| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,
* Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, and
Solution-Oriented Research for Science and Technology, Japan Science and Technology Corp., Suita, Osaka, Japan; and
RIKEN Research Center for Allergy and Immunology, Yokohama, Kanagawa, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production. Conventional CpG DNAs can exert their activity through Toll-like receptor 9 (TLR9) signaling, which depends on a cytoplasmic adapter, MyD88. However, it remains unknown how A/D-type CpG DNAs exhibit their immunostimulatory function. In this study we have investigated murine dendritic cell (DC) responses to these two distinct CpG DNAs. Not only splenic, but also in vitro bone marrow-derived, DCs could produce larger amounts of IFN- in response to A/D-type CpG DNAs compared with conventional CpG DNAs. This IFN- production was mainly due to the B220+ DC subset. On the other hand, the B220- DC subset responded similarly to both CpG DNAs in terms of costimulatory molecule up-regulation and IL-12 induction. IFN-, but not IL-12, induction was dependent on type I IFN. However, all activities of both CpG DNAs were abolished in TLR9- and MyD88-, but were retained in DNA-PKcs-deficient DCs. This study demonstrates that the TLR9-MyD88 signaling pathway is essential for all DC responses to both types of CpG DNAs. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production from plasmacytoid DC (PDC) and IFN-
from NK cells (5, 6). We previously demonstrated that Toll-like receptor 9 (TLR9) is essential for CpG DNA-induced immune responses based on the fact that TLR9-deficient (TLR9-/-) mice are refractory to CpG DNAs (8). In addition, TLR9 expression is sufficient to confer responsiveness to CpG DNA on a human kidney cell line (9, 10). Some CpG DNAs can activate human immune cells more efficiently than murine ones, while others can activate murine cells more effectively than human ones. This species-specific response is reconstituted by the expression of human or murine TLR9 on an otherwise refractory cell line, suggesting that TLR9 is also critical for the species-specific function of CpG DNAs (9). However, because all these experiments were performed with conventional CpG DNAs, the cellular and molecular mechanisms of how immune cells are activated by A/D-type CpG DNAs remain unelucidated.
In this study we have investigated how these CpG DNAs activate DCs, which play crucial roles in host defense by linking innate and adaptive immunities. Both types of CpG DNAs could induce IL-12 secretion from DCs. However, compared with conventional CpG DNAs, A/D-type CpG DNAs could induce greater amounts of IFN- production from DCs. A B220+ DC subset, which is considered to be a murine counterpart of human PDC, was mainly responsible for IFN- production induced by CpG DNAs. Both conventional and A/D-type CpG DNAs required the TLR9 signaling system and could induce IFN regulatory factor 7 (IRF7) mRNA up-regulation at similar levels. Thus, common signaling pathways are involved in the effects of distinct types of CpG DNAs on murine DC subsets.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C57BL/6J mice were purchased from CLEA Japan, Inc. (Tokyo, Japan). MyD88-deficient (MyD88-/-) mice were established as described previously (11) and backcrossed over eight times with C57BL/6 mice. TLR9-/- mice were generated as described previously (8). DNA-dependent protein kinase catalytic subunit-deficient (DNA-PKcs-/-) mice were provided by Dr. F. W. Alt (Harvard Medical School, Boston, MA) (12). IFN-/
R-deficient (IFN-/R-/-) mice were purchased from B&K Universal Ltd. (Hull, U.K.).
Reagents and Abs
Synthesized oligodeoxynucleotides were purchased from Hokkaido System Science (Sapporo, Japan). The sequences and backbones of oligodeoxynucleotides are: ODN1668, tccatgacgttcctgatgct (13); D19, ggTGCATCGATGCAgggggG (4); and control D, ggTGCATGCATGCAgggggG (4). Capital and lowercase letters in parentheses indicate bases with phosphodiester and phosphorothioate-modified backbones, respectively. Abs against mouse CD11c (clone HL3), CD40 (clone 3/23), CD86 (clone GL1), and B220 (clone RA3-6B2) were purchased from BD PharMingen (San Diego, CA)
Preparation of DCs
To prepare splenocytes containing DCs, spleens were cut unto small fragments and incubated with RPMI 1640 medium containing 400 U/ml collagenase (Wako Pure Chemical Industries, Osaka, Japan) and 15 µg/ml DNase (Sigma-Aldrich, St. Louis, MO) at 37°C for 20 min. For the last 5 min, EDTA was added at 5 mM. Single-cell suspensions were prepared after RBC lysis. CD11c+ cells were purified by MACS with anti-CD11c microbeads and used as splenic DCs. Enriched cells contained >90% CD11c+ cells.
To prepare in vitro bone marrow-derived DCs (BMDCs), BM cells were prepared from femora and tibia and passed through nylon mesh. Then cells were cultured in RPMI 1640 medium supplemented with 10% FCS, 100 µM 2-ME, and 100 ng/ml human Flt3 ligand (Flt3L; PeproTech EC, London, U.K.). After 6–8 days, the cells were used as Flt3L-induced BMDCs (Flt3L-BMDCs) for additional experiments. Flt3L-BMDCs on days 6–8 contained 80–90% CD11c+ cells, as described previously (14).
Flow cytometry
Splenic CD11c+DCs or Flt3L-BMDCs were first incubated with biotinylated anti-CD11c and then with PE-conjugated anti-B220 and CyChrome-conjugated streptavidin. As indicated in Fig. 2, B220+ and B220- cells were sorted using a FACSVantage (BD Bioscience, Mountain View, CA).
|
Measurement of cytokine production
Cells were seeded into 96-well plates at 2 x 106 cells/ml, or as otherwise indicated, in RPMI 1640 with 10% FCS and stimulated with various doses of synthesized oligodeoxynucleotides for 24 h. Culture supernatants were collected and analyzed for cytokine production. Cytokine concentrations in the supernatants were measured with ELISA. ELISA kits for mouse IFN- were purchased from PBL Biomedical Laboratories (New Brunswick, NJ). ELISA kits for mouse TNF- and IL-12 p40 were obtained from TECHNE Corp. (Minneapolis, MN).
Northern blot analysis
Total RNAs were isolated using Sepazol-RNA I (Nacalai Tesque, Kyoto, Japan), electrophoresed, and transferred to nylon membranes. Hybridization was performed with the indicated cDNA probes as described previously (11). cDNA probes specific for IFN-, IL-12 p40, and IRF7 were obtained though the previously published subtractive screenings (15). The IFN- probe is an EcoRI-HindIII fragment of the murine IFN-4 and detects multiple IFN- subtypes (16).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We first evaluated CpG DNA-induced production of cytokines in splenic CD11c+ DCs (Fig. 1A). D19 and ODN1668 were chosen as representatives of A/D-type and conventional CpG DNAs, respectively. Both increased the production of TNF- and IL-12 p40 from splenic DCs in a dose-dependent manner, although D19 needed higher concentrations than ODN1668 to achieve comparable levels of cytokine production (Fig. 1).
|
production of CpG DNA-stimulated splenic DCs. D19-induced IFN- secretion was detected above a concentration of 0.1 µM and increased in a dose-dependent manner. ODN1668 could also induce IFN-, but the production was only detected at concentrations of 0.01–0.3 µM and was abolished at higher concentrations. Furthermore, the maximal induction was much less than that of D19-stimulated DCs. Thus, ODN1668 and D19 have differential activities on mouse DCs in terms of IFN- production.
In the presence of Flt3L, CD11c+ cells, including IFN--producing cells, can be generated in vitro from BM cells (14). We next tested the responses of Flt3L-BMDCs to D19 and ODN1668. These DCs could also produce TNF- and IL-12p40 in response to D19 or ODN1668. Similar to splenic DCs, Flt3L-BMDCs also responded better to ODN1668 than to D19. D19 could induce Flt3L-BMDCs to produce IFN- in a dose-dependent manner, while ODN1668 induced small amounts of IFN- only at 0.01–0.3 µM. Taken together, not only splenic CD11c+, but also in vitro DCs, differentially responded to the two types of CpG DNAs in a similar manner.
B220+ CD11c+ cells are major IFN--producing cells in response to D19
DCs can be divided into subsets according to their surface molecule expression profiles (17). Among splenic DC subsets, B220+CD11cdull cells show a unique ability to produce IFN- upon viral infection (18, 19, 20, 21). To characterize the cell population involved in cytokine production from CpG DNA-stimulated splenic DCs, we purified B220+CD11cdull and B220-CD11chigh cells by cell sorting and analyzed their responses to ODN1668 or D19 (Fig. 2A). In response to ODN1668, both B220+CD11cdull and B220-CD11chigh cells produced IL-12 and enhanced their surface expression of CD40 and CD86. Neither population produced detectable levels of IFN- in response to 3 µM ODN1668. In the case of D19 stimulation, both populations showed increased expression of costimulatory molecules. However, B220-CD11chigh cells produced IL-12, but not IFN-, whereas B220+CD11cdull cells produced IFN-, but not IL-12.
Flt3L-BMDCs can also be divided into two subsets according to B220 expression (14). We next tested the responses of these subpopulations to CpG DNAs. The B220+ and B220- cells in Flt3L-BMDCs responded to the two types of CpG DNAs in a manner similar to that of splenic B220+CD11cdull and B220-CD11chigh cells, respectively (Fig. 2B). Thus, ODN1668 could activate both populations indistinguishably, whereas D19 showed differential cytokine-inducing ability in the two populations.
IFN- production in response to D19 is dependent on TLR9 and MyD88
TLR9 or its cytoplasmic adapter, MyD88, is essential for conventional CpG DNA signaling (8, 22, 23). We next investigated whether the two types of CpG DNAs show any differences in their dependency on TLR9 or MyD88. Among splenocytes, CD11c+ cells were mainly involved in IFN- production in response to D19 (Fig. 3A). This IFN- production was completely abolished in the absence of TLR9 or MyD88. Furthermore, whole and CD11c+ splenocytes from TLR9-/- or MyD88-/- mice lacked both ODN1668- and D19-induced IL-12 production (Fig. 3A).
|
production in response to D19 as well as that to 0.03 µM ODN1668 were completely abolished in the mutant Flt3L-BMDCs. Thus, the ability of both conventional and A/D-type CpG DNAs to induce cytokine production from in vivo and in vitro DCs was dependent on TLR9 and MyD88. DNA-PKcs is not essential for responses to CpG DNA
It has been reported that DNA-PKcs is necessary for cytokine production in response to CpG DNAs, because DNA-PKcs-/- cells lacked the response (24). We next examined cytokine production of DNA-PKcs-/- cells in response to CpG DNAs. DNA-PKcs-/- mice lack mature B and T cell population due to defective DNA recombination (12, 25). Therefore, CD11c+ cells were isolated by MACS from wild-type and mutant splenocytes. Splenic CD11c+ cells were stimulated with D19 or ODN1668 for 24 h and analyzed for their cytokine production (Fig. 4A). DNA-PKcs-/- CD11c+ cells retained the ability to produce IFN- and IL-12 in response to CpG DNAs.
|
in response to D19 (Fig. 4B). Thus, these results clearly indicated that DNA-PKcs are dispensable for all immunostimulatory effects of both types of CpG DNAs. Northern blot analysis of CpG DNA-stimulated DCs
IRF7 expression is induced by type I IFNs or viral infection and involved in type I IFN production (16, 26, 27). Therefore, we examined whether the IRF7 mRNA is differentially induced by the two types of CpG DNAs. As shown in Fig. 5A, IRF7 mRNA induction was observed in D19-stimulated Flt3L-DCs. ODN1668 also up-regulated IRF7 mRNA expression at both low and high concentrations with similar kinetics and levels as D19, although induction of IFN- and IFN- mRNA was abolished in DCs stimulated with high concentrations of ODN1668.
|
/ (27). Therefore, we analyzed gene expression of CpG DNA-stimulated IFN-/R-deficient (IFN-/R-/-) DCs. IL-12p40 mRNA induction by both CpG DNAs was retained in IFN-/R-/- DCs (Fig. 5B). However, IFN-/ mRNA up-regulation by D19 was abolished in the absence of IFN-/R (Fig. 5B), indicating the critical involvement of type I IFN signaling in type I IFN production induced by D19. Furthermore, IRF7 mRNA induction by D19 as well as by ODN1668 was abolished in the absence of IFN-/R. This suggests that type I IFN signaling is essential for IRF7 mRNA induction even in ODN1668-stimulated DCs. These data, however, indicate that the loss of IFN- mRNA induction at higher doses of ODN1668 may not be due to a decrease in IRF7 induction. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production from CD11c+ cells. Splenic CD11c+ cells can be divided into two populations, B220+CD11cdull and B220-CD11chigh cells. The former cells were identified as IFN--producing cells during viral infection (18, 19, 20). We found that A/D-type CpG DNAs also stimulated B220+CD11cdull cells to induce IFN- production. B220+CD11cdull cells could also produce significant, but smaller, amounts of IFN- by conventional CpG DNAs only at low doses, while B220-CD11chigh cells did not (data not shown). Interestingly, although B220-CD11chigh cells secreted similar amounts of IL-12 in response to the two types of CpG DNAs, B220+CD11cdull cells produced smaller amounts of IL-12 when stimulated with A/D-type CpG DNAs than with conventional CpG DNAs. Meanwhile, costimulatory molecule expression in B220+CD11cdull and B220-CD11chigh cells was comparatively up-regulated by both types of CpG DNAs. These results suggest that differential responses to conventional or A/D-type CpG DNAs are observed in cytokine-producing ability, but not in the ability to enhance costimulatory molecule expression. Notably, B220-CD11chigh cells, which cannot produce IFN-, responded to the two types of CpG DNAs in an indistinguishable manner. Thus, the differential ability of DCs to produce cytokines in response to conventional or A/D-type CpG DNAs is based on the characteristics of B220+CD11cdull cells.
At present we do not know how TLR9 can transduce such differential activity depending on the ligand. Klinman et al. (7) have shown that TLR9 overexpression can render a human kidney cell line responsive to conventional CpG DNAs, but not to A/D-type CpG DNAs. This suggests that TLR9 is not sufficient for transducing the A/D-type CpG DNA signal, and that another molecule(s) cooperatively functions to induce IFN- production with TLR9. It is assumed that oligodeoxynucleotides are incorporated into cells through a pathway not requiring any specific sequences and that only CpG DNAs can bind to TLR9 and trigger TLR9 signaling in the endosome (10, 28). However, confocal microscopic analysis revealed that conventional and A/D-CpG DNAs are destined for different cell compartments (29). Such differential behavior of CpG DNAs might lead to the induction of distinct cytokines. It is also possible that differential TLR9 responses are caused by coligation of other transmembrane proteins. In this context, it is noteworthy that scavenger receptor A (SR-A) can bind to the polyG stretch and that SR-A ligands can inhibit the binding of CpG DNAs containing the polyG stretch to splenic CD11c+ DCs (30). However, it remains unknown whether SR-A is involved in DC responses caused by A/D-type CpG DNAs.
DNA-PKcs was suggested as a signaling molecule for CpG DNA-induced immune responses (24). However, a recent report has shown that DNA-PKcs is not essential for CpG DNA responses (31). Our present results are consistent with the latter report and further show that the enzyme is dispensable not only for conventional, but also for A/D-type, CpG DNAs-induced signaling. In addition, MyD88-/- and TLR9-/- cells lacked any response to either type of CpG DNAs (Fig. 3). Thus, CpG DNAs can manifest their multiple immunostimulatory functions through the TLR9-MyD88-dependent pathway.
Viral infection can induce type I IFN production that is vigorously amplified by type I IFN itself (32, 33). IFN-/R-/- cells decreased their ability to produce IFN- in response to A/D-type CpG DNAs, indicating that type I IFN signaling is also involved in TLR9-induced IFN- production. IRF7 mRNA can be induced by type I IFN. The induction was suggested to be critical for IFN- production through the analysis of IRF-9-deficient mice that lack IRF7 mRNA induction (27). However, wild-type DCs could produce similarly increased levels of IRF7 mRNA expression in response to 3 µM ODN1668, although IFN- production was profoundly decreased (Fig. 5). Thus, IRF7 mRNA induction is not sufficient for TLR9-induced IFN- production.
In response to 3 µM ODN1668, low levels of type I IFN mRNA expression can be induced at 1 h, but the induction rapidly declines at later time points. Meanwhile, at 0.03 µM ODN1668 the induction comes later and reaches comparable levels as with D19. These results suggest the possibility that a high concentration of ODN1668 induces unknown negative feedback mechanism resulting in the abolishment of type I IFN gene expression. Further studies are necessary to clarify how TLR9 induces differential responses depending on its ligands.
Among TLR family members, TLR7 is closely related to TLR9 based on their molecular structures. In humans, TLR7 and TLR9 are expressed on a subset of DCs, PDC. Activation of TLR7 or TLR9 enhances the survival of DCs and the expression of surface molecules, such as costimulatory molecules and MHC class II. Thus, TLR7 and TLR9 have common features in their molecular structures and functions. While TLR9 is expressed exclusively on PDC, TLR7 is also expressed on another subset, myeloid DC. Experiments with TLR7 ligands clarified that TLR7 signaling can differentially induce IFN- and IL-12 from PDC and myeloid DC, respectively (34). The mechanism is unknown at present, but it is intriguing that murine TLR9 and the human TLR7 systems are well conserved in differential cytokine inducibility depending on DC subsets. Another intriguing point is that murine B220+CD11cdull cells do not produce high levels of IL-12 in response to D19, although they can in response to ODN1668. This is in contrast to the human TLR7 system, because human PDC cannot produce IL-12 in response to any stimuli. IFN- can inhibit IL-12 production (35), but that cannot account for the inability of A/D-type CpG DNA-stimulated B220+CD11cdull cells to produce IL-12, because costimulation with IFN- and ODN1668 did not decrease IL-12 production from B220-CD11chigh cells (data not shown). Furthermore, type I IFN-neutralizing Abs could not increase IL-12 production from D19-treated B220+CD11cdull cells (data not shown). Thus, it is unlikely that IFN- production induced by D19 prevents B220+CD11cdull cells from producing IL-12.
The present study has revealed subset-dependent responses of murine DCs to distinct types of CpG DNA. Further clarification of the underlying molecular mechanisms should contribute to elucidating how DCs are activated by CpG DNAs and to developing efficient vaccination strategies with CpG DNAs.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Shizuo Akira, Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan. E-mail address: sakira{at}biken.osaka-u.ac.jp
3 Abbreviations used in this paper: DC, dendritic cell; BM, bone marrow; CpG DNA, oligodeoxynucleotides containing the unmethylated CpG motif; DNA-PKcs, DNA-dependent protein kinase catalytic subunit; Flt3L, Flt3 ligand; IRF7, IFN regulatory factor 7; PDC, plasmacytoid DC; polyG, polyguanosine; SR-A, scavenger receptor A; TLR, Toll-like receptor.
Received for publication November 8, 2002. Accepted for publication January 15, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/ in plasmacytoid dendritic cells. Eur. J. Immunol. 31:2154.[Medline]
/ gene induction. Immunity. 13:539.[Medline]
+ B220+ dendritic cells endowed with type 1 interferon production capacity and tolerogenic potential. Blood 100:383. genes by positive feedback through interferon regulatory factor-7. EMBO J. 17:6660.[Medline]
and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J. Exp. Med. 195:1507. and as immune regulators: a new look. Immunity 14:661.[Medline]Related articles in The JI:
This article has been cited by other articles:
|
|
 |
|
  G. K. Chege, E. G. Shephard, A. Meyers, J. van Harmelen, C. Williamson, A. Lynch, C. M. Gray, E. P. Rybicki, and A.-L. Williamson HIV-1 subtype C Pr55gag virus-like particle vaccine efficiently boosts baboons primed with a matched DNA vaccine J. Gen. Virol., September 1, 2008; 89(9): 2214 - 2227. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-L. Baron, D. Gauchat, R. La Motte-Mohs, N. Kettaf, A. Abdallah, T. Michiels, J.-C. Zuniga-Pflucker, and R.-P. Sekaly TLR Ligand-Induced Type I IFNs Affect Thymopoiesis J. Immunol., June 1, 2008; 180(11): 7134 - 7146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yotsumoto, K. Saegusa, and Y. Aramaki Endosomal Translocation of CpG-Oligodeoxynucleotides Inhibits DNA-PKcs-Dependent IL-10 Production in Macrophages J. Immunol., January 15, 2008; 180(2): 809 - 816. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Oganesyan, S. K. Saha, E. M. Pietras, B. Guo, A. K. Miyahira, B. Zarnegar, and G. Cheng IRF3-dependent Type I Interferon Response in B Cells Regulates CpG-mediated Antibody Production J. Biol. Chem., January 11, 2008; 283(2): 802 - 808. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Sugiyama, K. Hoshino, M. Saito, T. Yano, I. Sasaki, C. Yamazaki, S. Akira, and T. Kaisho Immunoadjuvant effects of polyadenylic:polyuridylic acids through TLR3 and TLR7 Int. Immunol., January 1, 2008; 20(1): 1 - 9. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Phipps, C. E. Lam, S. Mahalingam, M. Newhouse, R. Ramirez, H. F. Rosenberg, P. S. Foster, and K. I. Matthaei Eosinophils contribute to innate antiviral immunity and promote clearance of respiratory syncytial virus Blood, September 1, 2007; 110(5): 1578 - 1586. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Trumstedt, E. Eriksson, A. M. Lundberg, T.-b. Yang, Z.-q. Yan, H. Wigzell, and M. E. Rottenberg Role of IRAK4 and IRF3 in the control of intracellular infection with Chlamydia pneumoniae J. Leukoc. Biol., June 1, 2007; 81(6): 1591 - 1598. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yasuda, C. Richez, J. W. Maciaszek, N. Agrawal, S. Akira, A. Marshak-Rothstein, and I. R. Rifkin Murine Dendritic Cell Type I IFN Production Induced by Human IgG-RNA Immune Complexes Is IFN Regulatory Factor (IRF)5 and IRF7 Dependent and Is Required for IL-6 Production J. Immunol., June 1, 2007; 178(11): 6876 - 6885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Uematsu and S. Akira Toll-like Receptors and Type I Interferons J. Biol. Chem., May 25, 2007; 282(21): 15319 - 15323. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kawagoe, S. Sato, A. Jung, M. Yamamoto, K. Matsui, H. Kato, S. Uematsu, O. Takeuchi, and S. Akira Essential role of IRAK-4 protein and its kinase activity in Toll-like receptor-mediated immune responses but not in TCR signaling J. Exp. Med., May 14, 2007; 204(5): 1013 - 1024. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. C. Gray, J. Kuchtey, and C. V. Harding CpG-B ODNs potently induce low levels of IFN-{alpha}{beta} and induce IFN-{alpha}{beta}-dependent MHC-I cross-presentation in DCs as effectively as CpG-A and CpG-C ODNs J. Leukoc. Biol., April 1, 2007; 81(4): 1075 - 1085. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Berghofer, G. Haley, T. Frommer, G. Bein, and H. Hackstein Natural and Synthetic TLR7 Ligands Inhibit CpG-A- and CpG-C-Oligodeoxynucleotide-Induced IFN-{alpha} Production J. Immunol., April 1, 2007; 178(7): 4072 - 4079. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Stanley, J. E. Johndrow, P. Manzanillo, and J. S. Cox The Type I IFN Response to Infection with Mycobacterium tuberculosis Requires ESX-1-Mediated Secretion and Contributes to Pathogenesis J. Immunol., March 1, 2007; 178(5): 3143 - 3152. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Inoue and Y. Aramaki Suppression of Skin Lesions by Transdermal Application of CpG-Oligodeoxynucleotides in NC/Nga Mice, a Model of Human Atopic Dermatitis J. Immunol., January 1, 2007; 178(1): 584 - 591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Boonstra, R. Rajsbaum, M. Holman, R. Marques, C. Asselin-Paturel, J. P. Pereira, E. E. M. Bates, S. Akira, P. Vieira, Y.-J. Liu, et al. Macrophages and Myeloid Dendritic Cells, but Not Plasmacytoid Dendritic Cells, Produce IL-10 in Response to MyD88- and TRIF-Dependent TLR Signals, and TLR-Independent Signals J. Immunol., December 1, 2006; 177(11): 7551 - 7558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Sester, K. Brion, A. Trieu, H. S. Goodridge, T. L. Roberts, J. Dunn, D. A. Hume, K. J. Stacey, and M. J. Sweet CpG DNA Activates Survival in Murine Macrophages through TLR9 and the Phosphatidylinositol 3-Kinase-Akt Pathway J. Immunol., October 1, 2006; 177(7): 4473 - 4480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Osawa, S. Iho, R. Takauji, H. Takatsuka, S. Yamamoto, T. Takahashi, S. Horiguchi, Y. Urasaki, T. Matsuki, and S. Fujieda Collaborative Action of NF-{kappa}B and p38 MAPK Is Involved in CpG DNA-Induced IFN-{alpha} and Chemokine Production in Human Plasmacytoid Dendritic Cells J. Immunol., October 1, 2006; 177(7): 4841 - 4852. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gursel, I. Gursel, H. S. Mostowski, and D. M. Klinman CXCL16 Influences the Nature and Specificity of CpG-Induced Immune Activation J. Immunol., August 1, 2006; 177(3): 1575 - 1580. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Merrell, J. M. Ilvesaro, N. Lehtonen, T. Sorsa, B. Gehrs, E. Rosenthal, D. Chen, B. Shackley, K. W. Harris, and K. S. Selander Toll-Like Receptor 9 Agonists Promote Cellular Invasion by Increasing Matrix Metalloproteinase Activity Mol. Cancer Res., July 1, 2006; 4(7): 437 - 447. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Esen and T. Kielian Central Role for MyD88 in the Responses of Microglia to Pathogen-Associated Molecular Patterns. J. Immunol., June 1, 2006; 176(11): 6802 - 6811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Guo, S. Garg, K. M. Hill, L. Jayashankar, M. R. Mooney, M. Hoelscher, J. M. Katz, J. M. Boss, and S. Sambhara A Distal Regulatory Region Is Required for Constitutive and IFN-{beta}-Induced Expression of Murine TLR9 Gene J. Immunol., December 1, 2005; 175(11): 7407 - 7418. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Delale, A. Paquin, C. Asselin-Paturel, M. Dalod, G. Brizard, E. E. M. Bates, P. Kastner, S. Chan, S. Akira, A. Vicari, et al. MyD88-Dependent and -Independent Murine Cytomegalovirus Sensing for IFN-{alpha} Release and Initiation of Immune Responses In Vivo J. Immunol., November 15, 2005; 175(10): 6723 - 6732. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Butler, D. H. Francis, J. Freeling, P. Weber, and A. M. Krieg Antibody Repertoire Development in Fetal and Neonatal Piglets. IX. Three Pathogen-Associated Molecular Patterns Act Synergistically to Allow Germfree Piglets to Respond to Type 2 Thymus-Independent and Thymus-Dependent Antigens J. Immunol., November 15, 2005; 175(10): 6772 - 6785. [Abstract] [Full Text] [PDF]
|
|
|
