|
|
||||||||
CUTTING EDGE |
Release from Plasmacytoid Dendritic Cells

* Experimental Immunology Branch, National Cancer Institute, Bethesda, MD 20892; and
Section of Retroviral Immunology, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
and TNF-
and a moderate switch in their capacity to polarize naive T cells. Our findings provide an explanation for low levels of type I IFN frequently observed in atopic individuals. | Introduction |
|---|
|
|
|---|
Myeloid DC and pDC express distinct repertoires of Toll-like receptors (TLRs) which determine their responsiveness to PAMPs. For instance, mdDC express TLRs 24 and are responsive to LPS, bacterial proteoglycans, and dsRNA, whereas pDC express TLR9, and are activated by bacterial DNA and oligodeoxynucleotides (ODN) containing unmethylated CpG motifs (9, 10). The cytokines released by TLR stimulation depend upon the lineage of the DC (11, 12, 13, 14), but increasing evidence indicates that mediators present in the peripheral microenvironment, where immature DC encounter PAMPs and inflammatory cytokines, have the potential of altering the profile of cytokines released in the lymphoid organs by the maturing DC, ultimately impacting the type of immune response elicited (15). In particular, we and others have shown that histamine, one of the major components of mast cell and basophil granules, inhibits IL-12 production and stimulates IL-10 secretion in LPS-stimulated mdDC (16, 17, 18). The resulting immune response is shifted from a Th1 to a Th2 phenotype, a phenomenon that helps explain the elevated levels of Th2 cells and IgE observed in atopic patients. Interestingly, it has been reported that atopy in children is also associated with decreased virus-induced IFN-
release (19). Because pDC are the main producers of type I IFN in the blood after viral infection, and because pDC can be exposed to histamine after allergen-induced degranulation of circulating basophils, we asked whether histamine might also influence the pattern of cytokines produced by pDC. We found that histamine, by acting on H2 receptors, inhibited the release of IFN-
from pDC treated with live flu virus or CpG ODNs, and moderately shifted their T cell polarizing capacity.
| Materials and Methods |
|---|
|
|
|---|
Human pDC were purified from elutriated monocytes from healthy National Institutes of Health Blood Bank donors using a BDCA-2 Cell Isolation kit (Miltenyi Biotec, Auburn, CA). pDC had a purity
90% based upon positive expression of BDCA-2, CD123 (IL-3R
), CD4, CD45RA, and lack of expression of CD14, CD1a, and CD11c. pDC (5 x 105/ml) were cultured in complete medium (RPMI 1640 containing 10% heat-inactivated (65°C, 30 min) FCS, 2 mM glutamine, 100 U/ml penicillin, and 55 mM 2-ME) supplemented with 10 ng/ml recombinant human IL-3 (PeproTech, Rocky Hill, NJ). mdDC were generated by culturing monocytes with GM-CSF and IL-4 as described (20). CD45RA+, CD4+ naive T cells were obtained from PBMC of healthydonors by 1) isolating CD4+ T cells by negative selection with a Miltenyi Biotec Human CD4+ T Cell Isolation kit, and 2) isolating CD45RA+ cells from the CD4+ T cells by positive selection using CD45RA MicroBeads (Miltenyi Biotec).
Reagents
The following CpG ODNs were used: ODN K3, ATCGACTCTCGAGCGTTCTC (21); control ODN (K3 flip), ATGCACTCTGCAGGCTTCTC; and ODN 2216, GGgggacgatcgtcGGGGGg (22), where the immunostimulatory CpG motifs are underlined and upper and lower case letters indicate phosphorothioate and phosphodiester linkage of the 3' base, respectively. ODNs were synthesized at the Food and Drug Administration Center for Biologics Evaluation and Research core facility (Bethesda, MD), and used at 10 µg/ml. Salmonella minnesota LPS (Sigma-Aldrich, St. Louis, MO) and histamine were used at 100 ng/ml and 10 µM, respectively. Live flu virus strain A/Puerto Rico/8/34, obtained from Dr. G. Shearer (National Cancer Institute, Bethesda, MD) (23), was used at a 1/400 dilution. H1, H2, and H3 histamine receptor antagonists, pyrilamine, cimetidine, and thioperamide were obtained from Sigma-Aldrich and used at 100 nM, 100 µM, and 1 µM respectively, 10 times their reported Kd values (16). Supernatants from overnight cultures containing 5 x 105 cells/ml were assayed for cytokines using the following ELISA kits (detection limits in brackets): human IFN-
(10 pg/ml) and human IL-10 (1 pg/ml) (BioSource International, Camarillo, CA); human TNF-
(4 pg/ml), Quantikine kit (R&D Systems, Minneapolis, MN); human IL-12 p70 (16 pg/ml), DuoSet ELISA Development kits (R&D Systems).
Flow cytometry
All mAbs used for staining were from BD PharMingen (San Diego, CA), except for the anti-BDCA-2FITC (Miltenyi Biotec). Surface and intracellular staining was performed as described (16).
T cell polarization
Polarization experiments with mdDC and pDC were performed as described (7, 16). Briefly, allogeneic naive CD4+ T cells were cocultured for 4 days with mature irradiated DC at a DC-T cell ratio of 1:10. pDC were first cultured in IL-3-containing medium for 48 h, and then treated for 7 h with the indicated stimuli before addition to the T cells; maturation of mdDC was overnight. T cells were then split and expanded in IL-2-containing medium for 8 days, and then internally labeled for cytokine production after PMA plus ionomycin stimulation in the presence of brefeldin A.
| Results and Discussion |
|---|
|
|
|---|
Because histamine dramatically changes the cytokine profile and T cell polarizing capacity of maturing mdDC (16, 17) we asked whether it would similarly modulate the effector functions of pDC. To stimulate pDC, we used two different TLR9 ligands, ODNs 2216 and K3. Consistent with previous results (21), ODN 2216 induced higher levels of IFN-
than ODN K3, and histamine inhibited IFN-
secretion induced by both ODNs (Fig. 1, A and B). Specifically, histamine suppressed the production of IFN-
from K3-treated pDC by an average of 70% (range 48100%) in 12 different donors and from 2216-treated pDC by 90 and 94% in two donors. Inhibition was not due to induction of cell death, because histamine did not affect the viability of the pDC, as assessed by trypan blue staining (data not shown). By contrast, pDC were unresponsive to both the control ODN (Ctrl), which has the critical immunostimulatory CpG motifs of K3 inverted, and to LPS, due to lack of expression of TLR4 (9). As previously observed in mdDC, we found in preliminary experiments that short exposure to histamine (2 h) was sufficient to inhibit IFN-
release in pDC treated with CpG ODNs (data not shown).
|
secretion. Fig. 1B shows that IFN-
secretion induced by flu was significantly suppressed by histamine; in three separate donors, histamine suppressed IFN-
by 73, 35, and 62% (average 57%). Histamine acts on the H2 receptor in pDC
To determine which histamine receptor was responsible for the inhibition of IFN-
release, we treated pDC with CpG ODN and histamine after preincubating the cells with antagonists specific for the three histamine receptors, H1, H2, and H3. Fig. 1C shows that the H2, but not the H1 or H3 antagonists, reversed the suppressive effect of histamine, indicating that histamine blocks the production of IFN-
in pDC by binding to H2 receptors. We previously reported that histamine also acted through H2 receptors in LPS-treated mdDC to suppress IL-12 release (16). Thus histamine uses the same receptor in pDC and mdDC to block secretion of different cytokines induced by different TLRs.
Effects of histamine on TNF-
, IL-12, IL-10, and IFN-
-inducible protein (IP)-10 in pDC
We next asked whether histamine would affect the secretion of other cytokines produced by pDC. Both K3 ODN and flu virus induced pDC to secrete similarly high levels of TNF-
(Fig. 2A). The addition of histamine significantly decreased the release of TNF-
by both stimuli.
|
In mdDC, LPS and histamine synergize to produce high levels of IL-10 which contribute to the inhibition of IL-12 secretion (16). To determine whether histamine and CpG ODN would have a similar effect on pDC, we stimulated pDC with K3 ODN, histamine or the two together and measured IL-10 in the supernatants. Concurrently, IL-10 production was measured in mdDC from the same donor. As shown in Fig. 2B, pDC secreted very little IL-10 in response to CpG ODN, and although histamine did cause an increase, the total amount of IL-10 detected was always small compared with that released by mdDC.
Another mediator induced in pDC by CpG ODN is the inflammatory chemokine, IP-10 (CXC chemokine ligand 10) (11), which attracts CXCR3-bearing cells, such as Th1 cells and pDC, to sites of inflammation. Interestingly, it has been reported that IP-10 is up-regulated following allergen challenge in a murine model of allergic airway inflammation (24). We detected high levels (nanogram per milliliter range) of IP-10 in supernatants from pDC treated with either CpG ODN or flu virus in six donors analyzed. However, the effects of histamine on IP-10 secretion were inconsistent, causing either increases or decreases or having no effect depending upon the donor (data not shown).
Histamine alters the T cell polarizing capacity of pDC without affecting phenotype
Histamine shifts the polarizing capacities of mdDC from Th1 to Th2 (16, 17) by decreasing IL-12 production, but without altering the expression of maturation markers. Therefore, we asked whether a similar pattern could be observed in pDC. pDC stimulated with CpG ODN or flu virus undergo a maturation process that involves up-regulation of costimulatory and MHC molecules, and variable changes in adhesion molecules. As seen in Table I, histamine alone failed to influence the expression of several maturation markers including MHC class I, CD40, CD86, and L-selectin (CD62 ligand), nor did it affect the changes in their levels of expression induced by either K3 ODN or flu maturation stimuli, except for CD40, where minor decreases were observed. Similarly, histamine did not alter the expression of CD80, CD83, and HLA-DR either alone or in the presence of maturation stimuli (data not shown). We next treated pDC with either ODN 2216 or live flu virus in the presence or absence of histamine, then cocultured them with allogeneic naive CD4+, CD45RA+ T lymphocytes. The same naive T cells were used in a parallel polarization experiment with mdDC from the same donor as the pDC, matured with either LPS or LPS and histamine. After priming and expansion in IL-2-containing medium, the patterns of IL-4 and IFN-
production by the T cells were analyzed by internal staining and flow cytometry. In agreement with recent reports (7, 11), the data of Fig. 3 show that pDC matured in the absence of histamine induce strong Th1 (IFN-
+, IL-4-) responses. By contrast, naive T cells primed with pDC matured with ODN plus histamine gave a pronounced skewing toward the Th2 phenotype (IFN-
-, IL-4+). These changes were comparable to those observed when LPS-matured mdDC (± histamine) were used for T cell priming (Fig. 3). In contrast, histamine had less effect on pDC matured with flu virus, suggesting that the partial inhibition of type I IFN production by histamine (Fig. 1B) was less able to impact T cell polarization by flu-infected pDC.
|
|
pDC are both professional APCs and a major source of virally induced type I IFN. We have shown in this study that histamine blocks the secretion of IFN-
and other cytokines by acting on H2 receptors of pDC stimulated with CpG ODNs or flu virus. Histamine has previously been found to modulate the cytokine repertoire in several different cell systems (25), but this is the first report describing its inhibitory effects on the production of type I IFN, a finding that sheds new light on the understanding of atopy-related immune disorders. By reducing cytokine secretion, histamine impacts the Th1/Th2 balance of primed T cells which could enhance IgE production, leading to increased severity of allergic diseases. However, equally important is the impact histamine would have on the IFN-dependent antiviral activities of pDC. In allergic individuals, pDC could be exposed to histamine either in peripheral blood, because allergens cause degranulation of circulating basophils (26), or in airway epithelial tissue. In fact, a recent report showed that pDC were selectively recruited to the nasal mucosa of allergic patients after experimentally induced allergic rhinitis (27). Regardless of its site of action, the inhibitory effect of histamine on the production of IFN-
by pDC provides an explanation for the reduced levels of type I IFN observed in atopic children after viral infection (19) and likely accounts for the undetectable levels of serum IFN-
in a patient with atopic dermatitis (28). It was suggested that this lack of IFN-
was related to enhanced susceptibility to viral infections in that patient (28). If this observation is validated in a larger cohort of patients, then the selective inhibition of H2 receptors by specific antagonists on pDC might provide a strategy for increasing resistance to viral infections in atopic patients.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: DC, dendritic cell; PAMP, pathogen-associated molecular pattern; mdDC, monocyte-derived DC; pDC, plasmacytoid DC; flu, influenza; TLR, Toll-like receptor; ODN, oligodeoxynucleotide; IP, IFN-
-inducible protein. ![]()
Received for publication November 20, 2002. Accepted for publication January 6, 2003.
| References |
|---|
|
|
|---|
. J. Exp. Med. 179:1109.
/
-producing cells link innate and adaptive immunity. J. Exp. Med. 192:219.
and
as immune regulatorsa new look. Immunity 14:661.[Medline]
and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J. Exp. Med. 195:1507.
release. Int. Arch. Allergy Immunol. 127:82.[Medline]
/
in plasmacytoid dendritic cells. Eur. J. Immunol. 31:2154.[Medline]
-inducible protein 10 (CXCL10) contributes to airway hyperreactivity and airway inflammation in a mouse model of asthma. J. Immunol. 168:5278.
serum levels in a patient with atopic dermatitis. J. Interferon Cytokine Res. 15:973.[Medline]Related articles in The JI:
This article has been cited by other articles:
![]() |
A. Shin, T. Toy, S. Rothenfusser, N. Robson, J. Vorac, M. Dauer, M. Stuplich, S. Endres, J. Cebon, E. Maraskovsky, et al. P2Y receptor signaling regulates phenotype and IFN-{alpha} secretion of human plasmacytoid dendritic cells Blood, March 15, 2008; 111(6): 3062 - 3069. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Spinelli Oliveira, J. T. Hancock, M. Hermes-Lima, D. A. Isola, M. Ochs, J. Yu, and D. Wilhem Filho Implications of dealing with airborne substances and reactive oxygen species: what mammalian lungs, animals, and plants have to say? Integr. Comp. Biol., October 1, 2007; 47(4): 578 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Popovic, R. DeMarco, M. T. Lotze, S. E. Winikoff, D. L. Bartlett, A. M. Krieg, Z. S. Guo, C. K. Brown, K. J. Tracey, and H. J. Zeh III High Mobility Group B1 Protein Suppresses the Human Plasmacytoid Dendritic Cell Response to TLR9 Agonists J. Immunol., December 15, 2006; 177(12): 8701 - 8707. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mazzoni, R. P. Siraganian, C. A. Leifer, and D. M. Segal Dendritic Cell Modulation by Mast Cells Controls the Th1/Th2 Balance in Responding T Cells J. Immunol., September 15, 2006; 177(6): 3577 - 3581. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Morita, T. Uchiyama, and T. Hori Nitric Oxide Inhibits IFN-{alpha} Production of Human Plasmacytoid Dendritic Cells Partly via a Guanosine 3',5'-Cyclic Monophosphate-Dependent Pathway J. Immunol., July 15, 2005; 175(2): 806 - 812. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. N. Meissner, S. Swain, M. Tighe, A. Harmsen, and A. Harmsen Role of Type I IFNs in Pulmonary Complications of Pneumocystis murina Infection J. Immunol., May 1, 2005; 174(9): 5462 - 5471. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hashizume, T. Horibe, H. Yagi, N. Seo, and M. Takigawa Compartmental Imbalance and Aberrant Immune Function of Blood CD123+ (Plasmacytoid) and CD11c+ (Myeloid) Dendritic Cells in Atopic Dermatitis J. Immunol., February 15, 2005; 174(4): 2396 - 2403. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-W. Qiao, J. Piper, G. Haraldsen, I. Oynebraten, B. Fleckenstein, O. Molberg, C. Khosla, and L. M. Sollid Tissue Transglutaminase-Mediated Formation and Cleavage of Histamine-Gliadin Complexes: Biological Effects and Implications for Celiac Disease J. Immunol., February 1, 2005; 174(3): 1657 - 1663. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. McKenna, A.-S. Beignon, and N. Bhardwaj Plasmacytoid Dendritic Cells: Linking Innate and Adaptive Immunity J. Virol., January 1, 2005; 79(1): 17 - 27. [Full Text] [PDF] |
||||
![]() |
M. Anlauf, M. K.-H. Schafer, C. Depboylu, W. Hartschuh, L. E. Eiden, G. Kloppel, and E. Weihe The Vesicular Monoamine Transporter 2 (VMAT2) Is Expressed by Normal and Tumor Cutaneous Mast Cells and Langerhans Cells of the Skin but Is Absent from Langerhans Cell Histiocytosis J. Histochem. Cytochem., June 1, 2004; 52(6): 779 - 788. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |