|
|
||||||||
-Herpesvirus 681

* Department of Biology, University of North Carolina, Charlotte, NC 28223; and
Division of Gastroenterology-Hepatology, Department of Internal Medicine, University of Iowa, Iowa City, IA 52242
| Abstract |
|---|
|
|
|---|
-herpesvirus infection. Following intragastric inoculation with murine
-herpesvirus 68 (
HV-68), expression of substance P and its receptor was increased in mucosal and peripheral lymphoid organs in wild-type strains of mice. These results suggested that this receptor/ligand pair might be an important component of the host response against this viral infection. Such a hypothesis was supported by the demonstration that mice, genetically deficient in substance P receptor expression, showed an increased viral burden when compared with syngeneic C57BL/6 mice. Furthermore, substance P receptor-deficient mice showed a reduced CTL response against
HV-68, suggesting a mechanism to explain this increased viral burden. Such limitations in the Ag-specific CTL response in substance P receptor-deficient mice could result from lowered expression of IL-12 during viral infection. Consistent with this hypothesis, increases in mRNA encoding IL-12 and secretion of this cytokine into sera of infected, wild-type animals were markedly reduced in substance P receptor-deficient mice. These studies demonstrate that genetic elimination of substance P receptors in mice results in an increased
-herpesvirus burden and an altered host response. | Introduction |
|---|
|
|
|---|
production following infection with schistosomiasis mansoni. Interestingly, lung infections with respiratory syncytial virus (14), mycoplasma (15), or parainfluenza virus (16) induce expression of substance P or its receptor, and contribute to the pathophysiology that accompanies such infections. Furthermore, substance P is induced following HIV infection (17), and the presence of this peptide seems to augment the ability of this virus to replicate (18). Taken together, these recent studies demonstrate specific mechanisms by which substance P, interacting with its receptor, can influence host responses during infectious diseases.
Murine
-herpesvirus 68 (
HV-68)3 is a
2-herpesvirus (19) that shares sequence homology and pathological similarities with EBV (20) and human herpesvirus-8 (21, 22). Intranasal (23) or gastric (24) inoculation with
HV-68 results in an acute, productive infection of lung or intestinal epithelial cells, respectively, followed by the dissemination of the virus to peripheral organs (23). B lymphocytes (21, 25, 26), macrophages (27), and possibly dendritic cells (28) become latently infected soon after inoculation. Levels of latent virus in the spleens of infected animals peak
15 days postinfection, coinciding with a marked splenomegaly (23, 26, 29) due to an unregulated expansion of leukocyte populations (26, 30). The CTL response (31, 32, 33, 34), which develops during the primary infection, and possibly late-developing anti-viral Abs (35) are thought to limit secondary disease caused by the emergence of
HV-68 from latency.
Most evidence points to early IFN-
/
production (36), followed by the development of a viral-specific CTL response (31, 32, 33, 34), as critical factors in a protective host response against this virus. Mice genetically deficient in type I IFN receptors are highly susceptible to a lethal infection by
HV-68 (36), indicating that this innate immune response is necessary for limiting early viral replication. Furthermore, in the absence of CD8+ T lymphocytes, mice have increased viral titers following infection (31). Development of a long-lived CD8+ CTL response requires CD4+ T lymphocytes (31, 32, 33, 34), and these CTLs most likely function to limit the extent of infection following reactivation (37). Therefore, the proper initiation of innate immune responses to allow development of viral-specific CTL responses is necessary for the optimal host response against
HV-68 infection.
An understanding of the contribution that substance P and its receptor makes to a developing, viral-specific CTL response has not been investigated. Therefore, the following studies focused on the importance of substance P receptor expression during
HV-68 infection. Surprisingly, the inability of genetically deficient mice to express a functional substance P receptor dramatically reduced viral-specific CTL responses, and resulted in an increased viral burden in these mutant mice. These studies represent the first to conclusively demonstrate that the lack of substance P receptor expression dramatically alters the host response during
HV-68 infection.
| Materials and Methods |
|---|
|
|
|---|
HV-68 was kindly provided by A. Nash (University of Edinburgh, Edinburgh, U.K.) and P. Doherty (St. Judes Hospital, Memphis, TN). Virus stock was prepared by infecting BHK-21 cells (ATCC CCL-10) with
HV-68 at a low multiplicity of infection, followed by isolation of virus, as previously described (24, 38). Replicating virus present in viral stocks was quantified using serial dilutions on NIH-3T3 cell (ATCC CRL 1658) monolayers, as previously described (24, 38).
Mice
Substance P receptor-deficient mice, bred for >10 generations onto a C57BL/6 background, were derived at the University of Iowa Medical Center (12). These mice were originally derived from induced mutations made by insertion of the lacZ gene into exon 1 of the substance P receptor (39). Substance P receptor-deficient mice were routinely screened by PCR to confirm disruption of the substance P receptor, as previously described (39), using the positive and negative strand primers CCAACACCTCCAAGACTTCTG and GCCACAGCTATGGAGTAGAT for wild type, and TCCAGACTGCCTTGGGAAAA and GCCACAGCTGTCATGGAGTAGAT for substance P receptor deficiency, respectively. Substance P receptor-deficient or syngeneic C57BL/6 (The Jackson Laboratory, Bar Harbor, ME) mice weighing 1822 g were used for all experiments.
Intragastric inoculation with
HV-68 or mock treatments
Mice were housed in isolation cages and given food and water ad libitum throughout the experimental period. For intragastric inoculations (24), mice were intubated with 6000 PFU of
HV-68 in 0.25 ml of PBS. For mock treatment, mice were handled in an identical manner, except that an equal volume of UV-killed
HV-68 was substituted for infectious virus. It should be noted that UV-inactivated viral preparations had undetectable levels of lytic virus, as determined using the plaque assay described below.
Measurement of splenomegaly
Following euthanasia, spleens from
HV-68-infected or mock-treated mice were removed and weighed. Single cell suspensions were made by gently pressing through a wire mesh screen. Hypotonic lysis was used to eliminate RBCs, and leukocytes were enumerated (Beckman Coulter, Hialeah, FL).
Quantification of lytic
HV-68 in tissue homogenates using a plaque assay
The presence of lytic virus was quantified, as previously described (24, 38), using a plaque-forming assay. Briefly, tissues isolated from the spleen or mesenteric lymph nodes were homogenized using pestles fitted into 1.5-ml microfuge tubes. Homogenates were then pulse sonicated (Vibra Cell, Newtown, CT) to release intracellular virus. After sonication, lysates were centrifuged at 5000 x g to remove cellular debris. Limiting dilutions of the lysates were then placed on NIH-3T3 monolayers for 1 h, followed by washing and overlaying with 0.15% agar (Difco, Detroit, MI) in RPMI 1640 with 30% FCS. After 5 days, overlays were removed and cell monolayers were stained with crystal violet. Plaque-forming units were quantified in duplicate at several serial dilutions of lysate to assure accuracy.
Infectious centers assay to quantify latent
HV-68 in cells isolated from tissues
The presence of latent virus was quantified using an infectious centers assay, as previously described (24, 38). For quantification of latent virus, spleens were removed and weighed, and total leukocytes were isolated from each organ. Limiting dilutions of isolated splenic leukocytes were then placed onto monolayers of NIH-3T3 cells. After 24 h, an agar overlay supplemented with medium and FCS was added, and allowed to incubate for 5 days in 5% CO2. The monolayers were then fixed and stained with crystal violet, and the number of infectious centers was counted in triplicate for several dilutions of cells for each experimental condition.
Semiquantitative RT-PCR to detect mRNA expression following
HV-68 infection
At the indicated times, total RNA was isolated from the mesenteric lymph nodes and spleens, as previously described (9, 11, 40, 41, 42, 43, 44, 45), using TRIzol reagent (Life Technologies, Gaithersburg, MD). A total of 1 µg total RNA was reverse transcribed using SuperScript II reverse transcriptase (Life Technologies). A portion of the total cDNA was amplified by PCR using 94°C denaturation, 59°C annealing, and 72°C extension temperatures, with the first three cycles having extended times. Positive and negative strand primers and the number of cycles used for amplification of each mRNA species were as follows: substance P receptor, 30 cycles, CCCATTGCTGCTCTCTTCGCCAGT and GGCCCACAGTGTCCCTACCAC; preprotachykinin, 30 cycles, TCTAAATTATTGGTCCGACTGGTC and TTCGTAGTTCTGCATTGCGCTTCT; IL-12p40, 27 cycles, GCACCAAATTACTCCGGACGGTTC and GCAAGTTCTTGGGCGGGTCTG; IL-18, 27 cycles, AACTTTGGCCGACTTCACTGTACAA and CTATTGATGTAAGTTAGTGAGAGTG; and G3PDH, 23 cycles, CCATCACCATCTTCCAGGAGCAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT, respectively. Amplified products were visualized under UV illumination following electrophoresis on ethidium bromide-stained agarose gels. Amplification of the appropriate gene fragments was assured by comparison with m.w. markers run on the same gel. It should be noted that the conditions for amplification of each mRNA species were predetermined to be within the linear range of amplification using methodologies previously described (9, 11, 40, 41, 42, 43, 44, 45). Densitometric analyses of the amplified fragments were performed using NIH Image. A gel-plotting macro was used to outline the bands, and the intensity was calculated on the uncalibrated OD setting.
Localization of
-galactosidase activity in macrophages or spleens from substance P receptor-deficient mice following
HV-68 infection
Substance P receptor-deficient mice were constructed by replacing most of exon 1 with the genes encoding neomycin resistance and lacZ (39). The lacZ gene encodes for
-galactosidase, and as such, expression of this enzyme occurs in substance P receptor-deficient mice when transcription activation at the substance P receptor gene locus occurs. Therefore, we used this fact to further define transcriptional activation of this gene following
HV-68 infection.
Peritoneal macrophages were isolated from C57BL/6 or substance P receptor-deficient mice, as previously described (42, 43, 44), and placed on round coverslips in 24-well plates. Macrophages were then exposed to
HV-68 (multiplicity of infection 1:1) for 2 h, and unattached virus was washed off. At 20 h postinfection, coverslips were washed, fixed with 0.25% glutaraldehyde, and incubated for 5 h in substrate solution (0.5 mg/ml 5-bromo-4-chloro-3-indolyl
-D-galactoside, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 2 mM magnesium chloride, 0.02% Nonidet P-40, and 0.01% deoxycholic acid in PBS) at 37°C. The sections were then fixed for 10 min in 4% paraformaldehyde, washed in PBS, and counterstained with eosin.
Groups of C57BL/6 or substance P receptor-deficient mice were mock or
HV-68 infected, and 10 days later
-galactosidase activity was detected in spleens. Tissues were embedded in OCT (Miles Scientific, Naperville, IL), frozen in liquid nitrogen, and cryostat sectioned. Slides were fixed using 0.25% glutaraldehyde in PBS for 30 min, washed, and then incubated at 37°C overnight in the substrate solution described above. Sections were then fixed for 10 min in 4% paraformaldehyde, washed, and counterstained with eosin.
Quantification of CTL activity using 51Cr release assays
51Cr release assays were performed, as previously described (46), with the following modifications. MC57G is a fibrosarcoma cell line derived from C57BL/6 mice, and has been used for cell-mediated cytotoxicity studies because it is readily infected with many virus strains (47). Empirical studies were performed to demonstrate that the MC57G cell line could be infected by
HV-68, and could express virally encoded mRNA following infection (data not shown). MC57G cells were infected with a multiplicity of infection of 5:1, and infected or uninfected cells were labeled with 150 µCi Na251CrO4 (100500 mCi/mg Cr; Amersham, Arlington Heights, IL) for 16 h at 37°C. Before addition of the effector cells, MC57G target cells were washed twice in RPMI 1640.
Effector CD8+ T lymphocytes were purified by MACS, using methods that are previously described (38), from splenic leukocytes 10 days following mock treatment or infection with
HV-68. This time postinfection corresponds to the peak development of the CTL response in mice. CD8+ cells were greater than 90% pure, as determined by FACS analysis (data not shown). Effector cells were added to targets at ratios between 40:1 and 5:1 in triplicate wells of 96-well plates, and centrifuged at 200 x g for 1 min. Plates were incubated for 46 h at 37°C, gently pipetted, and centrifuged at 200 x g for 5 min. Supernatants were harvested from each well and counted for 51Cr release.
Percentage of specific lysis was calculated using the following equation:
![]() |
![]() |
ELISA for IL-10, IL-12p40, and IL-12p75
Following euthanasia, sera were collected from
HV-68-infected or mock-treated mice and subjected to ELISA analyses to quantify IL-10, IL-12p40, or IL-12p75, as previously described (38).
FACS analyses for quantification of the percentage of lymphocyte subpopulations
Immunofluorescence analyses were performed to determine the percentage of CD4, CD8, and CD19 lymphocytes present in the splenic leukocyte population of
HV-68-infected substance P receptor-deficient or C57BL/6 mice. PE-conjugated mAbs (BD PharMingen, San Diego, CA) were used in these studies. Immunofluorescence analyses were performed using a FACSCalibur (BD Biosciences, San Jose, CA) and analyzing 10,000 cells per stain.
Statistical analysis to determine significance
Statistically significant differences in spleen weights, infectious centers, percentage of specific lysis, levels of cytokines, and lymphocyte subpopulations were determined using the Student t test (GraphPad, San Diego, CA).
| Results |
|---|
|
|
|---|
HV-68 infection of C57BL/6 mice
The localization of substance P at mucosal tissues (1, 48, 49) and the skin (50, 51) suggests a role for this neuropeptide in the protective response at sites in which pathogens enter the host. We began studies to demonstrate the importance for substance P receptor expression during the immune response against
HV-68. C57BL/6 mice were gastrically inoculated with
HV-68, and at varying times postinfection, the mesenteric lymph nodes and spleens were removed and subjected to semiquantitative RT-PCR analyses. Representative results of one such RT-PCR analysis are shown in Fig. 1, and demonstrate that substance P receptor mRNA expression increased in the mesenteric lymph nodes and spleens of
HV-68-infected C57BL/6 mice when compared with mock or uninfected controls.
|
HV-68 infection. It should be noted that two different amplified products are often observed when amplifying for preprotachykinin mRNA in these lymphoid organs. These two amplified products are expected, and correspond to the alternatively spliced
- and
-preprotachykinin mRNA species, as previously reported (9). In addition, it is important to note that increased mRNA expression encoding this neuropeptide and its receptor continued to be expressed up to 15 days postinfection in the mesenteric lymph nodes and spleens of C57BL/6 mice. Similar increases in expression of preprotachykinin and substance P receptor mRNAs were seen following
HV-68 infection of BALB/c mice (data not shown). Taken together, these results clearly demonstrate increased expression of the mRNAs encoding substance P and its receptor following gastric infection with the
-herpesvirus,
HV-68.
Leukocytosis and viral latency in substance P receptor-deficient mice following infection with
HV-68
Some genetically deficient mice with particular immunologic abnormalities are unable to control the acute phase of
HV-68 infection, and ultimately succumb to this pathogen (36). Therefore, our first studies focused on defining any morbidity and mortality resulting from
HV-68 infection of substance P receptor-deficient mice. For these studies, groups of substance P receptor-deficient mice were gastrically inoculated with 6000 PFU of
HV-68 or mock treated. For the following 60 days, the general health and weights of these substance P receptor-deficient mice were monitored. Mice remained healthy, with no deaths, and weight gain was not significantly different when comparing these two groups of mutant mice (data not shown).
Additional groups of substance P receptor-deficient mice were infected with 6000 PFU of
HV-68 to follow acute viral replication in intestinal epithelial cells. Similar to previously published results (24), lytic virus was detected in isolated intestinal epithelial cells at days 2 or 4 postinfection (89 ± 11 or 51 ± 25 PFU/107 cells, respectively). However, by 15 days postinfection, less than 1 PFU of lytic virus/107 cells could be detected. These results clearly demonstrated that substance P receptor-deficient mice could control the lytic phase of viral infection and remained healthy months following infection.
Infection with
HV-68 mimics EBV infections in that splenomegaly and leukocytosis result from a virally induced dysregulation of the host response (23, 31, 52, 53). Genetically deficient mice have been used to identify molecules that might contribute to this expansion of leukocytes (25, 31, 38, 54, 55, 56), although the exact mechanism has yet to be defined. We questioned whether mice on a C57BL/6 background, made genetically deficient in expression of the substance P receptor (12, 39), exhibit virally induced splenomegaly and leukocytosis. Substance P receptor-deficient mice were identified by PCR (Fig. 2A) and mock treated or
HV-68 infected by gastric lavage. Splenomegaly was evident in all mice at 15 days postinfection (Fig. 2B), as was leukocytosis (2.1 ± 1.1 x 107 vs 0.2 ± 0.1 x 107 white blood cells/ml, respectively), when compared with mock-treated C57BL/6 mice. In addition, the quantity of latent
HV-68 in splenic leukocytes of infected substance P receptor-deficient mice peaked at approximately day 15 postinfection (Fig. 2C), which is consistent with the kinetics of latency following infection of wild-type mice (23, 31, 52, 53). The presence of splenomegaly (Fig. 2B), peak viral latency (Fig. 2C), and the lack of lytic virus 15 days postinfection are characteristics consistent with
HV-68 infection in wild-type strains of mice (23, 31, 52, 53). Surprisingly, therefore, mice genetically deficient in substance P receptor expression could effectively control the initial lytic viral infection, and were susceptible to viral-induced splenomegaly and leukocytosis.
|
HV-68-infected substance P receptor-deficient mice
Substance P receptor-deficient mice were constructed by replacing most of exon 1 with the genes encoding neomycin resistance and lacZ (39). The lacZ gene encodes for
-galactosidase, and as such, expression of this enzyme occurs in substance P receptor-deficient mice when transcription activation of this gene occurs. We investigated the expression of
-galactosidase activity in substance P receptor-deficient mice as an indication of substance P receptor gene activation following infection. C57BL/6 or syngeneic substance P receptor-deficient mice were gastrically inoculated with
HV-68, and 10 days postinfection, spleens were removed and histochemical analyses were performed to determine
-galactosidase activity. As expected, there was no significant
-galactosidase activity in infected, wild-type C57BL/6 mice (Fig. 3A). Importantly, significant increases in
-galactosidase activity were observed in
HV-68-infected substance P receptor-deficient mice (Fig. 3C) as compared with mock-treated mice (Fig. 3B). Interestingly, the
-galactosidase activity was almost completely absent in the follicles, but localized to the marginal zones. The appearance of many of the
-galactosidase-positive cells within the marginal zones appeared to have a macrophage-like morphology.
|
HV-68 infection might induce
-galactosidase activity in this cell population, macrophages, derived from C57BL/6 or substance P receptor-deficient mice, were cultured in the presence of
HV-68. At 24 h following infection, macrophages were fixed and stained for
-galactosidase. Although
HV-68-infected macrophages from wild-type C57BL/6 mice expressed no such enzymatic activity (Fig. 3D), infected macrophages from substance P receptor-deficient mice had a high percentage of cells positive for
-galactosidase (Fig. 3F), when compared with mock-treated macrophages (Fig. 3E). Of three separate experiments, 47 ± 11% of macrophages from
HV-68-infected cultures were positive for
-galactosidase activity.
Taken together, the results shown in Figs. 1 and 3 support the notion that as yet undefined intracellular signals induce transcriptional activation of substance P receptors in C57BL/6 mice (Fig. 1), or transcriptional activation of
-galactosidase in substance P receptor-deficient mice (Fig. 3), respectively, following infection with
HV-68.
Substance P receptor-deficient mice have increased viral latency following
HV-68 infection
Although it was clear that substance P receptor-deficient mice could control an acute
HV-68 infection, we questioned whether the latent viral burden was similar in C57BL/6 vs syngeneic substance P receptor-deficient mice. Groups of mice were infected with
HV-68, and 10 or 15 days following infection, splenic leukocytes were isolated to quantify levels of latent virus using an infectious centers assay. As shown in Fig. 4, substance P receptor-deficient mice had a significantly higher amount of latent
HV-68 at days 10 and 15 postinfection when compared with levels observed in infected C57BL/6 mice. This result demonstrated that the lack of substance P receptor expression resulted in an increased viral burden in these mutant mice.
|
An effective CTL response is a critical component of the protective host response against
HV-68 (31, 32, 33). Mice that are CD8 deficient have greatly exaggerated viral burdens (31), and it has been postulated that an effective CTL response limits viral load during
-herpesvirus reactivation from latency (32). Therefore, we questioned whether the increased viral latency observed in substance P receptor-deficient mice might correlate with a lowered development of viral-specific CTL. Groups of C57BL/6 or substance P receptor-deficient mice were intragastrically infected with
HV-68. At varying days postinfection, splenic CD8+ T lymphocytes were isolated to quantify Ag-specific CTL activity. As shown in Fig. 5, wild-type C57BL/6 mice mounted a substantial CLT response at day 10 postinfection that begins to wane by 15 days postinfection. The magnitude and kinetics of this wild-type CTL response are similar to that previously reported by others (34). By comparison, substance P receptor-deficient mice had significantly less CTL activity than that observed in wild-type animals (Fig. 5). This was true for both 10 (Fig. 5) and 15 days postinfection (data not shown). Thus, the lack of a functional substance P receptor significantly affected the development and/or activity of a viral-specific CTL response.
|
HV-68-infected substance P receptor-deficient and C57BL/6 mice. Groups of mice were infected, and 15 days postinfection, splenic leukocytes were subjected to FACS analyses to quantify percentages of CD4+, CD8+, and CD19+ lymphocytes. No significant differences were observed in these lymphocyte subpopulations when comparing
HV-68-infected substance P receptor-deficient mice vs C57BL/6 mice.
Reduced IL-12 expression in substance P receptor-deficient mice following
HV-68 infection
Decreased levels of IL-12 derived from dendritic cells and macrophages can adversely affect the development and/or activity of CTL and Th1 cells (57). Therefore, we questioned whether substance P receptor-deficient mice had reduced IL-12 expression following infection with
HV-68. Groups of C57BL/6 or substance P receptor-deficient mice were intragastrically infected with virus, and at varying days postinfection, splenic RNA was isolated. A representative RT-PCR analysis is shown in Fig. 6A. Following
HV-68 infection, it was clear that substance P receptor-deficient mice did not have the ability to increase IL-12p40 mRNA expression to the level observed in infected C57BL/6 mice. This reduced increase in IL-12p40 mRNA expression by substance P receptor-deficient mice could not be ascribed to differences in input RNAs, nor to differences in the efficiency of reverse transcription, as evidenced by a lack of significant differences in IL-18 or G3PDH mRNA expression in either strain of mouse using the same cDNA for RT-PCR amplification (Fig. 6A). In addition, sera collected from mice at day 10 postinfection showed significantly lowered IL-12p40 protein content in substance P receptor-deficient mice when compared with C57BL/6 mice (Fig. 6B). ELISAs were also performed on sera to quantify the level of IL-12p75 present in infected mice. Despite the sensitivity of the ELISA for IL-12p75 being 20 pg/ml, we were unable to detect IL-12p75 in the sera of either C57BL/6 or substance P receptor-deficient mice. In contrast to IL-12p40 expression, IL-10 levels in the sera of
HV-68-infected substance P receptor-deficient mice were significantly higher than that observed in
HV-68-infected C57BL/6 mice (Fig. 6C). Together, these studies show that mice deficient in substance P receptor expression have altered cytokine responses following infection with this
-herpesvirus.
|
| Discussion |
|---|
|
|
|---|
HV-68 occurs early in infection and persists during the leukocytosis phase of the viral disease (Fig. 1). The response to this viral infection shows similarities and differences when compared with expression of substance P and its receptor during a bacterial infection (9, 11). Salmonella and
HV-68 are two very different pathogens; however, both induce early expression of substance P (9) and its receptor (11) in lymphoid tissues. This observation is a significant one, because it suggests that a common component of the host immune response to diverse mucosal pathogens involves this neuropeptide receptor. However, it should be noted that the kinetics of increased substance P and substance P receptor expression are somewhat different. Salmonella-infected mice have up-regulated substance P receptor expression in the mesenteric lymph nodes and spleens as early as 6 and 24 h, respectively (11). This is in contrast to receptor mRNA expression in the mesenteric lymph nodes and spleens of
HV-68-infected mice, which was detectable only after 48 and 96 h, respectively (Fig. 1). At present, it is not altogether clear why there were such differences in the kinetics of mRNA expression. Possible explanations could include the timing of microbial invasion into a particular organ, the type of inflammatory response induced by a particular pathogen, or variations in the cells that initially respond to the microbial infection.
The use of LacZ to interrupt exon 1 of the substance P receptor (11, 12, 39) provides a useful assay for in vivo transcriptional activation of this gene in substance P receptor-deficient animals. The striking localization of
-galactosidase activity to the marginal zone of
HV-68-infected spleens (Fig. 3C) provides an anatomical location for those cells most likely to up-regulate substance P receptor expression following infection. By 10 days postinfection, cells within the spleen that potentially contain virus include B lymphocytes (21), and possibly macrophages (27, 28) and dendritic cells (28). Infected B lymphocytes home to follicular regions (58), and transcriptional activation of the substance P receptor gene is clearly reduced or absent in the follicles of spleens from substance P receptor-deficient mice (Fig. 3C). Therefore, it is appropriate to conclude that follicular B cells do not respond to
HV-68 infection by significantly up-regulating substance P receptor expression, above any constitutive levels that might already be expressed. This result was somewhat unexpected because it is clear that B lymphocytes can express substance P receptors (59), and because substance P can augment B cell function (59).
The concentration of
-galactosidase activity in splenic marginal zones (Fig. 3C) suggested that macrophages, dendritic cells, T lymphocytes, or marginal zone B lymphocytes might be stimulated to up-regulate substance P receptor expression following infection. The dispersed nature of these
-galactosidase-positive cells, along with their often irregular morphology, suggested that macrophages or dendritic cells might be likely candidates for increased substance P receptor expression. This possibility is supported by the observation that
HV-68-infected macrophages derived from substance P receptor-deficient mice had increased
-galactosidase activity (Fig. 3F). Additional studies will be required to determine whether the increase in substance P receptor expression by macrophages is due to viral infection or some indirect effect. In addition, it will be important to determine whether T lymphocytes are capable of increased substance P receptor expression, and the factors involved if such induction is observed.
The recent availability of mouse strains that have been made genetically deficient in the expression of neuropeptide receptors or their ligands has added additional support for interactions between the nervous and immune systems (12, 39, 60, 61, 62, 63, 64). Often mice that are deficient in such receptors or ligands show altered responses when stimulated. The present study demonstrates that mice deficient in substance P receptor expression have an increased viral burden following
HV-68 infection (Fig. 4). This result is consistent with a previous report (64) using mice genetically deficient in preprotachykinin expression. This study demonstrated an increased viral burden in preprotachykinin-deficient mice following
HV-68 infection; however, the mechanisms responsible for this difference were not investigated (64). In our study, it is likely that a diminished CTL response by substance P receptor-deficient mice most likely contributed to an exacerbated viral infection (Fig. 5). As such, this is the first study to demonstrate that the lack of substance P receptor expression can reduce the CTL response. Furthermore, the preprotachykinin mRNA species can encode for multiple tachykinins (65), which can each interact preferentially with one of a group of neurokinin receptors (66, 67). Therefore, preprotachykinin-deficient mice are unable to produce any of these tachykinins, eliminating signaling through any of these neurokinin receptors. In our study, mice deficient in only one neurokinin receptor (i.e., the substance P receptor) were used to demonstrate that the lack of this receptor results in reduced CTL responses.
The exact mechanism responsible for such an effect on the CTL response is not clear. It is possible that signaling through substance P receptors expressed by CTL is necessary for optimal development and/or activity of this cell population. In support of this possibility, previous studies have suggested that CD8+ T lymphocytes can express substance P receptors (68, 69). Alternatively, the absence of substance P/substance P receptor interactions might limit the production of key factors by accessory cells that are necessary for the optimal development or activity of Ag-specific CTL. Substance P receptors have been reported to be expressed by Th cells, macrophages (6, 7, 11, 40, 42, 43), and dendritic cells (45). Each of these cell populations can provide soluble factors or express cell surface molecules capable of stimulating the development and/or activation of CTL. Evidence for such a hypothesis comes from the observation that mice deficient in substance P receptor expression demonstrated a reduced induction of IL-12p40 mRNA and protein expression following viral infection. Limited production of this key cytokine, which is necessary for optimal development of CTL and Th1 cells (57), could indirectly limit the formation of an optimal cell-mediated immune response. Clearly, such questions can be addressed, and the answers should provide important insights into the contributions made by substance P to CTL development and/or activity.
Substance P and its receptor have been implicated as contributing to a variety of deleterious proinflammatory responses sometimes referred to as neurogenic inflammation (39). It is important to note that the host response to
HV-68 infection being investigated in this study is not neurogenic inflammation, but rather a host response to a mucosal pathogen. This study together with the results of others (11, 12, 64) demonstrate that substance P and its receptor contribute to host responses directed against some very diverse microbial infections. Collectively, these works support the notion that this receptor and its ligand interact to augment the protective immune response.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kenneth L. Bost, Department of Biology, University of North Carolina, 9201 University City Boulevard, Charlotte, NC 28223. E-mail address: klbost{at}email.uncc.edu ![]()
3 Abbreviation used in this paper:
HV-68, murine
-herpesvirus 68. ![]()
Received for publication September 4, 2002. Accepted for publication December 17, 2002.
| References |
|---|
|
|
|---|
herpesviruses Epstein-Barr virus and herpesvirus saimiri. J. Gen. Virol. 71:1365.
herpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo. J. Gen. Virol. 73:3275.
herpesvirus 68. J. Virol. 71:5894.[Abstract]
-herpesvirus 68. J. Gen. Virol. 73:2347.
herpesvirus-68. J. Gen. Virol. 81:421.
herpesvirus 68-infected B cell-deficient mice. J. Gen. Virol. 77:2819.
-herpesvirus in the absence of CD4+ T cells. J. Exp. Med. 184:863.
herpesvirus 68 in peritoneal cells. J. Virol. 73:3273.
-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages. J. Immunol. 165:1074.
herpesvirus-induced splenomegaly: a critical role for CD4 T cells. J. Gen. Virol. 77:627.
-herpesvirus: role for a viral superantigen?. J. Exp. Med. 185:1641.
herpesvirus infection in mice deficient in CD4 and CD8 T cells. J. Virol. 67:5247.
herpesvirus latency by latent antigen-specific CD8+ T cells. J. Exp. Med. 192:943.
herpesvirus infection. J. Virol. 75:4435.
herpesvirus. J. Virol. 72:943.
herpesvirus. J. Immunol. 164:1820.
herpesvirus infection. Virology 261:173.[Medline]
herpesvirus-68-induced interleukin-10 increases viral burden, but limits virus-induced splenomegaly and leukocytosis. Immunology 104:109.[Medline]
up-regulate substance P receptor expression in murine peritoneal macrophages. J. Immunol. 165:182.
-induced TGF-
1 production by cultured murine macrophages. Cell. Immunol. 183:113.[Medline]
herpesvirus 68: a model for the study of
herpesvirus pathogenesis. Trends Microbiol. 6:276.[Medline]
herpesvirus 68. J. Virol. 76:3049.
herpesvirus-68 infection in interleukin-6-deficient mice. Virology 249:359.[Medline]
Interferon is not essential for recovery from acute infection with murine
herpesvirus 68. J. Virol. 71:3916.[Abstract]
herpesvirus-68 is necessary for the establishment of a normal latent load. J. Exp. Med. 194:301.
herpesvirus infection. J. Virol. 75:10467.This article has been cited by other articles:
![]() |
V. S. Chauhan, D. G. Sterka Jr., D. L. Gray, K. L. Bost, and I. Marriott Neurogenic Exacerbation of Microglial and Astrocyte Responses to Neisseria meningitidis and Borrelia burgdorferi J. Immunol., June 15, 2008; 180(12): 8241 - 8249. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gasper-Smith, I. Marriott, and K. L. Bost Murine {gamma}-Herpesvirus 68 Limits Naturally Occurring CD4+CD25+ T Regulatory Cell Activity following Infection J. Immunol., October 1, 2006; 177(7): 4670 - 4678. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Svensson, J. Kaim, C. Mallard, A. Olsson, E. Brodin, T. Hokfelt, and K. Eriksson Neurokinin 1 Receptor Signaling Affects the Local Innate Immune Defense against Genital Herpes Virus Infection J. Immunol., November 15, 2005; 175(10): 6802 - 6811. [Abstract] [Full Text] |