeshita, I. Gursel, C. Leifer, K. J. Ishii, D. Verthelyi, M. Gursel. 2002. CpG DNA: recognition by and activation of monocytes. Microbes Infect. 4:897.[Medline]
  8. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, et al 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  9. Bauer, S., C. J. Kirschning, H. Hacker, V. Redecke, S. Hausmann, S. Akira, H. Wagner, G. B. Lipford. 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad. Sci. USA 98:9237.[Abstract/Free Full Text]
  10. Takeshita, F., C. A. Leifer, I. Gursel, K. J. Ishii, S. Takeshita, M. Gursel, D. M. Klinman. 2001. Role of Toll-like receptor 9 in CpG DNA-induced activation of human cells. J. Immunol. 167:3555.[Abstract/Free Full Text]
  11. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function. Immunity. 9:143.[Medline]
  12. Gao, Y., J. Chaudhuri, C. Zhu, L. Davidson, D. T. Weaver, F. W. Alt. 1998. A targeted DNA-PKcs-null mutation reveals DNA-PK-independent functions for KU in V(D)J recombination. Immunity 9:367.[Medline]
  13. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 374:546.[Medline]
  14. Gilliet, M., A. Boonstra, C. Paturel, S. Antonenko, X. L. Xu, G. Trinchieri, A. O’Garra, Y. J. Liu. 2002. The development of murine plasmacytoid dendritic cell precursors is differentially regulated by FLT3-ligand and granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 195:953.[Abstract/Free Full Text]
  15. Kawai, T, O. Takeuchi, T. Fujita, J. Inoue, P. F. Muhlradt, S. Sato, K. Hoshino, S. Akira. 2001. Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFN-regulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes. J. Immunol. 167:5887.[Abstract/Free Full Text]
  16. Sato, M., H. Suemori, N. Hata, M. Asagiri, K. Ogasawara, K. Nakao, T. Nakaya, M. Katsuki, S. Noguchi, N. Tanaka, et al 2000. Distinct and essential roles of transcription factors IRF-3 and IRF7 in response to viruses for IFN-{alpha}/{beta} gene induction. Immunity. 13:539.[Medline]
  17. Shortman, K., Y. J. Liu. 2002. Mouse and human dendritic cell subtypes. Nat. Rev. Immunol. 2:151.[Medline]
  18. Asselin-Paturel, C., A. Boonstra, M. Dalod, I. Durand, N. Yessaad, C. Dezutter-Dambuyant, A. Vicari, A. O’Garra, C. Biron, F. Brière, et al 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat. Immunol. 2:1144.[Medline]
  19. Nakano, H., M. Yanagita, M. D. Gunn. 2001. CD11c+B220+Gr-1+ cells in mouse lymph nodes and spleen display characteristics of plasmacytoid dendritic cells. J. Exp. Med. 194:1171.[Abstract/Free Full Text]
  20. Martin, P., G. M. Del Hoyo, F. Anjuère, C. F. Arias, H. H. Vargasm, A. Fernández-L, V. Parrillas, C. Ardavin. 2002. Characterization of a new subpopulation of mouse CD8{alpha}+ B220+ dendritic cells endowed with type 1 interferon production capacity and tolerogenic potential. Blood 100:383.[Abstract/Free Full Text]
  21. Nikolic, T., G. M. Dingjan, P. J. Leenen, R. W. Hendriks. 2002. A subfraction of B220+ cells in murine bone marrow and spleen does not belong to the B cell lineage but has dendritic cell characteristics. Eur. J. Immunol. 32:686.[Medline]
  22. Häcker, H., R. M. Vabulas, O. Takeuchi, K. Hoshino, S. Akira, H. Wagner. 2000. Immune cell activation by bacterial CpG-DNA through myeloid differentiation marker 88 and tumor necrosis factor receptor-associated factor (TRAF)6. J. Exp. Med. 192:595.[Abstract/Free Full Text]
  23. Kaisho, T., S. Akira. 2002. Toll-like receptors as adjuvant receptors. Biochim. Biophys. Acta 1589:13.
  24. Chu, W., X. Gong, Z. Li, K. Takabayashi, H. Ouyang, Y. Chen, A. Lois, D. J. Chen, G. C. Li, M. Karin, et al 2000. DNA-PKcs is required for activation of innate immunity by immunostimulatory DNA. Cell 103:909.[Medline]
  25. Kurimasa, A, H. Ouyang, L. J. Dong, S. Wang, X. Li, C. Cordon-Cardo, D. J. Chen, G. C. Li. 1999. Catalytic subunit of DNA-dependent protein kinase: impact on lymphocyte development and tumorigenesis. Proc. Natl. Acad. Sci. USA 96:1403.[Abstract/Free Full Text]
  26. Marié, I., J. E. Durbin, D. E. Levy. 1998. Differential viral induction of distinct interferon-{alpha} genes by positive feedback through interferon regulatory factor-7. EMBO J. 17:6660.[Medline]
  27. Sato, M., N. Hata, M. Asagiri, T. Nakaya, T. Taniguchi, N. Tanaka. 1998. Positive feedback regulation of type I IFN genes by the IFN-inducible transcription factor IRF7. FEBS Lett. 441:106.[Medline]
  28. Ahmad-Nejad, P., H. Häcker, M. Rutz, S. Bauer, R. M. Vabulas, H. Wagner. 2002. Bacterial CpG-DNA and lipopolysaccharides activate Toll-like receptors at distinct cellular compartments. Eur. J. Immunol. 32:1958.[Medline]
  29. Gürsel, M., D. Verthelyi, I. Gürsel, K. J. Ishii, D. M. Klinman. 2002. Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide. J. Leukocyte Biol. 71:813.[Abstract/Free Full Text]
  30. Lee, S. W., M. K. Song, K. H. Baek, Y. Park, J. K. Kim, C. H. Lee, H. K. Cheong, C. Cheong, Y. C. Sung. 2000. Effects of a hexameric deoxyriboguanosine run conjugation into CpG oligodeoxynucleotides on their immunostimulatory potentials. J. Immunol. 165:3631.[Abstract/Free Full Text]
  31. Ishii, K. J., F. Takeshita, I. Gursel, M. Gursel, J. Conover, A. Nussenzweig, D. M. Klinman. 2002. Potential role of phosphatidylinositol 3 kinase, rather than DNA-dependent protein kinase, in CpG DNA-induced immune activation. J. Exp. Med. 196:269.[Abstract/Free Full Text]
  32. Taniguchi, T., K. Ogasawara, A. Takaoka, N. Tanaka. 2001. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19:623.[Medline]
  33. Levy, D. E., I. Marié, E. Smith, A. Prakash. 2002. Enhancement and diversification of IFN induction by IRF7-mediated positive feedback. J. Interferon Cytokine Res. 22:87.[Medline]
  34. Ito, T., R. Amakawa, T. Kaisho, H. Hemmi, K. Tajima, K. Uehira, Y. Ozaki, H. Tomizawa, S. Akira, S. Fukuhara. 2002. Interferon-{alpha} and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J. Exp. Med. 195:1507.[Abstract/Free Full Text]
  35. Biron, C. A.. 2001. Interferons {alpha} and {beta} as immune regulators: a new look. Immunity 14:661.[Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2003 170: 2795-2796. [Full Text]  



This article has been cited by other articles:


Home page
J. Immunol.Home page
C. Richter, M. H. S. Juan, J. Will, R. P. Brandes, U. Kalinke, S. Akira, J. M. Pfeilschifter, M. Hultqvist, R. Holmdahl, and H. H. Radeke
Ncf1 Provides a Reactive Oxygen Species-Independent Negative Feedback Regulation of TLR9-Induced IL-12p70 in Murine Dendritic Cells
J. Immunol., April 1, 2009; 182(7): 4183 - 4191.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Paget, E. Bialecki, J. Fontaine, C. Vendeville, T. Mallevaey, C. Faveeuw, and F. Trottein
Role of Invariant NK T Lymphocytes in Immune Responses to CpG Oligodeoxynucleotides
J. Immunol., February 15, 2009; 182(4): 1846 - 1853.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Scheu, P. Dresing, and R. M. Locksley
Visualization of IFN{beta} production by plasmacytoid versus conventional dendritic cells under specific stimulation conditions in vivo
PNAS, December 23, 2008; 105(51): 20416 - 20421.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. Y. Lee, Y. Kumagai, Y. Li, O. Takeuchi, H. Yoshida, J. Weinstein, E. S. Kellner, D. Nacionales, T. Barker, K. Kelly-Scumpia, et al.
TLR7-dependent and Fc{gamma}R-independent production of type I interferon in experimental mouse lupus
J. Exp. Med., December 22, 2008; 205(13): 2995 - 3006.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
C. Sundling, K. Schon, A. Morner, M. N. E. Forsell, R. T. Wyatt, R. Thorstensson, G. B. K. Hedestam, and N. Y. Lycke
CTA1-DD adjuvant promotes strong immunity against human immunodeficiency virus type 1 envelope glycoproteins following mucosal immunization
J. Gen. Virol., December 1, 2008; 89(12): 2954 - 2964.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
G. K. Chege, E. G. Shephard, A. Meyers, J. van Harmelen, C. Williamson, A. Lynch, C. M. Gray, E. P. Rybicki, and A.-L. Williamson
HIV-1 subtype C Pr55gag virus-like particle vaccine efficiently boosts baboons primed with a matched DNA vaccine
J. Gen. Virol., September 1, 2008; 89(9): 2214 - 2227.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M.-L. Baron, D. Gauchat, R. La Motte-Mohs, N. Kettaf, A. Abdallah, T. Michiels, J.-C. Zuniga-Pflucker, and R.-P. Sekaly
TLR Ligand-Induced Type I IFNs Affect Thymopoiesis
J. Immunol., June 1, 2008; 180(11): 7134 - 7146.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Yotsumoto, K. Saegusa, and Y. Aramaki
Endosomal Translocation of CpG-Oligodeoxynucleotides Inhibits DNA-PKcs-Dependent IL-10 Production in Macrophages
J. Immunol., January 15, 2008; 180(2): 809 - 816.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Oganesyan, S. K. Saha, E. M. Pietras, B. Guo, A. K. Miyahira, B. Zarnegar, and G. Cheng
IRF3-dependent Type I Interferon Response in B Cells Regulates CpG-mediated Antibody Production
J. Biol. Chem., January 11, 2008; 283(2): 802 - 808.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
T. Sugiyama, K. Hoshino, M. Saito, T. Yano, I. Sasaki, C. Yamazaki, S. Akira, and T. Kaisho
Immunoadjuvant effects of polyadenylic:polyuridylic acids through TLR3 and TLR7
Int. Immunol., January 1, 2008; 20(1): 1 - 9.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Phipps, C. E. Lam, S. Mahalingam, M. Newhouse, R. Ramirez, H. F. Rosenberg, P. S. Foster, and K. I. Matthaei
Eosinophils contribute to innate antiviral immunity and promote clearance of respiratory syncytial virus
Blood, September 1, 2007; 110(5): 1578 - 1586.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. Trumstedt, E. Eriksson, A. M. Lundberg, T.-b. Yang, Z.-q. Yan, H. Wigzell, and M. E. Rottenberg
Role of IRAK4 and IRF3 in the control of intracellular infection with Chlamydia pneumoniae
J. Leukoc. Biol., June 1, 2007; 81(6): 1591 - 1598.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Yasuda, C. Richez, J. W. Maciaszek, N. Agrawal, S. Akira, A. Marshak-Rothstein, and I. R. Rifkin
Murine Dendritic Cell Type I IFN Production Induced by Human IgG-RNA Immune Complexes Is IFN Regulatory Factor (IRF)5 and IRF7 Dependent and Is Required for IL-6 Production
J. Immunol., June 1, 2007; 178(11): 6876 - 6885.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Uematsu and S. Akira
Toll-like Receptors and Type I Interferons
J. Biol. Chem., May 25, 2007; 282(21): 15319 - 15323.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. Kawagoe, S. Sato, A. Jung, M. Yamamoto, K. Matsui, H. Kato, S. Uematsu, O. Takeuchi, and S. Akira
Essential role of IRAK-4 protein and its kinase activity in Toll-like receptor-mediated immune responses but not in TCR signaling
J. Exp. Med., May 14, 2007; 204(5): 1013 - 1024.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. C. Gray, J. Kuchtey, and C. V. Harding
CpG-B ODNs potently induce low levels of IFN-{alpha}{beta} and induce IFN-{alpha}{beta}-dependent MHC-I cross-presentation in DCs as effectively as CpG-A and CpG-C ODNs
J. Leukoc. Biol., April 1, 2007; 81(4): 1075 - 1085.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Berghofer, G. Haley, T. Frommer, G. Bein, and H. Hackstein
Natural and Synthetic TLR7 Ligands Inhibit CpG-A- and CpG-C-Oligodeoxynucleotide-Induced IFN-{alpha} Production
J. Immunol., April 1, 2007; 178(7): 4072 - 4079.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Stanley, J. E. Johndrow, P. Manzanillo, and J. S. Cox
The Type I IFN Response to Infection with Mycobacterium tuberculosis Requires ESX-1-Mediated Secretion and Contributes to Pathogenesis
J. Immunol., March 1, 2007; 178(5): 3143 - 3152.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Inoue and Y. Aramaki
Suppression of Skin Lesions by Transdermal Application of CpG-Oligodeoxynucleotides in NC/Nga Mice, a Model of Human Atopic Dermatitis
J. Immunol., January 1, 2007; 178(1): 584 - 591.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Boonstra, R. Rajsbaum, M. Holman, R. Marques, C. Asselin-Paturel, J. P. Pereira, E. E. M. Bates, S. Akira, P. Vieira, Y.-J. Liu, et al.
Macrophages and Myeloid Dendritic Cells, but Not Plasmacytoid Dendritic Cells, Produce IL-10 in Response to MyD88- and TRIF-Dependent TLR Signals, and TLR-Independent Signals
J. Immunol., December 1, 2006; 177(11): 7551 - 7558.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. P. Sester, K. Brion, A. Trieu, H. S. Goodridge, T. L. Roberts, J. Dunn, D. A. Hume, K. J. Stacey, and M. J. Sweet
CpG DNA Activates Survival in Murine Macrophages through TLR9 and the Phosphatidylinositol 3-Kinase-Akt Pathway
J. Immunol., October 1, 2006; 177(7): 4473 - 4480.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Osawa, S. Iho, R. Takauji, H. Takatsuka, S. Yamamoto, T. Takahashi, S. Horiguchi, Y. Urasaki, T. Matsuki, and S. Fujieda
Collaborative Action of NF-{kappa}B and p38 MAPK Is Involved in CpG DNA-Induced IFN-{alpha} and Chemokine Production in Human Plasmacytoid Dendritic Cells
J. Immunol., October 1, 2006; 177(7): 4841 - 4852.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Gursel, I. Gursel, H. S. Mostowski, and D. M. Klinman
CXCL16 Influences the Nature and Specificity of CpG-Induced Immune Activation
J. Immunol., August 1, 2006; 177(3): 1575 - 1580.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
M. A. Merrell, J. M. Ilvesaro, N. Lehtonen, T. Sorsa, B. Gehrs, E. Rosenthal, D. Chen, B. Shackley, K. W. Harris, and K. S. Selander
Toll-Like Receptor 9 Agonists Promote Cellular Invasion by Increasing Matrix Metalloproteinase Activity
Mol. Cancer Res., July 1, 2006; 4(7): 437 - 447.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Esen and T. Kielian
Central Role for MyD88 in the Responses of Microglia to Pathogen-Associated Molecular Patterns.
J. Immunol., June 1, 2006; 176(11): 6802 - 6811.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Z. Guo, S. Garg, K. M. Hill, L. Jayashankar, M. R. Mooney, M. Hoelscher, J. M. Katz, J. M. Boss, and S. Sambhara
A Distal Regulatory Region Is Required for Constitutive and IFN-{beta}-Induced Expression of Murine TLR9 Gene
J. Immunol., December 1, 2005; 175(11): 7407 - 7418.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Delale, A. Paquin, C. Asselin-Paturel, M. Dalod, G. Brizard, E. E. M. Bates, P. Kastner, S. Chan, S. Akira, A. Vicari, et al.
MyD88-Dependent and -Independent Murine Cytomegalovirus Sensing for IFN-{alpha} Release and Initiation of Immune Responses In Vivo
J. Immunol., November 15, 2005; 175(10): 6723 - 6732.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. E. Butler, D. H. Francis, J. Freeling, P. Weber, and A. M. Krieg
Antibody Repertoire Development in Fetal and Neonatal Piglets. IX. Three Pathogen-Associated Molecular Patterns Act Synergistically to Allow Germfree Piglets to Respond to Type 2 Thymus-Independent and Thymus-Dependent Antigens
J. Immunol., November 15, 2005; 175(10): 6772 - 6785.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. A. Hughes, C. S. Green, L. Lowchyj, G. M. Lee, V. K. Grippe, M. F. Smith Jr., L.-Y. Huang, E. T. Harvill, and T. J. Merkel
MyD88-Dependent Signaling Contributes to Protection following Bacillus anthracis Spore Challenge of Mice: Implications for Toll-Like Receptor Signaling
Infect. Immun., November 1, 2005; 73(11): 7535 - 7540.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L.-Y. Huang, K. J. Ishii, S. Akira, J. Aliberti, and B. Golding
Th1-Like Cytokine Induction by Heat-Killed Brucella abortus Is Dependent on Triggering of TLR9
J. Immunol., September 15, 2005; 175(6): 3964 - 3970.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S. B. Pruett, Q. Zheng, C. Schwab, and R. Fan
Sodium Methyldithiocarbamate Inhibits MAP Kinase Activation through Toll-like Receptor 4, Alters Cytokine Production by Mouse Peritoneal Macrophages, and Suppresses Innate Immunity
Toxicol. Sci., September 1, 2005; 87(1): 75 - 85.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Shi, A. Blumenthal, C. M. Hickey, S. Gandotra, D. Levy, and S. Ehrt
Expression of Many Immunologically Important Genes in Mycobacterium tuberculosis-Infected Macrophages Is Independent of Both TLR2 and TLR4 but Dependent on IFN-{alpha}{beta} Receptor and STAT1
J. Immunol., September 1, 2005; 175(5): 3318 - 3328.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
U. M. Nagarajan, D. M. Ojcius, L. Stahl, R. G. Rank, and T. Darville
Chlamydia trachomatis Induces Expression of IFN-{gamma}-Inducible Protein 10 and IFN-{beta} Independent of TLR2 and TLR4, but Largely Dependent on MyD88
J. Immunol., July 1, 2005; 175(1): 450 - 460.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
G. Gautier, M. Humbert, F. Deauvieau, M. Scuiller, J. Hiscott, E. E.M. Bates, G. Trinchieri, C. Caux, and P. Garrone
A type I interferon autocrine-paracrine loop is involved in Toll-like receptor-induced interleukin-12p70 secretion by dendritic cells
J. Exp. Med., May 2, 2005; 201(9): 1435 - 1446.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
K. Abel, Y. Wang, L. Fritts, E. Sanchez, E. Chung, P. Fitzgerald-Bocarsly, A. M. Krieg, and C. J. Miller
Deoxycytidyl-Deoxyguanosine Oligonucleotide Classes A, B, and C Induce Distinct Cytokine Gene Expression Patterns in Rhesus Monkey Peripheral Blood Mononuclear Cells and Distinct Alpha Interferon Responses in TLR9-Expressing Rhesus Monkey Plasmacytoid Dendritic Cells
Clin. Vaccine Immunol., May 1, 2005; 12(5): 606 - 621.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Schlender, V. Hornung, S. Finke, M. Gunthner-Biller, S. Marozin, K. Brzozka, S. Moghim, S. Endres, G. Hartmann, and K.-K. Conzelmann
Inhibition of Toll-Like Receptor 7- and 9-Mediated Alpha/Beta Interferon Production in Human Plasmacytoid Dendritic Cells by Respiratory Syncytial Virus and Measles Virus
J. Virol., May 1, 2005; 79(9): 5507 - 5515.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
K. Suzuki, T. Suda, T. Naito, K. Ide, K. Chida, and H. Nakamura
Impaired Toll-like Receptor 9 Expression in Alveolar Macrophages with No Sensitivity to CpG DNA
Am. J. Respir. Crit. Care Med., April 1, 2005; 171(7): 707 - 713.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Uematsu, S. Sato, M. Yamamoto, T. Hirotani, H. Kato, F. Takeshita, M. Matsuda, C. Coban, K. J. Ishii, T. Kawai, et al.
Interleukin-1 receptor-associated kinase-1 plays an essential role for Toll-like receptor (TLR)7- and TLR9-mediated interferon-{alpha} induction
J. Exp. Med., March 21, 2005; 201(6): 915 - 923.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Brummel and P. Lenert
Activation of Marginal Zone B Cells from Lupus Mice with Type A(D) CpG-Oligodeoxynucleotides
J. Immunol., February 15, 2005; 174(4): 2429 - 2434.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. McKenna, A.-S. Beignon, and N. Bhardwaj
Plasmacytoid Dendritic Cells: Linking Innate and Adaptive Immunity
J. Virol., January 1, 2005; 79(1): 17 - 27.
[Full Text] [PDF]


Home page
Int ImmunolHome page
K. Takeda and S. Akira
Toll-like receptors in innate immunity
Int. Immunol., January 1, 2005; 17(1): 1 - 14.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Honda, H. Yanai, T. Mizutani, H. Negishi, N. Shimada, N. Suzuki, Y. Ohba, A. Takaoka, W.-C. Yeh, and T. Taniguchi
Role of a transductional-transcriptional processor complex involving MyD88 and IRF-7 in Toll-like receptor signaling
PNAS, October 26, 2004; 101(43): 15416 - 15421.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. Vollmer, R. D. Weeratna, M. Jurk, H. L. Davis, C. Schetter, M. Wullner, T. Wader, M. Liu, A. Kritzler, and A. M. Krieg
Impact of modifications of heterocyclic bases in CpG dinucleotides on their immune-modulatory activity
J. Leukoc. Biol., September 1, 2004; 76(3): 585 - 593.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Takeshita, K. Suzuki, S. Sasaki, N. Ishii, D. M. Klinman, and K. J. Ishii
Transcriptional Regulation of the Human TLR9 Gene
J. Immunol., August 15, 2004; 173(4): 2552 - 2561.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Hochrein, B. Schlatter, M. O'Keeffe, C. Wagner, F. Schmitz, M. Schiemann, S. Bauer, M. Suter, and H. Wagner
Herpes simplex virus type-1 induces IFN-{alpha} production via Toll-like receptor 9-dependent and -independent pathways
PNAS, August 3, 2004; 101(31): 11416 - 11421.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Diao, E. Winter, W. Chen, C. Cantin, and M. S. Cattral
Characterization of Distinct Conventional and Plasmacytoid Dendritic Cell-Committed Precursors in Murine Bone Marrow
J. Immunol., August 1, 2004; 173(3): 1826 - 1833.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. G. Rothfuchs, C. Trumstedt, H. Wigzell, and M. E. Rottenberg
Intracellular Bacterial Infection-Induced IFN-{gamma} Is Critically but Not Solely Dependent on Toll-Like Receptor 4-Myeloid Differentiation Factor 88-IFN-{alpha}{beta}-STAT1 Signaling
J. Immunol., May 15, 2004; 172(10): 6345 - 6353.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. B. Conant and R. H. Swanborg
Autoreactive T Cells Persist in Rats Protected against Experimental Autoimmune Encephalomyelitis and Can Be Activated through Stimulation of Innate Immunity
J. Immunol., May 1, 2004; 172(9): 5322 - 5328.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
K. Hoebe and B. Beutler
LPS, dsRNA and the interferon bridge to adaptive immune responses: Trif, Tram, and other TIR adaptor proteins
Innate Immunity, April 1, 2004; 10(2): 130 - 136.
[Abstract] [PDF]


Home page
JEMHome page
M. Salio, M. J. Palmowski, A. Atzberger, I. F. Hermans, and V. Cerundolo
CpG-matured Murine Plasmacytoid Dendritic Cells Are Capable of In Vivo Priming of Functional CD8 T Cell Responses to Endogenous but Not Exogenous Antigens
J. Exp. Med., February 17, 2004; 199(4): 567 - 579.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Schirmbeck, P. Riedl, R. Zurbriggen, S. Akira, and J. Reimann
Antigenic Epitopes Fused to Cationic Peptide Bound to Oligonucleotides Facilitate Toll-Like Receptor 9-Dependent, but CD4+ T Cell Help-Independent, Priming of CD8+ T Cells
J. Immunol., November 15, 2003; 171(10): 5198 - 5207.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hemmi, H.
Right arrow Articles by Akira, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hemmi, H.
Right arrow Articles by Akira, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS