| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
T Cells in Lyme Arthritis 1
Departments of
*
Medicine (Immunobiology) and
Pathology, The University of Vermont College of Medicine, Burlington, VT 05405; and
Department of Medicine, University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, New Brunswick, NJ 08903
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T cells accumulate at epithelial barriers and at sites of inflammation in various infectious and autoimmune diseases, yet little is understood about the function of tissue-infiltrating T cells. We observe that T cells of the V1 subset accumulate in synovial fluid of human Lyme arthritis and are intensely cytolytic toward a wide array of target cells. Particularly striking is that the cytolytic activity is highly prolonged, lasting for at least 3 wk after stimulation of the T cells with Borrelia burgdorferi. Cytolysis is largely Fas dependent and results from very high and prolonged expression of surface Fas ligand, which is transcriptionally regulated. This also manifests in a substantial level of self-induced apoptosis of the T cells. In this capacity, certain T cell subsets may serve as cytolytic sentinels at sites of inflammation, and perhaps at epithelial barriers. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T cells form a minor subpopulation of T cells and are found in increased numbers in inflamed synovial fluid from both rheumatoid arthritis (1, 2, 3, 4) and Lyme arthritis (5), as well as in certain tissues from various inflammatory conditions (6, 7, 8, 9, 10, 11) and at epithelial barriers (12, 13, 14). The function of T cells at these anatomically selected sites remains obscure. Because they express a polymorphic TCR resulting from gene rearrangement, T cells manifest qualities of an adaptive immune system. However, many of the Ags recognized by T cells either require no traditional MHC restriction (15, 16, 17, 18, 19) or recognize nonpolymorphic structures such as CD1 (20, 21). In this capacity, T cells bear functional properties of the innate immune system. Collectively, T cells may form a bridge between these two seemingly disparate types of immune response.
Human T cells can be subdivided into two broad subsets based on their expression of TCR variable regions, V1 or V2 (1). Whereas both subsets are equally present in the thymus, V2 cells form the major subset in peripheral blood, presumably due to Ag-driven expansion. This is reflected by a high proportion of V2 cells expressing the memory T cell marker CD45RO (1). Although the endogenous Ags responsible for this expansion are unknown, several exogenous compounds have been found to activate V2 cells. These include small molecules such as isoprenyl phosphates and bisphosphates as well as alkylamines found in certain foods including tea (15, 16, 17, 18, 19). By contrast, V1 T cells are the predominant subset in the intestine (22, 23) and in synovial fluid of inflamed joints, such as in rheumatoid arthritis and Lyme arthritis (1, 2, 3, 4, 5). The reason for this anatomic sequestration is unknown. This may be related in part to localized expansion of molecules recognized by V1 T cells, such as MHC class I-like MICA in the intestinal epithelium (22, 23), or CD1c (21).
Beyond the knowledge of certain Ag specificities for T cells and their anatomic preferences for various epithelial barriers and inflamed tissues, little is known of the contribution this subset makes to the immune response and what mechanisms are used in their function. T cells are generally thought to have a protective effect in various infectious disease models, including Listeria (24), Leishmania (25), Mycobacterium (26), Plasmodium (27), and Salmonella (28). We recently observed that adoptively transferred murine syngeneic T cells were capable of provoking a Th1 cytokine response and myocarditis in response to infection with Coxsackievirus B3 (CVB3)3 in BALB/c mice that normally mount a Th2 pattern to Coxsackievirus infection (29). This capacity of wild-type T cells was lost when transferred to mice deficient in Fas (30). In related studies in human Lyme arthritis, we have observed that synovial T cells proliferate in response to the causative spirochete, Borrelia burgdorferi, and result in a selective loss of synovial CD4+ T cells which is Fas dependent (5). We thus considered that some of the functions of T cells may result from high levels or prolonged expression of Fas ligand (FasL) by T cells. In the current study, we examined this question in Lyme arthritis and found that in response to stimulation by B. burgdorferi, synovial T cells of the V1 subtype express high and sustained levels of FasL that is transcriptionally regulated.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Lyme arthritis patients were followed at the Lyme Disease Clinic at the University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School (New Brunswick, NJ). All patients had histories, examinations, and serologies consistent with Lyme arthritis. Each had Abs to B. burgdorferi in both synovial fluid and serum detected by ELISA and confirmed by immunoblot. Nine patients have been analyzed to date with Lyme arthritis of 6 mo to 2 years duration.
Derivation of synovial fluid lymphocytes and T cell clones
Lymphocytes were purified from synovial fluid by Ficoll-Hypaque (Pharmacia, Peapack, NJ) centrifugation, and cultured in AIM-V medium (Life Technologies, Gaithersburg, MD) containing 5% FBS and recombinant human IL-2 (50 U/ml). Cells were stimulated with 10 µg/ml sonicate of B. burgdorferi grown in BSK II medium as previously described (5, 31). From these bulk cultures, responding cells were cloned at 0.3 cell/well in AIM-V with 5% FBS on the presence of irradiated peripheral blood lymphocytes (3 x 105/well), human rIL-2 (10 U/ml), and 10 µg/ml B. burgdorferi. After 14–21 days, cells from positive wells were phenotyped, and those containing + CD4-CD8- T cells were expanded by restimulation with either B. burgdorferi or PHA (1 µg/ml) at 
14-day intervals. All synovial clones were V1 by Ab screening and DNA sequencing and proliferated in response to Borrelia stimulation (32).
Murine CD4+ 
T cell clones specific for CVB3 were established from BALB/c mice infected with CVB3 10 days earlier. Spleen cells were activated in vitro with CVB3 for 10 days and then cloned at 0.3 cell/well in the presence of CVB3 and irradiated BALB/c spleen cells and IL-2 (50 U/ml). After 14 days, positive wells for growth were restimulated and then assayed for specificity by testing proliferation for BALB/c spleen cells in the absence or presence of CVB3.
Assay of cytolytic activity
Various target cell lines as described in the text were labeled by incubation with 51Cr for 1 h, washed three times and then mixed in 200 µl at various E:T ratios. Effectors were Lyme arthritis synovial fluid-derived V1 clone cells, Borrelia-stimulated synovial lymphocytes, or FasL-transfected 293 or 3T3 cells. After 6 or 18 h at 37°C, depending on the target cell line and experiment, 100 µl of supernatant were removed and counted for gamma emission. Spontaneous release was determined from labeled targets in the absence of effector cells. Maximal release was determined by lysing targets with 1.0 N HCl. The percentage of maximal 51Cr release calculated as: % maximal cytolysis = [(experimental cpm - spontaneous cpm)/(maximal cpm - spontaneous cpm)]
Inhibition of cytolysis was performed by preincubating the appropriate cells for 30 min before the cytolysis assay with an anti-FasL-blocking Ab (ALF2.1a; Ancell, Bayport, MN), Fas-Fc (Alexis Biochemicals, San Diego, CA) or for 1.5 h with the pan-caspase blocker benzyloxycarbonyl-Val-Ala-Asp (zVAD) (Enzyme Systems Products, Livermore, CA), or the perforin blocker concanamycin A (CMA; Sigma-Aldrich, St. Louis, MO) at the concentrations indicated.
Abs and flow cytometry
Abs were to the determinants CD4 (S3.5; Caltag Laboratories, Burlingame, CA), -TCR (5A6.E9; Endogen, Woburn, MA), human Fas (DX2; BD PharMingen, San Diego, CA), human FasL (monoclonal ALF2.1a from Ancell or monoclonal NOK-1 from BD PharMingen), and perforin (BD PharMingen). Surface FasL was analyzed using the catalyzed reporter deposition (CARD) system of enzymatic amplification staining (EAS kit; Flow-Amp Systems, Cleveland, OH) (33). Cells were washed twice with staining buffer (PBS (pH 7.4), 1% BSA) and then incubated at 4°C for 20 min with 8-µg/ml portions of either isotype control mouse IgG1-biotin or mouse anti-human FasL-biotin (ALF2.1a). After two washes with staining buffer, all samples were incubated with a 1/50 dilution of streptavidin-HRP secondary reagent (EAS kit) at 4°C for 20 min. Cells were subsequently washed twice with staining buffer and then once with PBS, pH 7.4, and reacted with a 1/20 dilution of amplifier solution (EAS kit) at room temperature for 20 min followed by two washes with staining buffer. Cells were then stained with FITC-conjugated anti-CD4 or anti- simultaneously with streptavidin-PE (Caltag Laboratories) and incubated at 4°C for 20 min. After two washes with staining buffer, cells were fixed in methanol-free 1% formaldehyde, PBS, 1% BSA and stored at 4°C until analyzed by flow cytometry. Samples were analyzed on a Coulter Elite flow cytometer (Coulter, Hialeah, FL), and at least 2 x 104 events were accumulated for analysis.
Real-time quantitative PCR
Primers for human FasL were designed to amplify an 84 bp fragment. The primers were: forward primer, 5'-TGGCCCATTTAACA-3'; reverse primer, 5'-CCAGAAAGCAGGACATTCCA-3'. The amplified fragment contained the sequence bound by the fluorochrome-labeled primer: 5'-6-FAM (TCCAACTCAAGGTCCATGCCTCTGG)TAMRA-3' (Bioresearch Technologies, Novato, CA). Control amplification was assessed using endogenous control 18S rRNA (PE Biosystems, Foster City, CA) labeled with a VIC reporter dye. RNA was extracted from cells using Ultraspec (Biotecx Laboratories, Houston, TX) and treated with RNase-free DNase (Ambion, Austin, TX), and cDNA was made using Superscript reverse transcriptase (Invitrogen, San Diego, CA). PCR was performed using a Taq Man thermal cycler, ABI Prism 7700 (PerkinElmer-Applied Biosystems, Foster City, CA). Fluorescence signal was expressed as the normalized reporter signal (Rn) which represents the reporter signal (FAM or VIC) divided by the fluorescence signal of a passive reference dye (Rox). Validation control experiments were performed to measure efficiency of the target (FasL) and reference (18S) gene amplifications over a range of 3 logs of sample dilution. This resulted in a slope of -0.0827 when log input amount of template was plotted against 
CT (threshold cycle of FasL detection - threshold cycle of 18S detection (threshold set at 66% maximal amplification in log phase), and with FasL and 18S primers run in separate tubes. This indicated a highly constant FasL:18S amplification ratio as the cDNA was titered. Subsequently, all assays were run in duplicate and corrected to a reference pooled sample (calibrator) which was included in each separate run. Values were expressed as 2-CT (CT FasL) - CT 18S - CT calibrator).
RNase protection assay (RPA)
Total RNA from 293FasL+ cells, or T cell clones, or synovial fluid lymphocytes was prepared as above. RNA samples of 5 µg were analyzed using the RiboQuant Multiprobe RNase Protection Assay System (BD PharMingen). The template set hAPO-3c was used to assay for caspase-8, FasL, Fas, DCR1, DR3–5, TRAIL, TNFRp55, TNFR-associated death domain protein, receptor-interacting protein, and the housekeeping genes L32, and GAPDH. 32P-labeled protected probes were resolved on a sequencing gel, and dried gels were exposed overnight at -80°C to Kodak Biomax MR films (Kodak, Rochester, NY). Quantitation was also performed by phosphor imager analysis (Bio-Rad Laboratories, Hercules, CA).
Western blot analysis
Cells were washed twice in ice-cold PBS and solubilized in lysis buffer (1% Nonidet P-40, 50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 2 mM DTT, protease inhibitor mixture) (Complete; Boehringer Mannheim, Indianapolis, IN). Postnuclear lysates were collected after centrifugation (15,000 x g), and proteins (40 µg) were separated in 10% SDS-PAGE. Proteins were transferred to polyvinylidene difluoride membranes (Immuno-Blot; Bio-Rad), and blots were blocked and probed with the indicated Abs in 4% nonfat milk in PBS-Tween 20 (0.1%). Immunoreactive proteins were visualized using HRP-labeled conjugates (Jackson ImmunoResearch Laboratories, West Grove, PA) and ECL blotting substrate (Amersham, Arlington Heights, IL)
Detection of intracellular perforin
Cells were stained for surface expression of CD4 (for clones) or , using FITC-conjugated Abs, then washed in PBS-BSA, and fixed and permeabilized for 20 min on ice in calcium- and magnesium-free PBS (pH 7.4) containing 4% paraformaldehyde, 1% FCS, 0.1% saponin, and 0.1% sodium azide. Cells were then washed twice in saponin wash buffer (PBS containing 1% BSA, 0.1% saponin, and 0.1% sodium azide). Samples were stained intracellularly with either PE-conjugated anti-perforin or isotype control Abs (BD PharMingen) diluted in saponin wash buffer for 20 min on ice. Cell were then washed twice with saponin wash buffer and once in PBS, 1%BSA and finally fixed in 1% paraformaldehyde in PBS.
Detection of apoptosis by TUNEL
Apoptotic cells were assayed by flow cytometry using the TUNEL method (34, 35). Cells were initially stained for expression of CD4 or TCR- and then fixed for 15 min in 1% formaldehyde. Cell membranes were then permeabilized for 15 min using 70% ethanol at 4°C. Samples were incubated at 37°C for 1 h in 50 µl containing 10 U TdT and 0.5 nM dUTP-biotin (Roche Diagnostics, Indianapolis, IN). Specimens were washed twice with PBS, 1% BSA and incubated with a 1/50 dilution of streptavidin tricolor (Caltag Laboratories) at 4°C for 30 min. Cells were washed twice and analyzed by flow cytometry. Negative controls consisted of staining of cells with the same protocol but in the absence of dUTP-biotin.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T cells expand in the presence of B. burgdorferi and are broadly cytolytic
Lyme arthritis synovial fluid contains a high proportion of T cells that proliferate in vitro in response to B. burgdorferi (5, 32). Whereas peripheral blood lymphocytes from either normal individuals or Lyme arthritis patients typically contain 1–3% T cells, fresh Lyme arthritis synovial fluid contains on average 7–15% T cells, the majority of which are of the V1 subset (Fig. 1 and Ref.5). They respond vigorously to B. burgdorferi and expand over the course of 10–14 days to comprise as much as 68% of the cultured synovial lymphocytes (Fig. 1A). Furthermore, the Borrelia-stimulated synovial T lymphocytes are highly lytic toward Jurkat T cell targets (Fig. 1B). The high level of cytolytic activity and proportion of T cells were consistent in four synovial fluids examined. This might in part explain the loss of CD4+ T cells in the same synovial lymphocyte cultures during Borrelia stimulation (5).
|
1 clones was established from synovial fluid lymphocytes of two Lyme arthritis patients and examined for the spectrum and mechanism of their lytic activity. Previous studies of the T cell clones showed that they proliferate in response to B. burgdorferi in an IL-2-dependent manner (32). TCR sequence analysis established that the clones are all V1 but have unique complementarity-determining 3 regions with different V chains and thus are not daughter cells (32). A uniform finding of all the synovial V1 clones was their intense lytic activity toward a wide array of target cells. These included not only Jurkat T cells but also human CD4+ T cell clones (Fig. 2, A and B), various tumor cell lines including a human rectal carcinoma cell line and B cell lymphoma cells (C1R) (Fig. 2, C and D), and even xenotargets such as the mouse mastocytoma cell line P815 and mouse CD4+ T cell clones (Fig. 2, E and F). Of the numerous cell lines examined, only the erythroleukemia cell line K562 was resistant to lysis by the V1 clones (Fig. 2A). This correlated with the resistance of K562 to lysis by anti-Fas Ab or FasL+ 3T3 cells (data not shown). By contrast, each of the sensitive cell lines was also lysed by either anti-Fas Ab or FasL+ 3T3 cells (data not shown). It is conceivable that each of the sensitive human and mouse cell lines might express a common determinant that is recognized by the V1 TCR. However, there is currently no evidence of this, based on the lack of any up-regulation of CD25 or CD69 or proliferation by the V1 clones in response to these target cell lines (data not shown).
|
1 clones might be constitutive and not require recent activation or Ag recognition on target cells. This was studied in more detail by initially examining the duration of lytic activity of the V1 clones after stimulation with B. burgdorferi. After such activation, the V1 clones typically express CD25 for 7 days and proliferate in an IL-2-dependent manner, similar to T cells (32). However, cytolysis by the V1 clones after stimulation was evident for as long as 30 days without loss of activity. Fig. 3 shows an example of cytolysis manifested by a V1 clone compared with a Borrelia-reactive T cell clone examined during a 23-day period following Borrelia stimulation. Cytolysis of Jurkat cell targets by the V1 clone was undiminished during days 8–23, whereas the clone stimulated by the same Ag manifested very little cytolysis during the same period. Six additional V1 clones and five other Borrelia-reactive T cell clones gave similar results after stimulation with either B. burgdorferi or PHA (data not shown). The high level of cytolysis by the V1 clones was thus not merely a result of Borrelia stimulation or cross-reactivity between borrelial and target cell proteins.
|
1 cells is mediated by prolonged expression of FasL
Killing by cytolytic T cells in vitro is mediated by FasL and perforin (36). The mechanism of cytolysis was examined for the V1 clones by inhibiting FasL-induced lysis with either anti-FasL blocking Ab or Fas-Fc or by inhibiting perforin-induced lysis with CMA, which blocks perforin granule release (37). Fig. 4A shows the dose-effect inhibition of V1 killing of Jurkat T cells by anti-FasL, whereas the effect of Fas-Fc blocking is shown in Fig. 4C. Maximal blocking was 50% with anti-FasL and 65% using Fas-Fc. The effectiveness of the FasL-blocking Ab was demonstrated by its ability to inhibit killing to a similar degree by FasL-transfected 293 cells (which kill only by FasL) (Fig. 4B). The efficiency of the Fas-Fc block was illustrated by its complete inhibition of killing by FasL-transfected 3T3 fibroblasts (Fig. 4D). By contrast, blocking of perforin release by CMA provided only minimal inhibition of cell-lytic activity compared with the DMSO vehicle control (Fig. 4C). The ability of CMA to block perforin-mediated killing was confirmed by its ability to block the lytic activity of peritoneal exudate lymphocytes after alloimmunization (data not shown). Using the mouse cell lines as targets yielded similar results, showing even more effective block by Fas-Fc and none by CMA (data not shown). These findings suggested that the V1 cells kill primarily by FasL. This was further confirmed by the ability of the pan-caspase blocker, zVAD, to prevent cytolysis by the V1 clones (Fig. 4E) as efficiently as killing by the 293FasL+ cells (Fig. 4F).
|
and T cell clones. Given the limited and very transient surface expression of FasL on most activated T cells and its sensitivity to cleavage by metalloproteases (38), it is typically very difficult to convincingly observe surface FasL by flow cytometry on activated T cells using standard Ab staining protocols. To improve the sensitivity of surface FasL detection by flow cytometry, we adopted an amplification system known as CARD (33). This technique enzymatically amplifies the signal of the primary detecting Ab using an analyte-dependent reporter enzyme that catalyzes the deposition of biotin reporter molecules at the sites of the primary Ab binding (see Materials and Methods). A positive control for FasL staining was initially tested using 293 cells transfected with a FasL variant in which the metalloprotease cleavage site had been mutated. This provided highly stable surface FasL expression. Flow cytometric analysis of the 293FasL+ cells revealed readily detectable surface FasL even without amplification, but the mean fluorescence intensity was increased nearly 10-fold using the CARD amplification method (Fig. 5A).
|
T cell clones, four B. burgdorferi-reactive T cell clones, as well as fresh uncloned synovial lymphocytes, during a 3-wk period following stimulation with B. burgdorferi. As shown in Fig. 5, B and C, expression of FasL by a representative clone was very apparent initially after stimulation but declined considerably between days 6 and 15. By contrast, a representative V1 clone continued to manifest high surface FasL expression for at least 21 days. We have detected high levels of surface FasL on the V1 clones as late as day 30 (data not shown). These findings were consistent with an additional two and three clones. The surface levels of FasL varied slightly during the 30 days among the V1 clones and did not always correlate exactly with intensity of cytolysis on a given day (compare Fig. 5B and Fig. 3). However, both parameters remained very high throughout the 30-day period. A similar observation was seen in the noncloned synovial fluid lymphocytes. Fig. 5D shows that freshly isolated synovial lymphocytes already expressed high levels of surface FasL that were not observed in the non- fraction. Thus, even the CD8+ T cells in the synovial fluid are not induced to express FasL after Borrelia stimulation. This difference persisted for at least 21 days after stimulation with B. burgdorferi (Fig. 5, D and E). The findings were consistent in two synovial fluids analyzed.
The levels of total cellular FasL protein were determined by Western blot of whole cell lysates to assess whether the increased surface FasL reflected total cellular levels. Fig. 6A demonstrates that total cellular FasL protein was substantially higher in the V1 clones than in the clones, both unstimulated and after 8 days of activation by B. burgdorferi.
|
1 cells was transcriptionally regulated, message levels for FasL were determined using both real-time quantitative RT-PCR and RPA. Results by both methods were consistent in demonstrating increased FasL mRNA expression by the clones compared with the T cell clones. By real-time PCR, the FasL mRNA levels in the clones were 2- to 6-fold higher than the levels in T cells, when normalized to 18S rRNA (Fig. 6B). Over the course of 3 wk after activation with PHA, the clones maintained persistently high levels of FasL, which eventually declined by day 22 (Fig. 6C, top). This was also verified using B. burgdorferi stimulation (Fig. 6C, bottom). The RPA findings illustrated in Fig. 6, D and E, confirmed that FasL mRNA expression was higher in the V1cell clones, whereas the message for caspase-8, Fas, death receptors 3 and 5, TRAIL, and TNFR1p55 were quite similar between the and cells. The freshly cultured synovial lymphocytes also expressed substantial amounts of FasL message, consistent with the flow cytometry findings (Fig. 6D, lane C). Fig. 6E summarizes the RPA findings as normalized to the control gene L32. This confirms the elevated FasL mRNA expression in the cells during nearly 3 wk after stimulation with B. burgdorferi. Collectively, these findings demonstrate that synovial T cells from Lyme arthritis express high and sustained FasL after activation with B. burgdorferi, and this is at least in part transcriptionally regulated.
Synovial fluid-derived V1 cells also express high levels of perforin
The inhibition studies of cytolysis did not suggest that perforin was the predominant mediator of lysis by the clones. Nonetheless, we observed substantial and sustained levels of cytoplasmic perforin by these cells compared with T cells (Fig. 7). This was substantiated at the RNA level by semiquantitative RT-PCR (data not shown). Conceivably, perforin might play a substantial role in killing in vivo or with target cells other than the panel we examined. Thus, lytic pathways by both FasL and perforin were highly expressed by the synovial V1 cells.
|
1 cells are themselves susceptible to Fas-induced death
We have previously observed that the expansion in cell number of V1 cells after stimulation with B. burgdorferi is quite modest compared with T cell clones (32). Given the current findings, we considered that the high level of surface FasL expression by the V1 cells might induce their own cell death. This was further suggested by the presence of abundant surface Fas by the V1 cells at levels equivalent to T cells (Fig. 8A). In addition, there were also equivalent protein levels between the and clones for the Fas inhibitor cellular FLIP and the Fas mediator caspase-8 (Fig. 8B). Consequently, the V1 clones exhibited equivalent sensitivity as the clones to lysis by FasL-transfected 3T3 cells (Fig. 9A). This was further supported by the presence of a high proportion of apoptotic V1 cells but not T cells by the TUNEL assay in cultures 7–10 days after Borrelia stimulation (Fig. 9B). These findings show that Borrelia-stimulated V1 cells are undergoing a high rate of cell death concurrent with their proliferative response.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T cells are capable of expressing very high and sustained levels of surface FasL that is transcriptionally regulated. The findings are consistent not only with T cell clones but also for primary synovial T cells. This results in highly efficient cytolytic activity by V1 cells toward a wide array of targets. Direct recognition of the target cells by the TCR is not necessarily required. There is currently no evidence that the TCR actually recognizes a determinant expressed by the myriad target cells (including xenogeneic targets) lysed by the synovial V1 clones. These targets do not stimulate expression by the V1 clones of the activation markers CD25 or CD69 or proliferation by the clones. Furthermore, the V1 T cells may not escape their own lytic activity, thereby regulating themselves in a partly Fas-dependent manner. This logically follows from their expression of high levels of caspase-8 but low levels of the Fas inhibitor c-FLIP. These findings are also consistent with our observations of murine T cells. Splenic T cells from wild-type mice also express high levels of surface FasL for at least 1 wk after activation, but cell numbers expand only minimally due to a high proportion of dead cells. By contrast, the number of T cells from Fas-deficient lpr mice manifest a substantially larger increase with fewer apoptotic cells (C. Shi, unpublished observations).
There are at least three explanations, not mutually exclusive, for the high expression of FasL mRNA by V1 cells. First, TCR signaling may be more sustained or of higher intensity in V1 cells than in most T cells. This could lead to prolonged activation of the fasL gene. The model is consistent with a recent report that most T cells signal with a higher intensity than T cells (39). This includes greater calcium mobilization and activation of the mitogen-activated protein kinase, extracellular signal-regulated kinase, signals that are involved with fasL gene regulation. This might reflect an intrinsic higher affinity of many TCR for their cognate ligands. Although the specificity of the Lyme arthritis synovial V1 cells is unknown at present, other V1 cells manifest specificity for CD1c (21). Because CD1c is a nonpolymorphic MHC-like molecule, conceivably during evolution the V1 TCR may have selected a high affinity interaction with CD1c, leading to a higher intensity and more sustained signal. In a second model, V1 cells may independently express higher levels of transcription factors for the fasL gene. The promoter region of fasL has been well characterized in T cells and involves the transcription factors NFAT, NF-
B, SP1, early growth response gene (Egr)-2 and Egr-3 (40, 41, 42, 43). Expression of these transcription factors by V1 cells is currently under investigation. Finally, the V1 TCR might receive constant stimulation if its recognition determinant is expressed by the same V1 cell. We currently have little evidence for this last model as some activation markers, such as CD25, are not constitutively expressed by the V1 clones (32). We are further examining this possibility.
As part of the innate immune system, a central role of T cells is likely to be part of early defense mechanisms in response to infection. One of the most efficient processes used to combat infection is lysis of infected cells. In this capacity, T cells may be primed to function as an initial rapid and intense lytic mechanism. The contribution of T cells to defense against infections has been examined in mice in a number of infectious models including Listeria (24), Leishmania (25), Mycobacterium (26), Plasmodium (27), Toxoplasma (44), and Salmonella (28). Each of these studies has shown a moderately protective role for T cells.
In addition to Lyme arthritis, T cells accumulate at inflammatory sites in autoimmune disorders such as rheumatoid arthritis (4), celiac disease (10), and sarcoidosis (11). The reason for this is unclear. Some evidence suggests that T cells may be beneficial in certain autoimmune models. Both collagen-induced arthritis in mice (45) and adjuvant arthritis in rats (46) are made worse by depletion of T cells, as is the lupus-like disease in MRL-lpr mice lacking T cells (47). Similar results have been observed in a model of orchitis in which depletion accelerated the inflammatory response (48). We have observed previously that the percentage of synovial CD4+ T cells undergoing apoptosis after B. burgdorferi stimulation was directly proportional to the percentage of T cells present in the cultures (5). Removal of the T cells resulted in preservation of the CD4+ cells. The current findings now suggest a possible mechanism for this phenomenon, in which FasL+ T cells would lyse Fas-sensitive effector CD4+ T cells. An additional effect of FasL in the synovial environment may be to stimulate macrophages to secrete chemokines, as has been shown recently for FasL-expressing tumor cells (49). This might contribute to the large proportion of granulocytes found in inflammatory synovial fluid.
The intense lytic activity of the T cells may also influence the cytokine environment in a Fas-dependent manner. We recently observed that mice infected with wild-type CVB3 develop a Th1 viral response with accompanying myocarditis, whereas a CVB3 variant induced a Th2 viral response and no myocarditis, despite equal viremia. Transfer of as few as 5000 syngeneic T cells was able to restore a Th1 response to the CVB3 variant and provoke myocarditis (50). In follow-up studies, we have observed that wild-type CVB3 does not induce myocarditis and yields a Th2 viral response in C57CL/6 mice deficient for Fas (lpr) or FasL (gld). However, adoptive transfer of wild-type B6 T cells again provoked a Th1 response and myocarditis in gld mice (as they have functional Fas), but not in lpr mice (30). These findings are also consistent with in vitro studies showing that both murine and human T cells lyse Th2 CD4+ targets more efficiently than Th1 targets, and this is almost entirely Fas-mediated (Ref.30 and K. Roessner, unpublished observations). In this regard, synovial CD4+ T cells from Lyme arthritis patients express a Th1 cytokine phenotype (51).
The collective findings suggest that T cells at sites of inflammation may efficiently lyse a wide variety of cell types, including infected cells, infiltrating CD4+ T cells, and possibly parenchymal cells of normal tissue. The mechanism of this lytic activity is through the high and sustained expression of FasL and possibly perforin. That the V1 cells may be susceptible to their own armamentarium suggests that their sentinel function may depend more on their highly efficient cytolytic activity than on clonal expansion.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Ralph C. Budd, Immunobiology Program, The University of Vermont College of Medicine, Given Medical Building, D-305, 89 Beaumont Avenue, Burlington, VT 05405-0068. E-mail address: rbudd{at}zoo.uvm.edu
3 Abbreviations used in this paper: CVB3, Coxsackievirus B3; FasL, Fas ligand; CMA, concanamycin A; CARD, catalyzed reporter deposition; RPA, RNase protection assay; Egr, early growth response gene; zVAD, benzyloxycarbonyl-Val-Ala-Asp.
Received for publication October 29, 2002. Accepted for publication December 18, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
are phenotypically diverse and evenly distributed throughout the lymphoid system. J. Exp. Med. 169:1277.1 subset of rheumatoid synovial fluid and peripheral blood T lymphocytes. Eur. J. Immunol. 22:567.
T lymphocytes in synovia from rheumatoid arthritis patients with active synovitis. J. Clin. Immunol. 12:130.[Medline]
chain receptors in rheumatoid arthritis. J. Autoimmun. 1:319.[Medline]
T cells in Lyme arthritis. J. Exp. Med. 184:2109.1+ T cells in systemic sclerosis patients. Ann. NY Acad. Sci. 756:382.[Medline]
receptor. N. Engl. J. Med. 324:877.[Abstract]
+ T cells in coeliac disease. Scand. J. Immunol. 35:459.[Medline]
-positive antigen receptors in a subgroup of individuals with pulmonary sarcoidosis. J. Clin. Invest. 85:1353.
T-cell receptor on intestinal CD8+ intraepithelial lymphocytes. Nature 333:855.[Medline]
heterodimer in human intestinal intraepithelial lymphocytes. Eur. J. Immunol. 19:1335.[Medline]
T-cell receptor. Nature 340:239.[Medline]
9V2 T lymphocytes by mycobacterial low molecular weight ligand. Eur. J. Immunol. 24:1886.[Medline]
T cells by nonpeptidic mycobacterial ligands. Science 264:267. T cells. Proc. Natl. Acad. Sci. USA 91:8175. T cells. Nature 375:155.[Medline]
T cells recognize alkylamines derived from microbes, edible plants, and tea: implications for innate immunity. Immunity 11:57.[Medline]
cells. Eur. J. Immunol. 20:703.[Medline]
T cells: implications for innate immunity. J. Exp. Med. 191:937. T cells. Science 279:1737. T cells in primary infection with Listeria monocytogenes in mice. J. Exp. Med. 175:49.+ T cells during experimental infection of mice with Leishmania major. J. Immunol. 150:550.[Abstract]
T cells contribute to immunity against the liver stages of malaria in T-cell-deficient mice. Proc. Natl. Acad. Sci. USA 91:345. T-cell antigen receptor contribute to resistance to Salmonella infection in vivo. Infect. Immun. 62:4618. T cell receptor. J. Virol. 70:3039.[Abstract]
T cells promote a Th1 response during Coxsackievirus B3 infection in vivo: role of Fas and Fas ligand. J. Virol. 76:6487. T cells respond to Borrelia burgdorferi lipoproteins and lipidated hexapeptides. J. Immunol. 161:5762.TCR complex. Immunity 16:827.[Medline]
B sites in mouse CD95 ligand (Fas ligand) promoter: functional analysis in T cell hybridoma. J. Immunol. 161:3469. T cells play an important role in disease expression and in acquiring protective immune responses against infection with Toxoplama gondii. J. Immunol. 155:244.[Abstract]
T cells in murine collagen-induced arthritis. J. Immunol. 151:6546.[Abstract]
T cells does not prevent or ameliorate, but rather aggravates, rat adjuvant arthritis. Arthritis Rheum. 39:204.[Medline]
T cells. J. Immunol. 157:5689.[Abstract]
and T cells. J. Immunol. 155:2047.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  C. Shi, J. Wolfe, J. Q. Russell, K. Fortner, N. Hardin, J. Anguita, and R. C. Budd Fas Ligand Deficiency Impairs Host Inflammatory Response against Infection with the Spirochete Borrelia burgdorferi Infect. Immun., February 1, 2006; 74(2): 1156 - 1160. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Collins, J. Wolfe, K. Roessner, C. Shi, L. H. Sigal, and R. C. Budd Lyme Arthritis Synovial {gamma}{delta} T Cells Instruct Dendritic Cells via Fas Ligand J. Immunol., November 1, 2005; 175(9): 5656 - 5665. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. D. Ponomarev and B. N. Dittel {gamma}{delta} T Cells Regulate the Extent and Duration of Inflammation in the Central Nervous System by a Fas Ligand-Dependent Mechanism J. Immunol., April 15, 2005; 174(8): 4678 - 4687. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Dalton, G. Howell, J. Pearson, P. Scott, and S. R. Carding Fas-Fas Ligand Interactions Are Essential for the Binding to and Killing of Activated Macrophages by {gamma}{delta} T Cells J. Immunol., September 15, 2004; 173(6): 3660 - 3667. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Gao, W. Yang, M. Pan, E. Scully, M. Girardi, L. H. Augenlicht, J. Craft, and Z. Yin {gamma}{delta} T Cells Provide an Early Source of Interferon {gamma} in Tumor Immunity J. Exp. Med., August 4, 2003; 198(3): 433 - 442. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), K562 human embryonic kidney cell line (
); B, human Borrelia-specific 
) and two 
). cDNA was made and subjected to real-time PCR for FasL (top) vs reference control 18S ribosomal protein (bottom). C, Summary of results of FasL real-time PCR normalized to 18S ribosomal protein (see Materials and Methods) for the same T cell clones activated for the days indicated with either PHA (top) or B. burgdorferi (bottom). D, RNase protection confirms increased and prolonged FasL message in 
