The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elsawa, S. F.
Right arrow Articles by Bost, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elsawa, S. F.
Right arrow Articles by Bost, K. L.
The Journal of Immunology, 2003, 170: 2605-2612.
Copyright © 2003 by The American Association of Immunologists

Reduced CTL Response and Increased Viral Burden in Substance P Receptor-Deficient Mice Infected with Murine {gamma}-Herpesvirus 681

Sherine F. Elsawa*, William Taylor*, Cynthia C. Petty*, Ian Marriott*, Joel V. Weinstock{dagger} and Kenneth L. Bost2,*

* Department of Biology, University of North Carolina, Charlotte, NC 28223; and {dagger} Division of Gastroenterology-Hepatology, Department of Internal Medicine, University of Iowa, Iowa City, IA 52242


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
One component of the protective host response against mucosal pathogens includes the local production and increased expression of certain neuropeptides and their receptors. The present study further demonstrates this fact by investigating the contribution that substance P receptor expression makes toward immunity against a {gamma}-herpesvirus infection. Following intragastric inoculation with murine {gamma}-herpesvirus 68 ({gamma}HV-68), expression of substance P and its receptor was increased in mucosal and peripheral lymphoid organs in wild-type strains of mice. These results suggested that this receptor/ligand pair might be an important component of the host response against this viral infection. Such a hypothesis was supported by the demonstration that mice, genetically deficient in substance P receptor expression, showed an increased viral burden when compared with syngeneic C57BL/6 mice. Furthermore, substance P receptor-deficient mice showed a reduced CTL response against {gamma}HV-68, suggesting a mechanism to explain this increased viral burden. Such limitations in the Ag-specific CTL response in substance P receptor-deficient mice could result from lowered expression of IL-12 during viral infection. Consistent with this hypothesis, increases in mRNA encoding IL-12 and secretion of this cytokine into sera of infected, wild-type animals were markedly reduced in substance P receptor-deficient mice. These studies demonstrate that genetic elimination of substance P receptors in mice results in an increased {gamma}-herpesvirus burden and an altered host response.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Substance P is typically regarded as a neuropeptide that is secreted by neurons both in the central and peripheral nervous systems (1, 2). However, a growing body of evidence suggests that cells of the immune system can also secrete this peptide (3, 4, 5, 6, 7, 8, 9). Irrespective of the cellular source, the presence of this neuronal- or leukocyte-derived peptide during immune responses against pathogens can significantly influence host responses, or can contribute to disease pathology (10). Specifically, in vivo antagonism of substance P results in an increased bacterial burden and a limited Th1 response during salmonellosis (11). Mice genetically deficient in substance P receptor expression (12) or wild-type mice treated with substance P receptor antagonists (13) show limited granuloma formation and IFN-{gamma} production following infection with schistosomiasis mansoni. Interestingly, lung infections with respiratory syncytial virus (14), mycoplasma (15), or parainfluenza virus (16) induce expression of substance P or its receptor, and contribute to the pathophysiology that accompanies such infections. Furthermore, substance P is induced following HIV infection (17), and the presence of this peptide seems to augment the ability of this virus to replicate (18). Taken together, these recent studies demonstrate specific mechanisms by which substance P, interacting with its receptor, can influence host responses during infectious diseases.

Murine {gamma}-herpesvirus 68 ({gamma}HV-68)3 is a {gamma}2-herpesvirus (19) that shares sequence homology and pathological similarities with EBV (20) and human herpesvirus-8 (21, 22). Intranasal (23) or gastric (24) inoculation with {gamma}HV-68 results in an acute, productive infection of lung or intestinal epithelial cells, respectively, followed by the dissemination of the virus to peripheral organs (23). B lymphocytes (21, 25, 26), macrophages (27), and possibly dendritic cells (28) become latently infected soon after inoculation. Levels of latent virus in the spleens of infected animals peak ~15 days postinfection, coinciding with a marked splenomegaly (23, 26, 29) due to an unregulated expansion of leukocyte populations (26, 30). The CTL response (31, 32, 33, 34), which develops during the primary infection, and possibly late-developing anti-viral Abs (35) are thought to limit secondary disease caused by the emergence of {gamma}HV-68 from latency.

Most evidence points to early IFN-{alpha}/{beta} production (36), followed by the development of a viral-specific CTL response (31, 32, 33, 34), as critical factors in a protective host response against this virus. Mice genetically deficient in type I IFN receptors are highly susceptible to a lethal infection by {gamma}HV-68 (36), indicating that this innate immune response is necessary for limiting early viral replication. Furthermore, in the absence of CD8+ T lymphocytes, mice have increased viral titers following infection (31). Development of a long-lived CD8+ CTL response requires CD4+ T lymphocytes (31, 32, 33, 34), and these CTLs most likely function to limit the extent of infection following reactivation (37). Therefore, the proper initiation of innate immune responses to allow development of viral-specific CTL responses is necessary for the optimal host response against {gamma}HV-68 infection.

An understanding of the contribution that substance P and its receptor makes to a developing, viral-specific CTL response has not been investigated. Therefore, the following studies focused on the importance of substance P receptor expression during {gamma}HV-68 infection. Surprisingly, the inability of genetically deficient mice to express a functional substance P receptor dramatically reduced viral-specific CTL responses, and resulted in an increased viral burden in these mutant mice. These studies represent the first to conclusively demonstrate that the lack of substance P receptor expression dramatically alters the host response during {gamma}HV-68 infection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Virus isolation and propagation

{gamma}HV-68 was kindly provided by A. Nash (University of Edinburgh, Edinburgh, U.K.) and P. Doherty (St. Jude’s Hospital, Memphis, TN). Virus stock was prepared by infecting BHK-21 cells (ATCC CCL-10) with {gamma}HV-68 at a low multiplicity of infection, followed by isolation of virus, as previously described (24, 38). Replicating virus present in viral stocks was quantified using serial dilutions on NIH-3T3 cell (ATCC CRL 1658) monolayers, as previously described (24, 38).

Mice

Substance P receptor-deficient mice, bred for >10 generations onto a C57BL/6 background, were derived at the University of Iowa Medical Center (12). These mice were originally derived from induced mutations made by insertion of the lacZ gene into exon 1 of the substance P receptor (39). Substance P receptor-deficient mice were routinely screened by PCR to confirm disruption of the substance P receptor, as previously described (39), using the positive and negative strand primers CCAACACCTCCAAGACTTCTG and GCCACAGCTATGGAGTAGAT for wild type, and TCCAGACTGCCTTGGGAAAA and GCCACAGCTGTCATGGAGTAGAT for substance P receptor deficiency, respectively. Substance P receptor-deficient or syngeneic C57BL/6 (The Jackson Laboratory, Bar Harbor, ME) mice weighing 18–22 g were used for all experiments.

Intragastric inoculation with {gamma}HV-68 or mock treatments

Mice were housed in isolation cages and given food and water ad libitum throughout the experimental period. For intragastric inoculations (24), mice were intubated with 6000 PFU of {gamma}HV-68 in 0.25 ml of PBS. For mock treatment, mice were handled in an identical manner, except that an equal volume of UV-killed {gamma}HV-68 was substituted for infectious virus. It should be noted that UV-inactivated viral preparations had undetectable levels of lytic virus, as determined using the plaque assay described below.

Measurement of splenomegaly

Following euthanasia, spleens from {gamma}HV-68-infected or mock-treated mice were removed and weighed. Single cell suspensions were made by gently pressing through a wire mesh screen. Hypotonic lysis was used to eliminate RBCs, and leukocytes were enumerated (Beckman Coulter, Hialeah, FL).

Quantification of lytic {gamma}HV-68 in tissue homogenates using a plaque assay

The presence of lytic virus was quantified, as previously described (24, 38), using a plaque-forming assay. Briefly, tissues isolated from the spleen or mesenteric lymph nodes were homogenized using pestles fitted into 1.5-ml microfuge tubes. Homogenates were then pulse sonicated (Vibra Cell, Newtown, CT) to release intracellular virus. After sonication, lysates were centrifuged at 5000 x g to remove cellular debris. Limiting dilutions of the lysates were then placed on NIH-3T3 monolayers for 1 h, followed by washing and overlaying with 0.15% agar (Difco, Detroit, MI) in RPMI 1640 with 30% FCS. After 5 days, overlays were removed and cell monolayers were stained with crystal violet. Plaque-forming units were quantified in duplicate at several serial dilutions of lysate to assure accuracy.

Infectious centers assay to quantify latent {gamma}HV-68 in cells isolated from tissues

The presence of latent virus was quantified using an infectious centers assay, as previously described (24, 38). For quantification of latent virus, spleens were removed and weighed, and total leukocytes were isolated from each organ. Limiting dilutions of isolated splenic leukocytes were then placed onto monolayers of NIH-3T3 cells. After 24 h, an agar overlay supplemented with medium and FCS was added, and allowed to incubate for 5 days in 5% CO2. The monolayers were then fixed and stained with crystal violet, and the number of infectious centers was counted in triplicate for several dilutions of cells for each experimental condition.

Semiquantitative RT-PCR to detect mRNA expression following {gamma}HV-68 infection

At the indicated times, total RNA was isolated from the mesenteric lymph nodes and spleens, as previously described (9, 11, 40, 41, 42, 43, 44, 45), using TRIzol reagent (Life Technologies, Gaithersburg, MD). A total of 1 µg total RNA was reverse transcribed using SuperScript II reverse transcriptase (Life Technologies). A portion of the total cDNA was amplified by PCR using 94°C denaturation, 59°C annealing, and 72°C extension temperatures, with the first three cycles having extended times. Positive and negative strand primers and the number of cycles used for amplification of each mRNA species were as follows: substance P receptor, 30 cycles, CCCATTGCTGCTCTCTTCGCCAGT and GGCCCACAGTGTCCCTACCAC; preprotachykinin, 30 cycles, TCTAAATTATTGGTCCGACTGGTC and TTCGTAGTTCTGCATTGCGCTTCT; IL-12p40, 27 cycles, GCACCAAATTACTCCGGACGGTTC and GCAAGTTCTTGGGCGGGTCTG; IL-18, 27 cycles, AACTTTGGCCGACTTCACTGTACAA and CTATTGATGTAAGTTAGTGAGAGTG; and G3PDH, 23 cycles, CCATCACCATCTTCCAGGAGCAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT, respectively. Amplified products were visualized under UV illumination following electrophoresis on ethidium bromide-stained agarose gels. Amplification of the appropriate gene fragments was assured by comparison with m.w. markers run on the same gel. It should be noted that the conditions for amplification of each mRNA species were predetermined to be within the linear range of amplification using methodologies previously described (9, 11, 40, 41, 42, 43, 44, 45). Densitometric analyses of the amplified fragments were performed using NIH Image. A gel-plotting macro was used to outline the bands, and the intensity was calculated on the uncalibrated OD setting.

Localization of {beta}-galactosidase activity in macrophages or spleens from substance P receptor-deficient mice following {gamma}HV-68 infection

Substance P receptor-deficient mice were constructed by replacing most of exon 1 with the genes encoding neomycin resistance and lacZ (39). The lacZ gene encodes for {beta}-galactosidase, and as such, expression of this enzyme occurs in substance P receptor-deficient mice when transcription activation at the substance P receptor gene locus occurs. Therefore, we used this fact to further define transcriptional activation of this gene following {gamma}HV-68 infection.

Peritoneal macrophages were isolated from C57BL/6 or substance P receptor-deficient mice, as previously described (42, 43, 44), and placed on round coverslips in 24-well plates. Macrophages were then exposed to {gamma}HV-68 (multiplicity of infection 1:1) for 2 h, and unattached virus was washed off. At 20 h postinfection, coverslips were washed, fixed with 0.25% glutaraldehyde, and incubated for 5 h in substrate solution (0.5 mg/ml 5-bromo-4-chloro-3-indolyl {beta}-D-galactoside, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 2 mM magnesium chloride, 0.02% Nonidet P-40, and 0.01% deoxycholic acid in PBS) at 37°C. The sections were then fixed for 10 min in 4% paraformaldehyde, washed in PBS, and counterstained with eosin.

Groups of C57BL/6 or substance P receptor-deficient mice were mock or {gamma}HV-68 infected, and 10 days later {beta}-galactosidase activity was detected in spleens. Tissues were embedded in OCT (Miles Scientific, Naperville, IL), frozen in liquid nitrogen, and cryostat sectioned. Slides were fixed using 0.25% glutaraldehyde in PBS for 30 min, washed, and then incubated at 37°C overnight in the substrate solution described above. Sections were then fixed for 10 min in 4% paraformaldehyde, washed, and counterstained with eosin.

Quantification of CTL activity using 51Cr release assays

51Cr release assays were performed, as previously described (46), with the following modifications. MC57G is a fibrosarcoma cell line derived from C57BL/6 mice, and has been used for cell-mediated cytotoxicity studies because it is readily infected with many virus strains (47). Empirical studies were performed to demonstrate that the MC57G cell line could be infected by {gamma}HV-68, and could express virally encoded mRNA following infection (data not shown). MC57G cells were infected with a multiplicity of infection of 5:1, and infected or uninfected cells were labeled with 150 µCi Na251CrO4 (100–500 mCi/mg Cr; Amersham, Arlington Heights, IL) for 16 h at 37°C. Before addition of the effector cells, MC57G target cells were washed twice in RPMI 1640.

Effector CD8+ T lymphocytes were purified by MACS, using methods that are previously described (38), from splenic leukocytes 10 days following mock treatment or infection with {gamma}HV-68. This time postinfection corresponds to the peak development of the CTL response in mice. CD8+ cells were greater than 90% pure, as determined by FACS analysis (data not shown). Effector cells were added to targets at ratios between 40:1 and 5:1 in triplicate wells of 96-well plates, and centrifuged at 200 x g for 1 min. Plates were incubated for 4–6 h at 37°C, gently pipetted, and centrifuged at 200 x g for 5 min. Supernatants were harvested from each well and counted for 51Cr release.

Percentage of specific lysis was calculated using the following equation:


Spontaneous release values were obtained by incubation of labeled target cells in the presence of medium alone. Maximum release values were obtained by addition of 2% Triton X-100 to labeled target cells. Results are reported as mean values of triplicate determinations.

ELISA for IL-10, IL-12p40, and IL-12p75

Following euthanasia, sera were collected from {gamma}HV-68-infected or mock-treated mice and subjected to ELISA analyses to quantify IL-10, IL-12p40, or IL-12p75, as previously described (38).

FACS analyses for quantification of the percentage of lymphocyte subpopulations

Immunofluorescence analyses were performed to determine the percentage of CD4, CD8, and CD19 lymphocytes present in the splenic leukocyte population of {gamma}HV-68-infected substance P receptor-deficient or C57BL/6 mice. PE-conjugated mAbs (BD PharMingen, San Diego, CA) were used in these studies. Immunofluorescence analyses were performed using a FACSCalibur (BD Biosciences, San Jose, CA) and analyzing 10,000 cells per stain.

Statistical analysis to determine significance

Statistically significant differences in spleen weights, infectious centers, percentage of specific lysis, levels of cytokines, and lymphocyte subpopulations were determined using the Student t test (GraphPad, San Diego, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Increased preprotachykinin and substance P receptor mRNA expression following {gamma}HV-68 infection of C57BL/6 mice

The localization of substance P at mucosal tissues (1, 48, 49) and the skin (50, 51) suggests a role for this neuropeptide in the protective response at sites in which pathogens enter the host. We began studies to demonstrate the importance for substance P receptor expression during the immune response against {gamma}HV-68. C57BL/6 mice were gastrically inoculated with {gamma}HV-68, and at varying times postinfection, the mesenteric lymph nodes and spleens were removed and subjected to semiquantitative RT-PCR analyses. Representative results of one such RT-PCR analysis are shown in Fig. 1, and demonstrate that substance P receptor mRNA expression increased in the mesenteric lymph nodes and spleens of {gamma}HV-68-infected C57BL/6 mice when compared with mock or uninfected controls.



View larger version (61K):
[in this window]
[in a new window]
 
FIGURE 1. Increased preprotachykinin and substance P receptor mRNA expression following {gamma}HV-68 infection of C57BL/6 mice. At the indicated days postinfection, the mesenteric lymph nodes (MLN) or spleens of C57BL/6 mice were removed, and semiquantitative RT-PCR was performed to detect substance P receptor (SPR) and preprotachykinin (PPT) mRNA expression. Representative results from one of four separate experiments are shown as amplified products electrophoresed on ethidium bromide-stained agarose gels.

 
In addition, Fig. 1 shows representative results of increased preprotachykinin mRNA expression following {gamma}HV-68 infection. It should be noted that two different amplified products are often observed when amplifying for preprotachykinin mRNA in these lymphoid organs. These two amplified products are expected, and correspond to the alternatively spliced {beta}- and {gamma}-preprotachykinin mRNA species, as previously reported (9). In addition, it is important to note that increased mRNA expression encoding this neuropeptide and its receptor continued to be expressed up to 15 days postinfection in the mesenteric lymph nodes and spleens of C57BL/6 mice. Similar increases in expression of preprotachykinin and substance P receptor mRNAs were seen following {gamma}HV-68 infection of BALB/c mice (data not shown). Taken together, these results clearly demonstrate increased expression of the mRNAs encoding substance P and its receptor following gastric infection with the {gamma}-herpesvirus, {gamma}HV-68.

Leukocytosis and viral latency in substance P receptor-deficient mice following infection with {gamma}HV-68

Some genetically deficient mice with particular immunologic abnormalities are unable to control the acute phase of {gamma}HV-68 infection, and ultimately succumb to this pathogen (36). Therefore, our first studies focused on defining any morbidity and mortality resulting from {gamma}HV-68 infection of substance P receptor-deficient mice. For these studies, groups of substance P receptor-deficient mice were gastrically inoculated with 6000 PFU of {gamma}HV-68 or mock treated. For the following 60 days, the general health and weights of these substance P receptor-deficient mice were monitored. Mice remained healthy, with no deaths, and weight gain was not significantly different when comparing these two groups of mutant mice (data not shown).

Additional groups of substance P receptor-deficient mice were infected with 6000 PFU of {gamma}HV-68 to follow acute viral replication in intestinal epithelial cells. Similar to previously published results (24), lytic virus was detected in isolated intestinal epithelial cells at days 2 or 4 postinfection (89 ± 11 or 51 ± 25 PFU/107 cells, respectively). However, by 15 days postinfection, less than 1 PFU of lytic virus/107 cells could be detected. These results clearly demonstrated that substance P receptor-deficient mice could control the lytic phase of viral infection and remained healthy months following infection.

Infection with {gamma}HV-68 mimics EBV infections in that splenomegaly and leukocytosis result from a virally induced dysregulation of the host response (23, 31, 52, 53). Genetically deficient mice have been used to identify molecules that might contribute to this expansion of leukocytes (25, 31, 38, 54, 55, 56), although the exact mechanism has yet to be defined. We questioned whether mice on a C57BL/6 background, made genetically deficient in expression of the substance P receptor (12, 39), exhibit virally induced splenomegaly and leukocytosis. Substance P receptor-deficient mice were identified by PCR (Fig. 2A) and mock treated or {gamma}HV-68 infected by gastric lavage. Splenomegaly was evident in all mice at 15 days postinfection (Fig. 2B), as was leukocytosis (2.1 ± 1.1 x 107 vs 0.2 ± 0.1 x 107 white blood cells/ml, respectively), when compared with mock-treated C57BL/6 mice. In addition, the quantity of latent {gamma}HV-68 in splenic leukocytes of infected substance P receptor-deficient mice peaked at approximately day 15 postinfection (Fig. 2C), which is consistent with the kinetics of latency following infection of wild-type mice (23, 31, 52, 53). The presence of splenomegaly (Fig. 2B), peak viral latency (Fig. 2C), and the lack of lytic virus 15 days postinfection are characteristics consistent with {gamma}HV-68 infection in wild-type strains of mice (23, 31, 52, 53). Surprisingly, therefore, mice genetically deficient in substance P receptor expression could effectively control the initial lytic viral infection, and were susceptible to viral-induced splenomegaly and leukocytosis.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 2. Splenomegaly and latent virus in substance P receptor-deficient mice following infection with {gamma}HV-68. DNA was isolated from C57BL/6 or syngeneic substance P receptor-deficient mice. DNA from both mouse strains was subjected to two different PCR analyses using specific primers that could identify the presence of wild-type vs disrupted substance P receptor genes (A). To demonstrate splenomegaly and leukocytosis in substance P receptor-deficient mice, groups of animals were mock or {gamma}HV-68 infected and, at the indicated times postinfection, spleen weights (B) and level of latent virus were determined (C). Results are presented as mean values ± SDs. An asterisk indicates a statistically significant difference (p < 0.01) when compared with mock-infected mice. These experiments were performed three times with similar results.

 
LacZ expression in {gamma}HV-68-infected substance P receptor-deficient mice

Substance P receptor-deficient mice were constructed by replacing most of exon 1 with the genes encoding neomycin resistance and lacZ (39). The lacZ gene encodes for {beta}-galactosidase, and as such, expression of this enzyme occurs in substance P receptor-deficient mice when transcription activation of this gene occurs. We investigated the expression of {beta}-galactosidase activity in substance P receptor-deficient mice as an indication of substance P receptor gene activation following infection. C57BL/6 or syngeneic substance P receptor-deficient mice were gastrically inoculated with {gamma}HV-68, and 10 days postinfection, spleens were removed and histochemical analyses were performed to determine {beta}-galactosidase activity. As expected, there was no significant {beta}-galactosidase activity in infected, wild-type C57BL/6 mice (Fig. 3A). Importantly, significant increases in {beta}-galactosidase activity were observed in {gamma}HV-68-infected substance P receptor-deficient mice (Fig. 3C) as compared with mock-treated mice (Fig. 3B). Interestingly, the {beta}-galactosidase activity was almost completely absent in the follicles, but localized to the marginal zones. The appearance of many of the {beta}-galactosidase-positive cells within the marginal zones appeared to have a macrophage-like morphology.



View larger version (125K):
[in this window]
[in a new window]
 
FIGURE 3. LacZ expression in {gamma}HV-68-infected substance P receptor-deficient mice. In vivo expression of {beta}-galactosidase was determined using spleen sections from substance P receptor-deficient or C57BL/6 mice (A–C). For these studies, substance P receptor-deficient mice were mock treated (B) or {gamma}HV-68 infected (C), and 10 days later {beta}-galactosidase activity was detected. Results are presented as representative micrographs of three separate sections for each of three separate experiments. Follicular (f) and marginal (m) regions within each spleen are indicated. As a control for {beta}-galactosidase activity, {gamma}HV-68-infected C57BL/6 mice were used (A). In vitro expression of {beta}-galactosidase activity was determined using cultured macrophages derived from substance P receptor-deficient or C57BL/6 mice (D–F). For these studies, macrophages from substance P receptor-deficient mice were mock treated (E) or {gamma}HV-68 infected (F), and 24 h later, {beta}-galactosidase activity was detected. Results are presented as representative micrographs of three separate experiments. As a control for {beta}-galactosidase activity, {gamma}HV-68-infected macrophages derived from C57BL/6 mice were used (D).

 
To address whether {gamma}HV-68 infection might induce {beta}-galactosidase activity in this cell population, macrophages, derived from C57BL/6 or substance P receptor-deficient mice, were cultured in the presence of {gamma}HV-68. At 24 h following infection, macrophages were fixed and stained for {beta}-galactosidase. Although {gamma}HV-68-infected macrophages from wild-type C57BL/6 mice expressed no such enzymatic activity (Fig. 3D), infected macrophages from substance P receptor-deficient mice had a high percentage of cells positive for {beta}-galactosidase (Fig. 3F), when compared with mock-treated macrophages (Fig. 3E). Of three separate experiments, 47 ± 11% of macrophages from {gamma}HV-68-infected cultures were positive for {beta}-galactosidase activity.

Taken together, the results shown in Figs. 1 and 3 support the notion that as yet undefined intracellular signals induce transcriptional activation of substance P receptors in C57BL/6 mice (Fig. 1), or transcriptional activation of {beta}-galactosidase in substance P receptor-deficient mice (Fig. 3), respectively, following infection with {gamma}HV-68.

Substance P receptor-deficient mice have increased viral latency following {gamma}HV-68 infection

Although it was clear that substance P receptor-deficient mice could control an acute {gamma}HV-68 infection, we questioned whether the latent viral burden was similar in C57BL/6 vs syngeneic substance P receptor-deficient mice. Groups of mice were infected with {gamma}HV-68, and 10 or 15 days following infection, splenic leukocytes were isolated to quantify levels of latent virus using an infectious centers assay. As shown in Fig. 4, substance P receptor-deficient mice had a significantly higher amount of latent {gamma}HV-68 at days 10 and 15 postinfection when compared with levels observed in infected C57BL/6 mice. This result demonstrated that the lack of substance P receptor expression resulted in an increased viral burden in these mutant mice.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 4. Substance P receptor-deficient mice have increased viral latency following {gamma}HV-68 infection. Groups of substance P receptor-deficient or C57BL/6 mice were mock treated or {gamma}HV-68 infected, and at days 10 or 15 postinfection, splenic leukocytes were isolated. An infectious centers assay was performed to quantify latent virus present in these cells. Results are presented as mean values ± SDs. Asterisks indicate a statistically significant difference (p < 0.01) when compared with infected C57BL/6 mice. These experiments were performed three times with similar results.

 
Reduced Ag-specific CTL response in substance P receptor-deficient mice

An effective CTL response is a critical component of the protective host response against {gamma}HV-68 (31, 32, 33). Mice that are CD8 deficient have greatly exaggerated viral burdens (31), and it has been postulated that an effective CTL response limits viral load during {gamma}-herpesvirus reactivation from latency (32). Therefore, we questioned whether the increased viral latency observed in substance P receptor-deficient mice might correlate with a lowered development of viral-specific CTL. Groups of C57BL/6 or substance P receptor-deficient mice were intragastrically infected with {gamma}HV-68. At varying days postinfection, splenic CD8+ T lymphocytes were isolated to quantify Ag-specific CTL activity. As shown in Fig. 5, wild-type C57BL/6 mice mounted a substantial CLT response at day 10 postinfection that begins to wane by 15 days postinfection. The magnitude and kinetics of this wild-type CTL response are similar to that previously reported by others (34). By comparison, substance P receptor-deficient mice had significantly less CTL activity than that observed in wild-type animals (Fig. 5). This was true for both 10 (Fig. 5) and 15 days postinfection (data not shown). Thus, the lack of a functional substance P receptor significantly affected the development and/or activity of a viral-specific CTL response.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 5. Reduced Ag-specific CTL responses in substance P receptor-deficient mice. Groups of substance P receptor-deficient (SPR-/-) or C57BL/6 (C57) mice were mock treated or {gamma}HV-68 infected, and at day 10 postinfection, CD8+ T lymphocytes were isolated from these spleens. Na251CrO4-labeled MC57G cells were infected with {gamma}HV-68, and added to the indicated number of effector CD8+ T lymphocytes. Results are presented as mean values of triplicate determinations with SDs always less than 20% of mean values. Asterisks indicate a statistically significant difference (p < 0.01) when compared with infected substance P receptor-deficient mice. These experiments were performed four times with similar results.

 
FACS analyses were used to determine whether any differences in splenic lymphocyte subpopulations might be observed between {gamma}HV-68-infected substance P receptor-deficient and C57BL/6 mice. Groups of mice were infected, and 15 days postinfection, splenic leukocytes were subjected to FACS analyses to quantify percentages of CD4+, CD8+, and CD19+ lymphocytes. No significant differences were observed in these lymphocyte subpopulations when comparing {gamma}HV-68-infected substance P receptor-deficient mice vs C57BL/6 mice.

Reduced IL-12 expression in substance P receptor-deficient mice following {gamma}HV-68 infection

Decreased levels of IL-12 derived from dendritic cells and macrophages can adversely affect the development and/or activity of CTL and Th1 cells (57). Therefore, we questioned whether substance P receptor-deficient mice had reduced IL-12 expression following infection with {gamma}HV-68. Groups of C57BL/6 or substance P receptor-deficient mice were intragastrically infected with virus, and at varying days postinfection, splenic RNA was isolated. A representative RT-PCR analysis is shown in Fig. 6A. Following {gamma}HV-68 infection, it was clear that substance P receptor-deficient mice did not have the ability to increase IL-12p40 mRNA expression to the level observed in infected C57BL/6 mice. This reduced increase in IL-12p40 mRNA expression by substance P receptor-deficient mice could not be ascribed to differences in input RNAs, nor to differences in the efficiency of reverse transcription, as evidenced by a lack of significant differences in IL-18 or G3PDH mRNA expression in either strain of mouse using the same cDNA for RT-PCR amplification (Fig. 6A). In addition, sera collected from mice at day 10 postinfection showed significantly lowered IL-12p40 protein content in substance P receptor-deficient mice when compared with C57BL/6 mice (Fig. 6B). ELISAs were also performed on sera to quantify the level of IL-12p75 present in infected mice. Despite the sensitivity of the ELISA for IL-12p75 being 20 pg/ml, we were unable to detect IL-12p75 in the sera of either C57BL/6 or substance P receptor-deficient mice. In contrast to IL-12p40 expression, IL-10 levels in the sera of {gamma}HV-68-infected substance P receptor-deficient mice were significantly higher than that observed in {gamma}HV-68-infected C57BL/6 mice (Fig. 6C). Together, these studies show that mice deficient in substance P receptor expression have altered cytokine responses following infection with this {gamma}-herpesvirus.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 6. IL-12 and IL-10 expression in {gamma}HV-68-infected mice. At the indicated days postinfection, the spleens of substance P receptor-deficient (SPR-/-) or C57BL/6 (C57) mice were removed, and semiquantitative RT-PCR was performed (A). RT-PCR was performed to detect IL-12p40, IL-18, or G3PDH mRNAs from each cDNA. Three separate studies were performed on two mice at each time point, with similar results. Sera were also collected from mice at 10 days postinfection, and ELISAs were performed to quantify IL-12p40 (B) and IL-10 (C). ELISA results are presented as means of triplicate determinations ± SDs. An asterisk indicates a statistically significant difference (p < 0.01) when comparing C57BL/6 mice with substance P receptor-deficient mice that were infected. These studies were performed three times with similar results.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The ability of pathogens to induce expression of neuropeptides and their receptors has been used as one argument for their importance during the host response (3, 5, 6, 7, 11, 12, 13, 14, 17). In the present study, increased expression of preprotachykinin mRNA and the substance P receptor at mucosal and peripheral sites following infection of C57BL/6 mice with {gamma}HV-68 occurs early in infection and persists during the leukocytosis phase of the viral disease (Fig. 1). The response to this viral infection shows similarities and differences when compared with expression of substance P and its receptor during a bacterial infection (9, 11). Salmonella and {gamma}HV-68 are two very different pathogens; however, both induce early expression of substance P (9) and its receptor (11) in lymphoid tissues. This observation is a significant one, because it suggests that a common component of the host immune response to diverse mucosal pathogens involves this neuropeptide receptor. However, it should be noted that the kinetics of increased substance P and substance P receptor expression are somewhat different. Salmonella-infected mice have up-regulated substance P receptor expression in the mesenteric lymph nodes and spleens as early as 6 and 24 h, respectively (11). This is in contrast to receptor mRNA expression in the mesenteric lymph nodes and spleens of {gamma}HV-68-infected mice, which was detectable only after 48 and 96 h, respectively (Fig. 1). At present, it is not altogether clear why there were such differences in the kinetics of mRNA expression. Possible explanations could include the timing of microbial invasion into a particular organ, the type of inflammatory response induced by a particular pathogen, or variations in the cells that initially respond to the microbial infection.

The use of LacZ to interrupt exon 1 of the substance P receptor (11, 12, 39) provides a useful assay for in vivo transcriptional activation of this gene in substance P receptor-deficient animals. The striking localization of {beta}-galactosidase activity to the marginal zone of {gamma}HV-68-infected spleens (Fig. 3C) provides an anatomical location for those cells most likely to up-regulate substance P receptor expression following infection. By 10 days postinfection, cells within the spleen that potentially contain virus include B lymphocytes (21), and possibly macrophages (27, 28) and dendritic cells (28). Infected B lymphocytes home to follicular regions (58), and transcriptional activation of the substance P receptor gene is clearly reduced or absent in the follicles of spleens from substance P receptor-deficient mice (Fig. 3C). Therefore, it is appropriate to conclude that follicular B cells do not respond to {gamma}HV-68 infection by significantly up-regulating substance P receptor expression, above any constitutive levels that might already be expressed. This result was somewhat unexpected because it is clear that B lymphocytes can express substance P receptors (59), and because substance P can augment B cell function (59).

The concentration of {beta}-galactosidase activity in splenic marginal zones (Fig. 3C) suggested that macrophages, dendritic cells, T lymphocytes, or marginal zone B lymphocytes might be stimulated to up-regulate substance P receptor expression following infection. The dispersed nature of these {beta}-galactosidase-positive cells, along with their often irregular morphology, suggested that macrophages or dendritic cells might be likely candidates for increased substance P receptor expression. This possibility is supported by the observation that {gamma}HV-68-infected macrophages derived from substance P receptor-deficient mice had increased {beta}-galactosidase activity (Fig. 3F). Additional studies will be required to determine whether the increase in substance P receptor expression by macrophages is due to viral infection or some indirect effect. In addition, it will be important to determine whether T lymphocytes are capable of increased substance P receptor expression, and the factors involved if such induction is observed.

The recent availability of mouse strains that have been made genetically deficient in the expression of neuropeptide receptors or their ligands has added additional support for interactions between the nervous and immune systems (12, 39, 60, 61, 62, 63, 64). Often mice that are deficient in such receptors or ligands show altered responses when stimulated. The present study demonstrates that mice deficient in substance P receptor expression have an increased viral burden following {gamma}HV-68 infection (Fig. 4). This result is consistent with a previous report (64) using mice genetically deficient in preprotachykinin expression. This study demonstrated an increased viral burden in preprotachykinin-deficient mice following {gamma}HV-68 infection; however, the mechanisms responsible for this difference were not investigated (64). In our study, it is likely that a diminished CTL response by substance P receptor-deficient mice most likely contributed to an exacerbated viral infection (Fig. 5). As such, this is the first study to demonstrate that the lack of substance P receptor expression can reduce the CTL response. Furthermore, the preprotachykinin mRNA species can encode for multiple tachykinins (65), which can each interact preferentially with one of a group of neurokinin receptors (66, 67). Therefore, preprotachykinin-deficient mice are unable to produce any of these tachykinins, eliminating signaling through any of these neurokinin receptors. In our study, mice deficient in only one neurokinin receptor (i.e., the substance P receptor) were used to demonstrate that the lack of this receptor results in reduced CTL responses.

The exact mechanism responsible for such an effect on the CTL response is not clear. It is possible that signaling through substance P receptors expressed by CTL is necessary for optimal development and/or activity of this cell population. In support of this possibility, previous studies have suggested that CD8+ T lymphocytes can express substance P receptors (68, 69). Alternatively, the absence of substance P/substance P receptor interactions might limit the production of key factors by accessory cells that are necessary for the optimal development or activity of Ag-specific CTL. Substance P receptors have been reported to be expressed by Th cells, macrophages (6, 7, 11, 40, 42, 43), and dendritic cells (45). Each of these cell populations can provide soluble factors or express cell surface molecules capable of stimulating the development and/or activation of CTL. Evidence for such a hypothesis comes from the observation that mice deficient in substance P receptor expression demonstrated a reduced induction of IL-12p40 mRNA and protein expression following viral infection. Limited production of this key cytokine, which is necessary for optimal development of CTL and Th1 cells (57), could indirectly limit the formation of an optimal cell-mediated immune response. Clearly, such questions can be addressed, and the answers should provide important insights into the contributions made by substance P to CTL development and/or activity.

Substance P and its receptor have been implicated as contributing to a variety of deleterious proinflammatory responses sometimes referred to as neurogenic inflammation (39). It is important to note that the host response to {gamma}HV-68 infection being investigated in this study is not neurogenic inflammation, but rather a host response to a mucosal pathogen. This study together with the results of others (11, 12, 64) demonstrate that substance P and its receptor contribute to host responses directed against some very diverse microbial infections. Collectively, these works support the notion that this receptor and its ligand interact to augment the protective immune response.


    Footnotes
 
1 This work was supported by a grant from the National Institutes of Health (AI32976). Back

2 Address correspondence and reprint requests to Dr. Kenneth L. Bost, Department of Biology, University of North Carolina, 9201 University City Boulevard, Charlotte, NC 28223. E-mail address: klbost{at}email.uncc.edu Back

3 Abbreviation used in this paper: {gamma}HV-68, murine {gamma}-herpesvirus 68. Back

Received for publication September 4, 2002. Accepted for publication December 17, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Pernow, B.. 1983. Substance P. Pharmacol. Rev. 35:85.[Medline]
  2. Ribeiro-da-Silva, A., T. Hokfelt. 2000. Neuroanatomical localization of substance P in the CNS and sensory neurons. Neuropeptides 34:256.[Medline]
  3. Lambrecht, B. N., P. R. Germonpre, E. G. Everaert, I. Carro-Muino, M. De Veerman, C. de Felipe, S. P. Hunt, K. Thielemans, G. F. Joos, R. A. Pauwels. 1999. Endogenously produced substance P contributes to lymphocyte proliferation induced by dendritic cells and direct TCR ligation. Eur. J. Immunol. 29:3815.[Medline]
  4. Pascual, D. W., K. L. Bost. 1990. Substance P production by P388D1 macrophages: a possible autocrine function for this neuropeptide. Immunology 71:52.[Medline]
  5. Weinstock, J. V., A. Blum, J. Walder, R. Walder. 1988. Eosinophils from granulomas in murine schistosomiasis mansoni produce substance P. J. Immunol. 141:961.[Abstract]
  6. Ho, W. Z., J. P. Lai, X. H. Zhu, M. Uvaydova, S. D. Douglas. 1997. Human monocytes and macrophages express substance P and neurokinin-1 receptor. J. Immunol. 159:5654.[Abstract]
  7. Lai, J. P., G. X. Zhan, D. E. Campbell, S. D. Douglas, W. Z. Ho. 2000. Detection of substance P and its receptor in human fetal microglia. Neuroscience 101:1137.[Medline]
  8. De Giorgio, R., P. L. Tazzari, G. Barbara, V. Stanghellini, R. Corinaldesi. 1998. Detection of substance P immunoreactivity in human peripheral leukocytes. J. Neuroimmunol. 82:175.[Medline]
  9. Bost, K. L.. 1995. Inducible preprotachykinin mRNA expression in mucosal lymphoid organs following oral immunization with Salmonella. J. Neuroimmunol. 62:59.[Medline]
  10. Marriott, I., K. L. Bost. 2001. Substance P. J. J. Oppenheim, and M. Feldmann, and S. K. Durum, and T. Hirano, and J. Vilcek, and N. A. Nicola, eds. Cytokine Reference, Chapter 13005. Academic, New York.
  11. Kincy-Cain, T., K. L. Bost. 1996. Increased susceptibility of mice to Salmonella infection following in vivo treatment with the substance P antagonist, spantide II. J. Immunol. 157:255.[Abstract]
  12. Blum, A. M., A. Metwali, M. Kim-Miller, J. Li, K. Qadir, D. E. Elliott, B. Lu, Z. Fabry, N. Gerard, J. V. Weinstock. 1999. The substance P receptor is necessary for a normal granulomatous response in murine schistosomiasis mansoni. J. Immunol. 162:6080.[Abstract/Free Full Text]
  13. Blum, A. M., D. E. Elliott, A. Metwali, J. Li, K. Qadir, J. V. Weinstock. 1998. Substance P regulates somatostatin expression in inflammation. J. Immunol. 161:6316.[Abstract/Free Full Text]
  14. Tripp, R. A., D. Moore, J. Winter, L. J. Anderson. 2000. Respiratory syncytial virus infection and G and/or SH protein expression contribute to substance P, which mediates inflammation and enhanced pulmonary disease in BALB/c mice. J. Virol. 74:1614.[Abstract/Free Full Text]
  15. Kwan, M. L., A. D. Gomez, P. Baluk, H. Hashizume, D. M. McDonald. 2001. Airway vasculature after mycoplasma infection: chronic leakiness and selective hypersensitivity to substance P. Am. J. Physiol. Lung Cell. Mol. Physiol. 280:L286.[Abstract/Free Full Text]
  16. Jacoby, D. B., B. L. Yost, T. Elwood, A. D. Fryer. 2000. Effects of neurokinin receptor antagonists in virus-infected airways. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L59.[Abstract/Free Full Text]
  17. Ho, W. Z., J. P. Lai, Y. Li, S. D. Douglas. 2002. HIV enhances substance P expression in human immune cells. FASEB J. 16:616.[Abstract/Free Full Text]
  18. Lai, J. P., W. Z. Ho, G. X. Zhan, Y. Yi, R. G. Collman, S. D. Douglas. 2001. Substance P antagonist (CP-96, 345) inhibits HIV-1 replication in human mononuclear phagocytes. Proc. Natl. Acad. Sci. USA 98:3970.[Abstract/Free Full Text]
  19. Efstathiou, S., Y. M. Ho, A. C. Minson. 1990. Cloning and molecular characterization of the murine herpesvirus 68 genome. J. Gen. Virol. 71:1355.[Abstract/Free Full Text]
  20. Efstathiou, S., Y. M. Ho, S. Hall, C. J. Styles, S. D. Scott, U. A. Gompels. 1990. Murine herpesvirus 68 is genetically related to the {gamma} herpesviruses Epstein-Barr virus and herpesvirus saimiri. J. Gen. Virol. 71:1365.[Abstract/Free Full Text]
  21. Sunil-Chandra, N. P., S. Efstathiou, A. A. Nash. 1992. Murine {gamma} herpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo. J. Gen. Virol. 73:3275.[Abstract/Free Full Text]
  22. Virgin, H. W., P. Latreille, P. Wamsley, K. Hallsworth, K. E. Weck, A. J. Dal Canto, S. H. Speck. 1997. Complete sequence and genomic analysis of murine {gamma} herpesvirus 68. J. Virol. 71:5894.[Abstract]
  23. Sunil-Chandra, N. P., S. Efstathiou, J. Arno, A. A. Nash. 1992. Virological and pathological features of mice infected with murine {gamma}-herpesvirus 68. J. Gen. Virol. 73:2347.[Abstract/Free Full Text]
  24. Peacock, J. W., K. L. Bost. 2000. Infection of intestinal epithelial cells and development of systemic disease following gastric instillation of murine {gamma} herpesvirus-68. J. Gen. Virol. 81:421.[Abstract/Free Full Text]
  25. Usherwood, E. J., J. P. Stewart, K. Robertson, D. J. Allen, A. A. Nash. 1996. Absence of splenic latency in murine {gamma} herpesvirus 68-infected B cell-deficient mice. J. Gen. Virol. 77:2819.[Abstract/Free Full Text]
  26. Cardin, R. D., J. W. Brooks, S. R. Sarawar, P. C. Doherty. 1996. Progressive loss of CD8+ T cell-mediated control of a {gamma}-herpesvirus in the absence of CD4+ T cells. J. Exp. Med. 184:863.[Abstract/Free Full Text]
  27. Weck, K. E., S. S. Kim, H. I. Virgin, S. H. Speck. 1999. Macrophages are the major reservoir of latent murine {gamma} herpesvirus 68 in peritoneal cells. J. Virol. 73:3273.[Abstract/Free Full Text]
  28. Flano, E., S. M. Husain, J. T. Sample, D. L. Woodland, M. A. Blackman. 2000. Latent murine {gamma}-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages. J. Immunol. 165:1074.[Abstract/Free Full Text]
  29. Usherwood, E. J., A. J. Ross, D. J. Allen, A. A. Nash. 1996. Murine {gamma} herpesvirus-induced splenomegaly: a critical role for CD4 T cells. J. Gen. Virol. 77:627.[Abstract/Free Full Text]
  30. Tripp, R. A., A. M. Hamilton-Easton, R. D. Cardin, P. Nguyen, F. G. Behm, D. L. Woodland, P. C. Doherty, M. A. Blackman. 1997. Pathogenesis of an infectious mononucleosis-like disease induced by a murine {gamma}-herpesvirus: role for a viral superantigen?. J. Exp. Med. 185:1641.[Abstract/Free Full Text]
  31. Ehtisham, S., N. P. Sunil-Chandra, A. A. Nash. 1993. Pathogenesis of murine {gamma} herpesvirus infection in mice deficient in CD4 and CD8 T cells. J. Virol. 67:5247.[Abstract/Free Full Text]
  32. Usherwood, E. J., D. J. Roy, K. Ward, S. L. Surman, B. M. Dutia, M. A. Blackman, J. P. Stewart, D. L. Woodland. 2000. Control of {gamma} herpesvirus latency by latent antigen-specific CD8+ T cells. J. Exp. Med. 192:943.[Abstract/Free Full Text]
  33. Belz, G. T., P. C. Doherty. 2001. Virus-specific and bystander CD8+ T-cell proliferation in the acute and persistent phases of a {gamma} herpesvirus infection. J. Virol. 75:4435.[Abstract/Free Full Text]
  34. Stevenson, P. G., P. C. Doherty. 1998. Kinetic analysis of the specific host response to a murine {gamma} herpesvirus. J. Virol. 72:943.[Abstract/Free Full Text]
  35. Sangster, M. Y., D. J. Topham, S. D’Costa, R. D. Cardin, T. N. Marion, L. K. Myers, P. C. Doherty. 2000. Analysis of the virus-specific and nonspecific B cell response to a persistent B-lymphotropic {gamma} herpesvirus. J. Immunol. 164:1820.[Abstract/Free Full Text]
  36. Dutia, B. M., D. J. Allen, H. Dyson, A. A. Nash. 1999. Type I interferons and IRF-1 play a critical role in the control of a {gamma} herpesvirus infection. Virology 261:173.[Medline]
  37. Khanna, R., S. R. Burrows. 2000. Role of cytotoxic T lymphocytes in Epstein-Barr virus-associated diseases. Annu. Rev. Microbiol. 54:19.[Medline]
  38. Peacock, J. W., K. L. Bost. 2001. Murine {gamma} herpesvirus-68-induced interleukin-10 increases viral burden, but limits virus-induced splenomegaly and leukocytosis. Immunology 104:109.[Medline]
  39. Bozic, C. R., B. Lu, U. E. Hopken, C. Gerard, N. P. Gerard. 1996. Neurogenic amplification of immune complex inflammation. Science 273:1722.[Abstract/Free Full Text]
  40. Bost, K. L.. 1995. Quantification of macrophage-derived substance P receptor mRNA using competitive polymerase chain reaction. Adv. Exp. Med. Biol. 373:219.[Medline]
  41. Bost, K. L., M. J. Mason. 1995. Thapsigargin and cyclopiazonic acid initiate rapid and dramatic increases of IL-6 mRNA expression and IL-6 secretion in murine peritoneal macrophages. J. Immunol. 155:285.[Abstract]
  42. Kincy-Cain, T., K. L. Bost. 1997. Substance P-induced IL-12 production by murine macrophages. J. Immunol. 158:2334.[Abstract]
  43. Marriott, I., K. L. Bost. 2000. IL-4 and IFN-{gamma} up-regulate substance P receptor expression in murine peritoneal macrophages. J. Immunol. 165:182.[Abstract/Free Full Text]
  44. Marriott, I., K. L. Bost. 1998. Substance P diminishes lipopolysaccharide and interferon-{gamma}-induced TGF-{beta}1 production by cultured murine macrophages. Cell. Immunol. 183:113.[Medline]
  45. Marriott, I., K. L. Bost. 2001. Expression of authentic substance P receptors in murine and human dendritic cells. J. Neuroimmunol. 114:131.[Medline]
  46. Hogan, R. J., W. R. Taylor, M. A. Cuchens, J. P. Naftel, L. W. Clem, N. W. Miller, V. G. Chinchar. 1999. Induction of target cell apoptosis by channel catfish cytotoxic cells. Cell. Immunol. 195:110.[Medline]
  47. Doherty, P. C., W. E. Biddison, J. R. Bennink, B. B. Knowles. 1978. Cytotoxic T-cell responses in mice infected with influenza and vaccinia viruses vary in magnitude with H-2 genotype. J. Exp. Med. 148:534.[Abstract/Free Full Text]
  48. Holzer, P., U. Holzer-Petsche. 1997. Tachykinins in the gut. I. Expression, release and motor function. Pharmacol. Ther. 73:173.[Medline]
  49. Joos, G. F., R. A. Pauwels. 2001. Tachykinin receptor antagonists: potential in airways diseases. Curr. Opin. Pharmacol. 1:235.[Medline]
  50. Rossi, R., O. Johansson. 1998. Cutaneous innervation and the role of neuronal peptides in cutaneous inflammation: a minireview. Eur. J. Dermatol. 8:299.[Medline]
  51. Scholzen, T., C. A. Armstrong, N. W. Bunnett, T. A. Luger, J. E. Olerud, J. C. Ansel. 1998. Neuropeptides in the skin: interactions between the neuroendocrine and the skin immune systems. Exp. Dermatol. 7:81.[Medline]
  52. Simas, J. P., S. Efstathiou. 1998. Murine {gamma} herpesvirus 68: a model for the study of {gamma} herpesvirus pathogenesis. Trends Microbiol. 6:276.[Medline]
  53. Doherty, P. C., R. A. Tripp, A. M. Hamilton-Easton, R. D. Cardin, D. L. Woodland, M. A. Blackman. 1997. Tuning into immunological dissonance: an experimental model for infectious mononucleosis. Curr. Opin. Immunol. 9:477.[Medline]
  54. Lee, B. J., S. K. Reiter, M. Anderson, S. R. Sarawar. 2002. CD28-/- mice show defects in cellular and humoral immunity but are able to control infection with murine {gamma} herpesvirus 68. J. Virol. 76:3049.[Abstract/Free Full Text]
  55. Sarawar, S. R., J. W. Brooks, R. D. Cardin, M. Mehrpooya, P. C. Doherty. 1998. Pathogenesis of murine {gamma} herpesvirus-68 infection in interleukin-6-deficient mice. Virology 249:359.[Medline]
  56. Sarawar, S. R., R. D. Cardin, J. W. Brooks, M. Mehrpooya, A. M. Hamilton-Easton, X. Y. Mo, P. C. Doherty. 1997. {gamma} Interferon is not essential for recovery from acute infection with murine {gamma} herpesvirus 68. J. Virol. 71:3916.[Abstract]
  57. Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13:251.[Medline]
  58. Bridgeman, A., P. G. Stevenson, J. P. Simas, S. Efstathiou. 2001. A secreted chemokine binding protein encoded by murine {gamma} herpesvirus-68 is necessary for the establishment of a normal latent load. J. Exp. Med. 194:301.[Abstract/Free Full Text]
  59. Bost, K. L., D. W. Pascual. 1992. Substance P: a late-acting B lymphocyte differentiation cofactor. Am. J. Physiol. 262:C537.[Abstract/Free Full Text]
  60. Turnbull, A. V., G. W. Smith, S. Lee, W. W. Vale, K. F. Lee, C. Rivier. 1999. CRF type I receptor-deficient mice exhibit a pronounced pituitary-adrenal response to local inflammation. Endocrinology 140:1013.[Abstract/Free Full Text]
  61. Venihaki, M., P. Dikkes, A. Carrigan, K. P. Karalis. 2001. Corticotropin-releasing hormone regulates IL-6 expression during inflammation. J. Clin. Invest. 108:1159.[Medline]
  62. Gaveriaux-Ruff, C., H. W. Matthes, J. Peluso, B. L. Kieffer. 1998. Abolition of morphine-immunosuppression in mice lacking the µ-opioid receptor gene. Proc. Natl. Acad. Sci. USA 95:6326.[Abstract/Free Full Text]
  63. Goetzl, E. J., J. K. Voice, S. Shen, G. Dorsam, Y. Kong, K. M. West, C. F. Morrison, A. J. Harmar. 2001. Enhanced delayed-type hypersensitivity and diminished immediate-type hypersensitivity in mice lacking the inducible VPAC(2) receptor for vasoactive intestinal peptide. Proc. Natl. Acad. Sci. USA 98:13854.[Abstract/Free Full Text]
  64. Payne, C. M., C. J. Heggie, D. G. Brownstein, J. P. Stewart, J. P. Quinn. 2001. Role of tachykinins in the host response to murine {gamma} herpesvirus infection. J. Virol. 75:10467.[Abstract/Free Full Text]
  65. Krause, J. E., J. M. Chirgwin, M. S. Carter, Z. S. Xu, A. D. Hershey. 1987. Three rat preprotachykinin mRNAs encode the neuropeptides substance P and neurokinin A. Proc. Natl. Acad. Sci. USA 84:881.[Abstract/Free Full Text]
  66. Regoli, D., A. Boudon, J. L. Fauchere. 1994. Receptors and antagonists for substance P and related peptides. Pharmacol. Rev. 46:551.[Medline]
  67. Hershey, A. D., P. E. Dykema, J. E. Krause. 1991. Organization, structure, and expression of the gene encoding the rat substance P receptor. J. Biol. Chem. 266:4366.[Abstract/Free Full Text]
  68. Goode, T., J. O’Connell, C. Sternini, P. Anton, H. Wong, G. C. O’Sullivan, J. K. Collins, F. Shanahan. 1998. Substance P (neurokinin-1) receptor is a marker of human mucosal but not peripheral mononuclear cells: molecular quantitation and localization. J. Immunol. 161:2232.[Abstract/Free Full Text]
  69. Qian, B. F., G. Q. Zhou, M. L. Hammarstrom, A. Danielsson. 2001. Both substance P and its receptor are expressed in mouse intestinal T lymphocytes. Neuroendocrinology 73:358.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
V. S. Chauhan, D. G. Sterka Jr., D. L. Gray, K. L. Bost, and I. Marriott
Neurogenic Exacerbation of Microglial and Astrocyte Responses to Neisseria meningitidis and Borrelia burgdorferi
J. Immunol., June 15, 2008; 180(12): 8241 - 8249.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Gasper-Smith, I. Marriott, and K. L. Bost
Murine {gamma}-Herpesvirus 68 Limits Naturally Occurring CD4+CD25+ T Regulatory Cell Activity following Infection
J. Immunol., October 1, 2006; 177(7): 4670 - 4678.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Svensson, J. Kaim, C. Mallard, A. Olsson, E. Brodin, T. Hokfelt, and K. Eriksson
Neurokinin 1 Receptor Signaling Affects the Local Innate Immune Defense against Genital Herpes Virus Infection
J. Immunol., November 15, 2005; 175(10): 6802 - 6811.
[Abstract] [Full Text]