The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sano, K.
Right arrow Articles by Tamura, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sano, K.
Right arrow Articles by Tamura, G.
The Journal of Immunology, 2003, 170: 2367-2373.
Copyright © 2003 by The American Association of Immunologists

Oligodeoxynucleotides Without CpG Motifs Work as Adjuvant for the Induction of Th2 Differentiation in a Sequence-Independent Manner1

Kunio Sano2,*, Hidekazu Shirota*, Tadashi Terui{dagger}, Toshio Hattori* and Gen Tamura*

Departments of * Respiratory and Infectious Diseases and {dagger} Dermatology, Graduate School of Medicine, Tohoku University, Sendai, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The outcomes of immune responses are regulated by various parameters including how Ags are handled by APCs. In this study, we describe the intrinsic immunomodulatory characteristics of oligodeoxynucleotides (ODNs) that improve the Ag presentation by APCs. ODNs (20-mer) containing CpG motifs induced strong Th1-skewed responses. In contrast, those without CpG motifs enhanced cytokine production by effector Th cells without particular skewing toward Th1 responses or induced the differentiation of unprimed CD4+ T cells toward Th2 cells. These functional features were prominently envisaged when ODNs were conjugated to the Ag, and were underlain by the facilitated binding of ODN-conjugated Ag to Ia+ cells. Despite the functional differences between ODNs with CpG motifs and those without CpG motifs, both ODNs bound to Ia+ cells with similar affinity and kinetics. Immunoenhancing activities of the ODNs were not sequence-dependent; the characteristics, including the facilitation of Ag capture, enhancement of effector Th cell responses, and induction of Th2 cells, were shared by randomly synthesized ODNs conjugated to Ag. This is the first study suggesting that ODNs, independent of the sequences, enhance immune responses through the promoted capture of ODN-conjugated Ag by APCs.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunostimulatory activities of oligodeoxynucleotides (ODNs)3 have recently attracted much interest. ODNs containing CpG motifs (CpG) induce the expression of costimulatory molecules and IL-12 in APCs, which are in turn capable of inducing Th1 cells (1, 2, 3, 4). These steps are initiated by the binding of CpG to APCs, and appear to be mediated by surface receptors specific for ODNs (5). Although ODNs bind to several surface molecules (6, 7, 8, 9, 10, 11, 12, 13), the identities of the receptors involved in the CpG-mediated activation have not been determined yet. Toll-like receptor (TLR)-9 is an essential intracytoplasmic mediator that colocalizes with CpG and transduces signals (14, 15, 16).

ODNs without CpG motifs (nonCpG) also bind to cells through surface receptors. CpG and nonCpG share common surface receptors and bind to them with the same affinity (5). However, binding of nonCpG failed to induce the maturation or activation of APCs (17). Failure to activate APCs was in parallel with the inability of nonCpG to colocalize with TLR-9 (15, 16). The functional involvement of nonCpG in the immune system largely remains unknown.

The first essential step for T cell immunity is the capture and presentation to T cells by APCs of Ag from the surrounding environment. Dendritic cells (DCs) are known to be specialized for Ag presentation because they are equipped with machinery to efficiently capture diverse Ags (18, 19, 20). B cells also turn into efficient APCs when Ags are captured through surface Ig (21, 22, 23). The ability of DCs and B cells to catch Ags was, however, greatly improved when the Ag was directly conjugated to ODNs (17, 24, 25). A particular consequence following the uptake of CpG-conjugated Ag by DCs is the activation of Ag-specific Th1 cells (17, 24). NonCpG also bind to cells through the same receptor as CpG (5), although little is known about the immunological effects of nonCpG or nonCpG-mediated Ag capture.

In this study, we reveal a novel feature of nonCpG as immunomodulators. NonCpG could induce enhancement of Th cell responses and Th2 skewing, which could be demonstrated when nonCpG was directly conjugated to Ag.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

BALB/c mice were bred in our animal facility and were used at 7 to 12 wk of age. BALB/c mice transgenic (tg) for TCR specific for OVA323–339 and I-Ad were supplied by Dr. S. Habu (Tokai University, Kanagawa, Japan) (26), and bred in our laboratories. TLR9-deficient mice (14) were kindly provided by Dr. S. Akira (Osaka University, Osaka, Japan).

ODNs and direct conjugation to Ags

The sequences of the 20-mer CpG and nonCpG were TCCATGACGTTCCTGACGTT and TCCATGAGCTTCCTGAGTCT, respectively. CpG, nonCpG, and randomly synthesized 20-mer ODNs (RSOs) were synthesized by Nihon Gene Research Laboratories (Sendai, Japan) or Takara Shuzo (Osaka, Japan), and were fully phosphorothioated. ODNs containing a thiol residue at the 5' end were used for the conjugation to proteins. The LPS content of ODN was <6 pg of LPS/mg of DNA, as measured by Limulus HS-J Single test (Wako Pure Chemical, Osaka, Japan). The ODNs were conjugated to OVA and R-PE (Molecular Probes, Eugene, OR) by mixing thiolated ODNs and maleimide-activated Ag using sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carobylate (Pierce, Rockford, IL) in our laboratory. Unconjugated ODNs were removed by extensive dialysis. The conjugates were purified by gel filtration chromatography to minimize the effects of contaminating aggregates, as described previously (17). The molar and weight ratios of the ODN-Ag are listed in Table I.


View this table:
[in this window]
[in a new window]
 
Table I. Molar and weight ratios of ODN to Ag

 
Incubation of spleen cells with ODN-conjugate PE

BALB/c spleen cells (1 x 106/ml) depleted of RBC were incubated with 10 µg/ml PE, either alone or conjugated with CpG, nonCpG, or RSOs, at 37°C for 12 h, except in a kinetics experiment, where the incubation was conducted for varying periods of time at 4°C to minimize fluid-phase endocytosis. Then, the cells were stained with FITC-labeled anti-I-Ad mAb (MK-D6) (27) together with or without biotinylated mAb against CD40 (Caltag Laboratories, Burlingame, CA) or CD86 (Caltag Laboratories), and analyzed using FACSCaliber (BD Biosciences, Mountain View, CA). The binding of biotinylated reagents was visualized using streptavidin-conjugated allophycoerythrin (Biomeda, Foster City, CA). FITC (Sigma-Aldrich, St. Louis, MO) was conjugated to anti-I-Ad mAb in our laboratory after the partial purification of ascites by ammonium sulfate precipitation. Propidium iodide (Sigma-Aldrich)-stained dead cells were excluded from analyses.

Treatment with monodansyl cadavarine and confocal microscopy

Spleen cells were layered onto 55% Percoll (Pharmacia, Uppsala, Sweden) and centrifuged for 15 min at 2000 x g. Ia+-enriched cells (>95% purity) were recovered from the top layer. After treatment with or without monodansyl cadavarine (MDC; 500 µM; Sigma-Aldrich) for 30 min at 37°C, the Ia-enriched cells were incubated with CpG-PE for 1 h at 37°C. The stained cells were examined using a confocal laser scanning microscope (MR/AG-1; Bio-Rad, Hercules, CA). PE was excited with 488-nm argon and emission spectra were collected with 570-nm long pass filters.

Competitive inhibition with free ODNs

The Ia-enriched cells were preincubated with graded doses of CpG, or 300 µg/ml CpG or nonCpG for 30 min, followed by CpG or nonCpG (1 µg/ml) conjugated with R-PE for an additional 30 min at 4°C. After washing, the cells were analyzed for the expression of R-PE using flow cytometry.

In vitro restimulation of PE-primed lymph node (LN) cell

BALB/c mice were primed s.c. with 100 µg of R-PE emulsified in CFA in the hind footpads. After 7 days, popliteal LN cells (3 x 105/well) were cultured with graded concentrations of PE, nonCpG-PE, or CpG-PE in quadruplicate in 96-well plates. After 2 days, the culture supernatants were assayed for IFN-{gamma}.

In vitro restimulation of OVA-specific Th1 or Th2 cells

The induction of OVA-specific Th1- and Th2-enriched cells was described previously (24). CD4+ Th cells (1 x 105) were cocultured with 2 x 105 APCs in the presence of OVA, CpG-OVA, or nonCpG-OVA in quadruplicate in 96-well plates. APCs were prepared by treating spleen cells from unimmunized BALB/c mice with mitomycin C (50 µg/ml; Wako Pure Chemical) for 30 min at 37°C. After 2 days, the culture supernatants were assayed for IFN-{gamma} and IL-4.

In vitro induction of effector Th cells and in vitro restimulation

Spleen cells (5 x 106) from unimmunized anti-OVA TCR tg mice were cultured with graded doses of CpG-OVA or nonCpG-OVA in 12-well plates. For blocking with Abs, the cultures were initiated in the presence of 10 or 1 µg/ml anti-IL-4 (BD PharMingen, San Diego, CA), anti-CD86 (BD PharMingen) or isotype-matched control IgG2b mAb (BD PharMingen). After 6 days, viable lymphocytes (1 x 105) recovered from the interface by Ficoll-Paque (Pharmacia Biotech, Uppsala, Sweden) density-gradient centrifugation were restimulated with 2 x 105 APCs in the presence of OVA (100 µg/ml) in quadruplicate in 96-well plates. After 2 days, the culture supernatants were assayed for IFN-{gamma} and IL-4.

In vivo induction of effector Th cells and in vitro restimulation

BALB/c mice were primed s.c. with 5 µg of OVA, nonCpG-OVA, or CpG-OVA on days 0 and 7. On day 14, popliteal LN cells (3 x 105/well) were cultured with OVA (100 µg/ml) in quadruplicate in 96-well plates. After 2 days, the culture supernatants were assayed for IFN-{gamma} and IL-4.

Cytokine assay

Cytokine concentrations in the culture supernatants were determined using ELISA, as described previously (28). Paired anti-IL-4 and anti-IFN-{gamma} mAbs were purchased from BD PharMingen. Tetramethylbenzidine reagent (Kirkegaard & Perry Laboratories, Gaithersburg, MD) was used for color development, and OD450 were converted to concentrations (nanograms per milliliter) according to a standard curve. Standard recombinant mouse IL-4 and IFN-{gamma} were purchased from Genzyme (Cambridge, MA).

In vivo IgG responses

BALB/c mice were immunized i.p. with 10 µg of OVA, either alone or conjugated with CpG or nonCpG, twice at a 14-day interval. Fourteen days after the second immunization, the sera were assayed for OVA-specific IgG1 and IgG2a using ELISA after appropriate dilutions. Anti-OVA IgG1 and IgG2a Abs bound to the immobilized OVA were detected with alkaline phosphatase-conjugated anti-IgG1 (Southern Biotechnology Associates, Birmingham, AL) and IgG2a (Southern Biotechnology Associates) Abs, respectively. Colors were developed using K-Gold PNPP substrate (Neogen, Lexington, KY). Titers were compared with serial dilutions of standard sera prepared from mice hyperimmunized with OVA in alum and that in CFA for IgG1 and IgG2a detections, respectively. Results are expressed as arbitrary units per milliliter.

Statistics

Data of in vitro culture experiments and in vivo anti-OVA Ab responses were expressed as the mean ± SEM. Each experiment was repeated at least twice. The Student t test was used in the analysis of the results.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Binding and endocytosis of CpG- and nonCpG-conjugated PE in Ia+ cells

We first examined the binding of ODNs to splenocytes using the conjugates with fluorescent protein, PE. Spleen cells were incubated with PE (1 µg/ml), either alone or conjugated with CpG or nonCpG, and examined for fluorescence emitted from PE by flow cytometry. In contrast to PE alone that poorly bound to spleen cells, ODN-conjugated PE strongly stained spleen cells, the majority of which were positive for Ia expression (Fig. 1A). CpG- and nonCpG-conjugated PE stained Ia+ cells to a similar extent. Experiments with graded doses of PE showed that unconjugated PE bound to Ia+ cells in a dose-dependent manner over wide ranges of doses, whereas CpG- and nonCpG-conjugated PE practically reached plateau levels at lower doses of PE (Fig. 1B). ODN-conjugated PE was calculated to bind to Ia+ cells ~30 times more efficiently than ODN-unconjugated PE (Fig. 1B). Time-course experiments revealed that the binding was rapid and reached a plateau by 30 min even at 4°C, a temperature at which endocytosis is minimized (Fig. 1C). Both CpG- and nonCpG-conjugated PE bound to Ia+ cells to comparable extents at all time points examined (Fig. 1C).



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 1. Binding and endocytosis of CpG- and nonCpG-conjugated PE in Ia+ cells. Spleen cells were incubated with 10 µg/ml (A and C) or graded doses (B) of PE ({circ}), CpG-conjugated PE (CpG-PE; {blacksquare}), or nonCpG-conjugated PE (nonCpG-PE; {square}) at 37 (A and B) or 4°C (C). The stained cells were analyzed using flow cytometry. The relationship between PE staining and Ia expression (A) and MFI of PE staining in gated Ia+ cells (B and C) is shown. D, The Ia-enriched cells were pretreated with or without MDC before the incubation with CpG-PE (10 µg/ml). Emission from PE was examined using confocal microscopy. Each experiment was repeated at least twice with similar results.

 
When the Ia+ cells were pretreated with MDC, a transglutaminase inhibitor that inhibits receptor-mediated endocytosis (29), the Ia+ cells were stained with CpG-conjugated PE in a generalized ring type fluorescence pattern, whereas the MDC-untreated Ia+ cells showed a granular pattern (Fig. 1D).

When the Ia+ cells were preincubated with graded doses of free CpG before the incubation with CpG-conjugated PE, the binding of CpG-conjugated PE to the Ia+ cells was inhibited in a dose-dependent manner (Fig. 2A). The inhibition was maximal at a dose of 1000 µg/ml CpG, where the mean fluorescence intensity (MFI) was almost equivalent to the autofluorescence level of the unstained Ia+ cells (MFI = 17) (Fig. 2A). Both CpG- and nonCpG-conjugated PE bound to Ia+ cells to a comparable level (Fig. 2B). The binding of CpG- and nonCpG-conjugated PE was inhibited to a similar extent by the preincubation with excess doses of either free CpG or nonCpG (Fig. 2B).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 2. Competitive inhibition with free ODNs. The Ia-enriched cells were incubated with 1 µg/ml PE conjugated with CpG (A and B) or nonCpG (B) following preincubation with graded doses of free CpG (A), or 300 µg/ml of free CpG or nonCpG (B). The stained cells were analyzed using flow cytometry. Each experiment was repeated twice with similar results.

 
These results suggest that ODN-conjugated proteins can bind to Ia+ cells through surface receptors at similar affinity and kinetics irrespective of the presence of CpG motifs in the ODNs.

No need for TLR9 in ODN-mediated Ag uptake by Ia+ cells

We examined whether TLR9 is involved in the ODN-mediated uptake of Ag. Following the incubation of the Ia-enriched cells with nonCpG- or CpG-conjugated PE, either was incorporated into almost all the Ia+ cells to similar extents, regardless of whether or not TLR9 was expressed in the Ia+ cells (Fig. 3). In sharp contrast to the Ag uptake, CpG was essential for the activation of the Ia+ cells, as revealed by the increased proportion of the CD86+ cells (Fig. 3A) and the enhanced expression of CD40 (Fig. 3B). Thus, TLR9 is not required for the uptake of ODN-conjugated Ag.



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 3. No need for TLR9 in ODN-mediated Ag uptake by Ia+ cells. Purified Ia+ cells from TLR9-deficient (TLR9 KO) or wild-type (WT) mice were incubated with PE (10 µg/ml) conjugated with CpG or nonCpG overnight. Then, the Ia+ cells were examined for the expression for PE and CD86 (A) or PE and CD40 (B). Results shown are representative of three experiments with similar results. The numbers in figures indicate the percentage of cells in each quadrant (A) and CD40 MFI on the total acquired cells (B).

 
Activation of Th cells by ODN-conjugated Ag

We next examined the functional difference between CpG-conjugated and nonCpG-conjugated Ag. PE-primed LN cells were stimulated with graded doses of PE, either alone or conjugated with CpG or nonCpG. In comparison to stimulation with PE alone, the IFN-{gamma} production from PE-primed LN cells was enhanced by approximately an order of magnitude when stimulated with the same dose of PE conjugated with nonCpG (Fig. 4A). The enhancement of IFN-{gamma} production by nonCpG-conjugated Ag was, however, not so high as that by CpG-conjugated Ag.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 4. Activation of Th cells by ODN-conjugated Ag. A, BALB/c mice were primed with PE in CFA in the hind footpads. Regional LN cells were cultured with titrated doses of PE, nonCpG-PE, or CpG-PE for 2 days, and levels of IFN-{gamma} in culture supernatants were determined. B, Th1 and Th2 cells induced in vitro from OVA-specific CD4+ T cells were stimulated with indicated doses (micrograms per milliliter) of OVA, nonCpG-OVA, or CpG-OVA for 2 days, and culture supernatants were assayed for IFN-{gamma} ({blacksquare}) and IL-4 (). Each experiment was repeated three times independently with similar results. *, p < 10-8; **, p < 0.001 (compared with the nonCpG-OVA group).

 
To further clarify the functional effects, we examined the activation of Th1 or Th2 cells by ODN-conjugated Ag. OVA-specific T cells enriched for Th1 and Th2 cells predominantly produced IFN-{gamma} and IL-4 in response to OVA stimulation (100 µg/ml), respectively (Fig. 4B). Stimulation of Th1 or Th2 cells with 1 µg/ml OVA failed to induce the production of cytokines, whereas the same concentration of OVA conjugated with nonCpG induced the secretion of IFN-{gamma} from Th1 cells and IL-4 from Th2 cells, and the cytokine levels were comparable to those induced by a 100-fold higher dose of unconjugated OVA. In contrast, CpG-conjugated OVA enhanced the production of IFN-{gamma}, but not IL-4, from Th1- and Th2-enriched cells as well.

Induction of effector Th cells by ODN-conjugated Ag

We next examined the effects of ODN-conjugated OVA on the differentiation of unprimed T cells into effector Th cells. OVA-specific CD4+ T cells were cultured with graded concentrations of OVA conjugated with CpG or nonCpG, and restimulated with OVA. CpG-conjugated OVA induced Th1 differentiation (Fig. 5A), whereas nonCpG-conjugated OVA induced Th2 differentiation (Fig. 5B). Another difference was the antigenicity of the conjugate, since the effects of CpG-OVA reached a plateau at a dose of 0.1 µg/ml (Fig. 5A), whereas those of nonCpG-OVA were maximal at a 10-fold higher dose (Fig. 5B).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 5. Induction of effector Th cells by ODN-conjugated Ag. A–C, Spleen cells from OVA-specific tg mice were cultured with graded doses of CpG-OVA (A) or nonCpG-OVA (B), or 1 µg/ml nonCpG-OVA in the presence of the indicated doses of Abs (C), for 6 days, and the viable cells were restimulated with 100 µg/ml OVA. D and E, BALB/c mice were primed with 5 µg of OVA, nonCpG-OVA, or CpG-OVA in the hind footpads on days 0 and 7. On day 14, regional LN cells were stimulated in vitro with 100 µg/ml OVA for 2 days, and culture supernatants were assayed for IFN-{gamma} (D) and IL-4 (E). Data were representative of three independent experiments. *, p < 0.0005; **, p < 0.001 (compared with the control Ab group); ***, p < 10-4; ****, p < 0.001 (comparison between the nonCpG-OVA and CpG-OVA groups. CTRL, Isotype-matched control Ab.

 
We then examined whether IL-4 and CD86 were involved in the Th2 induction by nonCpG-conjugated Ag. When T cells were cultured with nonCpG-OVA in the presence of anti-IL-4 or anti-CD86 mAb, the recovered Th cells failed to produce IL-4 in response to Ag restimulation (Fig. 5C), indicating that the development of nonCpG-OVA-induced Th2 cells is, like ordinal Th2 cells, dependent on IL-4 and costimulatory molecules.

We next examined the in vivo effects of ODN-conjugated OVA on the differentiation of Th cells. Regional LN cells from mice primed with OVA, either alone or conjugated with CpG or nonCpG, were stimulated in vitro with OVA, and cytokine production was assessed. Immunization with OVA alone failed to prime Th cells (Fig. 5, D and E). The same dose of OVA conjugated with nonCpG, however, induced the differentiation into Th2 cells that predominantly produced IL-4, whereas OVA conjugated with CpG induced Th1 cells (Fig. 5, D and E).

To generalize the observations obtained with nonCpG-conjugated Ag, we conducted experiments using RSOs. Spleen cells were incubated with PE, either alone, mixed or conjugated with RSOs, and analyzed by flow cytometry. Binding of PE to Ia+ cells was enhanced when PE was conjugated with RSOs, whereas PE inefficiently bound to spleen cells even in the presence of attendant RSOs (Fig. 6A). Lack of the activation of Ia+ cells by nonCpG was also substantiated, because RSO-conjugated PE failed to augment CD86 (Fig. 6B) or CD40 expression (Fig. 6C) in the gated Ia+ cells, which was in sharp contrast to our previous observations with CpG-conjugated PE (17). Thus, the facilitated binding of ODN-conjugated Ag to Ia+ cells is a shared and sequence-independent characteristic of ODNs. The skewing toward Th2 cell by ODN-conjugated Ag is also a generalized feature, because the injection of OVA conjugated, but not mixed, with RSOs induced Th2 cells (Fig. 6D).



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 6. RSO-conjugated Ag enhanced Ag-binding and Th2 induction. A–C, Spleen cells were incubated with 10 µg/ml PE, either alone, mixed, or conjugated with RSOs for 3 h. The cells were then stained with FITC-anti-Ia mAb (A–C), together with anti-CD86 (B) or anti-CD40 (C) mAb, and analyzed using flow cytometry. Only gated Ia+ cells were shown in B and C. D, BALB/c mice were primed with 5 µg of OVA, RSO + OVA, or RSO-OVA in the hind footpads on days 0 and 7. On day 14, regional LN cells were stimulated with 100 µg/ml OVA for 2 days, and culture supernatants were assayed for IFN-{gamma} ({blacksquare}) and IL-4 (). Each experiment was repeated three or four times with similar results. *, p < 0.005 (compared with the RSO + OVA group)

 
In vivo IgG responses

We examined the effects of nonCpG-conjugated OVA on in vivo Ig production. Immunization of mice with OVA alone failed to mount anti-OVA Ab production (Fig. 7). The same dose of OVA conjugated with nonCpG induced exclusively IgG1 production, which is a hallmark of Th2 responses. The anti-OVA IgG2a isotype was induced only by immunization with CpG-conjugated OVA.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 7. In vivo IgG production. BALB/c mice were immunized i.p. with 10 µg of OVA, nonCpG-OVA, or CpG-OVA twice at a 14-day interval. 14 days after the last immunization, sera were collected and examined for OVA-specific IgG1 and IgG2a using ELISA. Data are expressed as arbitrary units per milliliter. Each group consists of five mice, and experiments were repeated twice with similar results. *, p < 0.005; **, p < 10-5 (compared with the OVA group).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DNAs have been generally considered to be immunologically inert. The potent immunostimulatory activities exerted by CpG (1, 2, 3, 4) appeared rather exceptional. In the present work, however, we demonstrated that ODNs ubiquitously have immunoenhancing activities independent of the particular sequences.

Two representative effects of ODNs we observed were the enhanced activation of Ag-primed effector Th cells (Fig. 4) and the induction of the Th2 differentiation from naive T cells (Figs. 5 and 6). The two characteristics were clearly envisaged when ODNs were directly conjugated to Ag. In the parallel experiments, the covalent conjugation of Ag to ODNs lead to the accelerated binding of Ag to Ia+ cells (Fig. 1). In light of the fact that ODNs bind to cell membranes through specific surface receptors (5), the superiority of the direct linkage between ODNs and Ag in Th cell activation and Ag capture by APCs would reflect that the endocytosis of ODN-conjugated Ag through ODN-specific receptors was more efficient than fluid-phase endocytosis of Ag. Thus, the enhanced responses of Th cells by ODN-conjugated Ag would be accounted for by an increase in Ag capture and uptake by the Ia+ APCs. So far as we know of, DNAs, particularly as a form conjugated to Ag, have not been examined with respect to Ag presentation and Th cell activation.

Previously, B cells were thought to be activated by ODNs either in a sequence-specific or nonspecific manner (30, 31, 32). The mechanisms of B cell activation remained unknown. It has been reported that the engagement of surface Ig by ODN-mediated charge-charge interactions leads to activation of B cells (33). More recently, DNAs were reported to induce the maturation of APCs (34). These activities are manifested by dsDNAs and abrogated by cleavage to ssDNAs.

Recently McCluskie et al. (35, 36) reported that nonCpG ODNs, when given orally together with Ag, induced Th2 cells. These effects were observed when nonCpG ODNs and Ag were delivered by mucosal but not parenteral routes. The reason remains unsolved. The nonCpG-Ag conjugates we adopted induce Th2 cells even when given parenterally or used in vitro. The mechanisms of the action include an enhancement of Ag uptake. However, the dependency of nonCpG-mediated Th2 induction on costimulatory molecules (Fig. 5) needs to be reconciled with the failure of nonCpG ODNs to activate APCs. DCs that had been activated by environmental stimuli and yet had lacked the IL-12 secretion might incorporate nonCpG-Ag and become competent to present Ag to Th cells for skewing toward Th2 responses. The underlying mechanisms remain unknown.

Experiments using antisense DNAs had hinted that the uptake of DNAs by cells was inefficient. It has become evident, however, that DNAs are incorporated into the cytoplasmic portion after binding to the cell surface through DNA-specific receptors (37, 38). DNAs, regardless of the presence or absence of CpG motifs in the sequences, use identical receptors despite the apparent functional difference between the two (5). Recently, the functional difference, including the expression of costimulatory molecules and IL-12, has been ascribed at least in part to the ability of CpG, but not nonCpG, to bind to TLR9 in the cytoplasm (4, 5, 6). The ODN receptors or intracellular components responsible for our current observations remain to be elucidated.

The findings obtained with the nonCpG in the present study were not exceptionally dependent on particular sequences, because RSOs had immunological effects comparable to those by the nonCpG we used (Fig. 6). For unknown reasons, the RSOs were conjugated to Ag less efficiently than the nonCpG even in repeated trials. The conjugation ratio of the RSOs to Ag was lower than that of the nonCpG, and in parallel, the RSO-conjugated Ags bound to Ia+ cells less efficiently than the nonCpG-conjugated Ag.

CpG and nonCpG share identical DNA receptors, whereas they showed quantitative or qualitative differences as adjuvants. First, CpG is quantitatively superior to nonCpG in the enhancement of antigenicity. For example, the CpG-conjugated PE stimulated PE-primed T cells 10-fold more efficiently than the nonCpG-conjugated PE (Fig. 4). In another experiment, the induction of effector Th cell development by CpG-conjugated OVA reached a plateau at a 10-fold lower dose than that by nonCpG-conjugated OVA (Fig. 5). These differences could not be ascribed to the difference in uptake of ODN-conjugated Ag, because both CpG and nonCpG bind to the same receptors with the same avidity (5). More notable are the qualitative differences; CpG could initiate Th1 responses, whereas nonCpG induced Th2 differentiation (Figs. 5 and 6). CpG and nonCpG can drive uncommitted immune responses toward totally opposite directions.

How physiologically relevant would the modulation of immune responses by DNAs be? Our present study suggested two possible adjuvant effects exerted by DNAs; the induction of Th2 differentiation at the initial encounter with Ags (Figs. 5 and 6), and the amplification of the Th2-skewed response in the subsequent encounters (Fig. 4). Th2-biased responses by DNAs appear beneficial for the prevention of autoimmunities, which are largely Th1-dependent (39). However, if self Ag-specific Th1 cells had happened to be induced in advance for any reason, the situation would not be the same. The activation of the preceding Th1 cells by DNAs (Fig. 4) would make autoimmune diseases overt that would otherwise have remained concealed. The above scenario might account for the onset or deterioration of autoimmune diseases upon viral infection that promotes the release of DNAs from infected cells. This hypothesis needs to be tested.

In summary, we demonstrated as an intrinsic immunomodulator characteristic of ODNs independent of the particular sequences.


    Acknowledgments
 
We thank Brent K. Bell for editing the English manuscript. We also thank Dr. Ken J. Ishii for his generous support.


    Footnotes
 
1 This work was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture, Japan. Back

2 Address correspondence and reprint requests to Dr. Kunio Sano, Department of Respiratory and Infectious Diseases, Graduate School of Medicine, Tohoku University, Sendai 980-8574, Japan. E-mail address: sano{at}int1.med.tohoku.ac.jp Back

3 Abbreviations used in this paper: ODN, oligodeoxynucleotide; CpG, oligodeoxynucleotide containing CpG motifs; TLR, Toll-like receptor; nonCpG, oligodeoxynucleotide without CpG motifs; DC, dendritic cell; tg, transgenic; RSO, randomly synthesized oligodeoxynucleotide; LN, lymph node; MFI, mean fluorescence intensity; MDC, monodansyl cadavarine. Back

Received for publication May 29, 2002. Accepted for publication December 17, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Klinman, D. M., A. K. Yi, S. L. Beaucage, J. Conover, A. M. Krieg. 1996. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete IL-6, IL-12, and IFN-{gamma}. Proc. Natl. Acad. Sci. USA 93:2879.[Abstract/Free Full Text]
  2. Chu, R. S., O. S. Targoni, A. M. Krieg, P. V. Lehmann, C. V. Harding. 1997. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186:1623.[Abstract/Free Full Text]
  3. Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28:2045.[Medline]
  4. Jakob, T., P. S. Walker, A. M. Krieg, M. C. Udey, J. C. Vogel. 1998. Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J. Immunol. 161:3042.[Abstract/Free Full Text]
  5. Liang, H., F. C. Reich, D. S. Pisetsky, P. E. Lipsky. 2000. The role of cell surface receptors in the activation of human B cells by phosphorothioate oligonucleotides. J. Immunol. 165:1438.[Abstract/Free Full Text]
  6. Bennett, R. M., G. T. Gabor, M. M. Merritt. 1985. DNA binding to human leukocytes: evidence for a receptor-mediated association, internalization, and degradation of DNA. J. Clin. Invest. 76:2182.
  7. Gasparro, F. P., R. Dall’amico, M. O’Malley, P. W. Heald, R. L. Edelson. 1990. Cell membrane DNA: a new target for psoralen photoadduct formation. Photochem. Photobiol. 52:315.[Medline]
  8. Pearson, A. M., A. Rich, M. Krieger. 1993. Polynucleotide binding to macrophage scavenger receptors depends on the formation of base-quartet-stabilized four-stranded helices. J. Biol. Chem. 268:3546.[Abstract/Free Full Text]
  9. Kimura, Y., K. Sonehara, E. Kuramoto, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, T. Tokunaga. 1994. Binding of oligoguanylate to scavenger receptors is required for oligonucleotides to augment NK cell activity and induce IFN. J. Biochem. 116:991.[Abstract/Free Full Text]
  10. Beltinger, C., H. U. Saragovi, R. M. Smith, L. LeSauteur, N. Shah, L. DeDionisio, L. Christensen, A. Raible, L. Jarett, A. M. Gewirtz. 1995. Binding, uptake, and intracellular trafficking of phosphorothioate-modified oligodeoxynucleotides. J. Clin. Invest. 95:1814.
  11. Benimetskaya, L., J. D. Loike, Z. Khaled, G. Loike, S. C. Silverstein, L. Cao, J. E. Khoury, T. Cai, C. A. Stein. 1997. Mac-1 (CD11b/CD18) is an oligodeoxynucleotide-binding protein. Nat. Med. 3:414.[Medline]
  12. Filaci, G., P. Contini, I. Grasso, D. Bignardi, M. Ghio, L. Lanza, M. Scudeletti, F. Puppo, M. Bolognesi, R. S. Accolla, F. Indiveri. 1998. Double-stranded deoxyribonucleic acid binds to HLA class II molecules and inhibits HLA class II-mediated antigen presentation. Eur. J. Immunol. 28:3968.[Medline]
  13. Siess, D. C., C. T. Vedder, L. S. Merkens, T. Tanaka, A. C. Freed, S. L. McCoy, M. C. Heinrich, M. E. Deffebach, R. M. Bennett, S. H. Hefeneider. 2000. A human gene coding for a membrane-associated nucleic acid-binding protein. J. Biol. Chem. 275:33655.[Abstract/Free Full Text]
  14. Hemmi, H., O. Takeuchi, T. Kawai, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  15. Bauer, S, C. J. Kirschning, H. Hacker, V. Redecke, S. Hausmann, S. Akira, H. Wagner, G. B. Lipford. 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad. Sci. USA 98:9237.[Abstract/Free Full Text]
  16. Takeshita, F., C. A. Leifer, I. Gursel, K. J. Ishii, S. Takeshita, M. Gursel, D. M. Klinman. 2001. Cutting edge: role of Toll-like receptor 9 in CpG DNA-induced activation of human cells. J. Immunol. 167:3555.[Abstract/Free Full Text]
  17. Shirota, H., K. Sano, N. Hirasawa, T. Terui, K. Ohuchi, T. Hattori, K. Shirato, G. Tamura. 2001. Novel roles of CpG oligodeoxynucleotides as a leader for the sampling and presentation of CpG-tagged Ag by dendritic cells. J. Immunol. 167:66.[Abstract/Free Full Text]
  18. Romani, N., S. Koide, M. Crowley, M. Witmer-Pack, A. M. Livingstone, C. G. Fathman, K. Inaba, R. M. Steinman. 1989. Presentation of exogenous protein antigens by dendritic cells to T cell clones: intact protein is presented best by immature, epidermal Langerhans cells. J. Exp. Med. 169:1169.[Abstract/Free Full Text]
  19. Inaba, K., M. Inaba, M. Naito, R. M. Steinman. 1993. Dendritic cell progenitors phagocytose particulates, including bacillus Calmette-Guerin organisms, and sensitize mice to mycobacterial antigens in vivo. J. Exp. Med. 178:479.[Abstract/Free Full Text]
  20. Reis e Sousa, C., P. D. Stahl, J. M. Austyn. 1993. Phagocytosis of antigens by Langerhans cells in vitro. J. Exp. Med. 178:509.[Abstract/Free Full Text]
  21. Kakiuchi, T., R. W. Chesnut, H. M. Grey. 1983. B cells as antigen-presenting cells: the requirement for B cell activation. J. Immunol. 131:109.[Medline]
  22. Rock, K. L., B. Benacerraf, A. K. Abbas. 1984. Antigen presentation by hapten-specific B lymphocytes, I: role of surface immunoglobulin receptors. J. Exp. Med. 160:1102.[Abstract/Free Full Text]
  23. Lanzavecchia, A.. 1985. Antigen-specific interaction between T and B cells. Nature 314:537.[Medline]
  24. Shirota, H., K. Sano, T. Kikuchi, G. Tamura, K. Shirato. 2000. Regulation of murine airway eosinophilia and Th2 cells by antigen–conjugated CpG oligodeoxynucleotides as a novel antigen–specific immunomodulator. J. Immunol. 164:5575.[Abstract/Free Full Text]
  25. Shirota, H., K. Sano, N. Hirasawa, T. Terui, K. Ohuchi, T. Hattori, G. Tamura. 2002. B cells capturing Ag conjugated with CpG oligodeoxynucleotides induce Th1 cells by elaborating IL-12. J. Immunol. 169:787.[Abstract/Free Full Text]
  26. Sato, T., T. Sasahara, Y. Nakamura, T. Osaki, T. Hasegawa, T. Tadakuma, Y. Arata, Y. Kumagai, M. Katsuki, S. Habu. 1994. Naive T cells can mediate delayed-type hypersensitivity response in T cell receptor transgenic mice. Eur. J. Immunol. 24:1512.[Medline]
  27. Kappler, J. W., B. Skidmore, J. White, P. Marrack. 1981. Antigen-inducible, H-2-restricted, interleukin-2-producing T cell hybridomas: lack of independent antigen and H-2 recognition. J. Exp. Med. 153:1198.[Abstract/Free Full Text]
  28. Sano, K., K. Haneda, G. Tamura, K. Shirato. 1999. Ovalbumin (OVA) and Mycobacterium tuberculosis bacilli cooperatively polarize anti–OVA T-helper (Th) cells toward a Th1-dominant phenotype and ameliorate murine tracheal eosinophilia. Am. J. Respir. Mol. Cell Biol. 20:1260.[Abstract/Free Full Text]
  29. Khine, A. A., C. A. Lingwood. 1994. Capping and receptor-mediated endocytosis of cell-bound verotoxin (Shiga-like toxin). I. Chemical identification of an amino acid in the B subunit necessary for efficient receptor glycolipid binding and cellular internalization. J. Cell. Physiol. 161:319.[Medline]
  30. Branda, R. F., A. L. Moore, L. Mathews, J. J. McCormarck, G. Zon. 1993. Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1. Biochem. Pharmacol. 45:2037.[Medline]
  31. Pisetsky, D. S., C. F. Reich. 1993. Stimulation of murine lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus. Life Sci. 54:101.
  32. Liang, H., Y. Nishioka, C. F. Reich, D. S. Pisetsky, P. E. Lipsky. 1996. Activation of human B cells by phosphorothioate oligodeoxynucleotides. J. Clin. Invest. 98:1119.[Medline]
  33. Liang, H., C. F. Reich, D. S. Pisetsky, P. E. Lipsky. 2001. The role of surface Ig binding in the activation of human B cells by phosphorothioate oligodeoxynucleotides. Scand. J. Immunol. 54:551.[Medline]
  34. Ishii, K. J., K. Suzuki, C. Coban, F. Takeshita, Y. Itoh, H. Matoba, L. D. Kohn, D. M. Klinman. 2001. Genomic DNA released by dying cells induces the maturation of APCs. J. Immunol. 167:2602.[Abstract/Free Full Text]
  35. McCluskie, M. J., H. L. Davis. 2000. Oral, intrarectal and intranasal immunizations using CpG and non-CpG oligodeoxynucleotides as adjuvants. Vaccine 19:413.[Medline]
  36. McCluskie, M. J., R. D. Weeratna, H. L. Davis. 2001. The potential of oligodeoxynucleotides as mucosal and parenteral adjuvants. Vaccine 19:2657.[Medline]
  37. Loke, S. L., C. A. Stein, X. H. Zhang, K. Mori, M. Nakanishi, C. Subasinghe, J. S. Cohen, L. M. Neckers. 1989. Characterization of oligonucleotide transport into living cells. Proc. Natl. Acad. Sci. USA 86:3474.[Abstract/Free Full Text]
  38. Yakubov, L. A., E. A. Deeva, V. F. Zarytova, E. M. Ivanova, A. S. Ryte, L. V. Yurchenko, V. V. Vlassov. 1989. Mechanism of oligonucleotide uptake by cells: involvement of specific receptors?. Proc. Natl. Acad. Sci. USA 86:6454.[Abstract/Free Full Text]
  39. Liblau, R. S., S. M. Singer, H. O. McDevitt. 1995. Th1 and Th2 CD4+ T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol. Today 16:34.[Medline]



This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
S. Kippenberger, J. Muller, M. Schultz, A. Dorn, A. Bock, H. Aygun, D. Thaci, M. Hofmann, R. Kaufmann, and A. Bernd
Oligonucleotides suppress PKB/Akt and act as superinductors of apoptosis in human keratinocytes
Nucleic Acids Res., April 22, 2009; (2009) gkp252v1.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
T. Hayashi, K. Hasegawa, Y. Sasaki, T. Mori, C. Adachi, and K. Maeda
Systemic administration of interleukin-4 expressing plasmid DNA delays the development of glomerulonephritis and prolongs survival in lupus-prone female NZB x NZW F1 mice
Nephrol. Dial. Transplant., November 1, 2007; 22(11): 3131 - 3138.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Jozefowski, M. Arredouani, T. Sulahian, and L. Kobzik
Disparate Regulation and Function of the Class A Scavenger Receptors SR-AI/II and MARCO
J. Immunol., December 15, 2005; 175(12): 8032 - 8041.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Shirota, M. Gursel, and D. M. Klinman
Suppressive Oligodeoxynucleotides Inhibit Th1 Differentiation by Blocking IFN-{gamma}- and IL-12-Mediated Signaling
J. Immunol., October 15, 2004; 173(8): 5002 - 5007.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Heit, K. M. Huster, F. Schmitz, M. Schiemann, D. H. Busch, and H. Wagner
CpG-DNA Aided Cross-Priming by Cross-Presenting B Cells
J. Immunol., February 1, 2004; 172(3): 1501 - 1507.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. Coban, K. J. Ishii, A. W. Stowers, D. B. Keister, D. M. Klinman, and N. Kumar
Effect of CpG Oligodeoxynucleotides on the Immunogenicity of Pfs25, a Plasmodium falciparum Transmission-Blocking Vaccine Antigen
Infect. Immun., January 1, 2004; 72(1): 584 - 588.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sano, K.
Right arrow Articles by Tamura, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sano, K.
Right arrow Articles by Tamura, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS