The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Katavic, V.
Right arrow Articles by Marusic, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Katavic, V.
Right arrow Articles by Marusic, A.
The Journal of Immunology, 2003, 170: 1540-1547.
Copyright © 2003 by The American Association of Immunologists

Increased Bone Mass Is a Part of the Generalized Lymphoproliferative Disorder Phenotype in the Mouse 1,2

Vedran Katavic*, Ivan Kresimir Lukic*, Natasa Kovacic*, Danka Grcevic{dagger}, Joseph A. Lorenzo{ddagger} and Ana Marusic3,*

* Croatian Institute for Brain Research and Department of Anatomy, {dagger} Department of Physiology and Immunology, Zagreb University School of Medicine, Zagreb, Croatia; {ddagger} Division of Endocrinology and Metabolism, Department of Medicine, University of Connecticut Health Center, Farmington, CT 06030


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We investigated the bone phenotype of mice with generalized lymphoproliferative disorder (gld) due to a defect in the Fas ligand-mediated apoptotic pathway. C57BL/6-gld mice had greater whole body bone mineral density and greater trabecular bone volume than their wild-type controls. gld mice lost 5-fold less trabecular bone and had less osteoclasts on bone surfaces after ovariectomy-induced bone resorption. They also formed more bone in a model of osteogenic regeneration after bone marrow ablation, had less osteoclasts on bone surfaces and less apoptotic osteoblasts. gld and wild-type mice had similar numbers of osteoclasts in bone marrow cultures, but marrow stromal fibroblasts from gld mice formed more alkaline phosphatase-positive colonies. Bone diaphyseal shafts and bone marrow stromal fibroblasts produced more osteoprotegerin mRNA and protein than wild-type mice. These findings provide evidence that the disturbance of the bone system is a part of generalized lymphoproliferative syndrome and indicates the possible role of osteoprotegerin as a regulatory link between the bone and immune system.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
In addition to their physical proximity, the immune system and bone are also functionally related (1, 2, 3, 4). Bone and immune cells may share the same progenitors and their differentiation may be driven by the same support cells. Macrophages and osteoclasts develop from the same bipotential monocyte-lineage progenitor cells (5, 6) and share the property of tissue degradation, followed by reparation conducted by cells of mesenchymal origin, fibroblasts or osteoblasts (3, 5). Marrow stromal cells include the progenitors of the osteoblastic lineage (7), express critical molecules for osteoclastogenesis (1), and provide the microenvironment for normal hemopoiesis (8). Members of the TNF-related family of ligands and receptors (1, 2), other cytokines (9, 10), CSFs (3, 5), and signaling molecules (11, 12) are essential for normal development and function of both systems.

Apoptosis, or programmed cell death, is important for the maintenance of both systems. In bone, as many as 65% of osteoblasts undergo apoptosis after they have completed synthesizing bone matrix, and osteoclasts in resorption lacunae can also die by apoptosis after they have stopped resorbing bone (13, 14, 15). In vitro studies demonstrated that osteoblasts constitutively express Fas and can be induced to undergo Fas-mediated apoptosis (16). In situ hybridization of the developing human mandible demonstrated the expression of Fas on both osteoblasts and osteoclasts, and of Fas ligand only on osteoblasts (17). In the immune system, cell death signaling through the Fas-Fas ligand interaction is crucial for lymphocyte homeostasis (reviewed in Ref.18). Mice homozygous for a mutation in the Fas ligand or Fas gene develop generalized lymphoproliferative disorder (gld4 mutation) or lymphoproliferative syndrome (lpr mutation), respectively (19). They die prematurely (20), mostly because of autoimmune syndromes, characterized by the formation of a broad spectrum of autoantibodies and the accumulation of abnormal double-negative (CD3+CD4-CD8-B220+) T cells in lymph nodes and spleen (21).

Although the immune phenotype of the mice with disturbance in the Fas-mediated apoptosis is well defined, possible alterations in bone homeostasis have not been investigated. We report in this study that mice lacking Fas ligand-induced apoptosis pathway (gld mice) have greater total body bone mineral density (BMD) and increased trabecular bone volume. In vivo, they loose less bone after ovariectomy (Ovx)-induced estrogen depletion, and form more trabecular bone during the osteogenic regeneration that follows marrow ablation of long bones. Increased bone mass seems to be the consequence of decreased osteoblast apoptosis, which live longer and secrete higher levels of osteoprotegerin (OPG), an osteoclast-inhibitory cytokine.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals

Mice homozygous for the gld mutation in a C57BL/6 background were originally obtained from E. R. Podack (Miami University, Miami, FL) (21). Maintenance of animals and experimental procedures followed the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All animal protocols were approved by the Ethics Committee of the Zagreb University School of Medicine (Zagreb, Croatia). Twelve-week-old female wild-type (C57BL/6, B6+/+) mice or mice homozygous for the gld point mutation (B6-gld) were used in all experiments. gld phenotype was confirmed by FACS as an increase in double-negative CD3+CD4-CD8-B220+ T lymphocytes (21).

Ovariectomy

B6+/+ or B6-gld mice were sham-operated (Sham) or ovariectomized (Ovx) and sacrificed 1 or 3 wk after surgery. Uteri were isolated and wet uterine weights were measured to confirm the effects of surgery.

Bone marrow ablation

Tibial bone marrow ablation was performed under general anesthesia as described earlier (22). Mice were sacrificed by cervical dislocation following CO2 anesthesia on days 6, 8, and 10 postablation. Tibiae were processed for histology or RNA was extracted for RT-PCR analysis. Sham-operated, nonablated mice were used as controls (day 0).

Bone density and histomorphometry

Total body BMD was measured using peripheral dual-energy x-ray absorptiometry (Eclipse; Norland Medical Systems, Ford Atkinson, WI) with a resolution 0.5 x 0.5 mm and scan speed of 10 mm/s. BMD was determined in a window that excluded the calvaria and tails. The data presented are the average of three measurements for each mouse, with repositioning between scans. The mean coefficient of variation was 1.6%.

Cancellous bone of distal femoral or proximal tibial metaphyses was analyzed three-dimensionally using a microcomputed tomography (µCT) system (µCT-20; ScancoMedical, Zürich, Switzerland). Total volume of the scanned area was 0.44 mm3 in the metaphyseal trabecular bone and did not include any cortical bone. Using two-dimensional microstructural data from 200 scanned slices, a three-dimensional microstructural image was reconstructed to calculate the trabecular bone volume fraction (bone volume/total volume; BV/TV), trabecular thickness, and trabecular spacing.

Tibiae from mice with ablated bone marrow or humeri from Ovx mice were fixed in 4% buffered paraformaldehyde and embedded in paraffin. Serial sections were stained with Goldner’s trichrome stain. Osteoclasts were identified by tartrate-resistant acid phosphatase (TRAP) staining, characteristic morphology, and association with bone (23). Histomorphometric measurements (24) were performed by a blinded observer. We measured total tissue area (diaphyseal/marrow cavity), trabecular perimeter, trabecular area, clot area, and cortical width (22, 23). Percentage of trabecular area, percentage of clot area, trabecular number, trabecular thickness, and trabecular spacing were calculated from directly measured values. Number of TRAP-positive osteoclasts was counted on adjacent sections and expressed per bone perimeter. Apoptotic cells were visualized by in situ end-labeling method (25) using a commercial protocol (KLENOW-FragEl kit; Oncogene, Boston, MA).

Osteoclast-like or osteoblastic cell quantitation in bone marrow cell cultures

Mouse bone marrow cells were cultured with recombinant mouse (rm) receptor activator of NF-{kappa}B ligand (RANKL) and rmM-CSF to stimulate osteoclast-like cell (OCL) formation (26). After 7 days of culture, TRAP-positive multinucleated giant cells with four or more nuclei per cell were considered OCL and counted per well. More than 98% of TRAP-positive cells showed specific binding of labeled calcitonin, as previously described (26). For the cultivation of marrow stromal fibroblasts, bone marrow cells were cultured with 50 µg/ml ascorbic acid, 10-8 M dexamethasone, and 8 mM {beta}-glycerophosphate, and the colonies of marrow stromal fibroblasts were identified by alkaline phosphatase staining (27).

Immunocytochemistry

For immunocytochemistry, 1.5 x 106 marrow cells per well were plated into 4-well chamber slides (Nunc, Naperville, IL). On day 8, marrow stromal fibroblasts were immunostained for OPG using a polyclonal goat anti-mouse OPG Ab (Santa Cruz Biotechnology, Santa Cruz, CA). Binding of alkaline phosphatase-conjugated affinity-purified secondary rabbit anti-goat Ab (Dianova, Hamburg, Germany) was visualized with naphtol-AS-MX phosphate and Fast Red substrate (Sigma-Aldrich, St. Louis, MO).

Gene expression analysis

In the bone marrow ablation model, tibiae were carefully dissected out from the surrounding tissues, and the distal ends and proximal epiphyseal plates were excised so that only the tissue enclosed by bone served as a source for RNA. Humeri from Ovx animals were dissected out in a similar way. Total RNA was extracted using a commercial kit (TRI-REAGENT; Molecular Research Center, Cincinnati, OH). Each bone RNA sample was prepared from a pool of three tibiae. In cultures of marrow stromal fibroblasts, RNA was extracted on day 8, pooling three wells of a 6-well plate per group. For PCR amplification, 10 µg of total RNA were converted to cDNA by reverse transcriptase (Superscript II; Life Technologies, Grand Island, NY) (22, 26). The amount of cDNA corresponding to 0.5 µg of reversely transcribed RNA was amplified by PCR, using specific amplimer sets for receptor activator of NF-{kappa}B (RANK), OPG, RANKL, and {beta}-actin (26). For each amplimer set, we performed amplifications over a range of 18–39 cycles to verify that they were in the linear range of each PCR analysis (28). The amplified products were run on a 1.5% agarose gel, stained with ethidium bromide, and photographed under UV illumination. OD of the bands was determined using a digital image processing and analysis program (Scion Image; Scion, Frederick, MD). For each time point, RT was performed on RNA samples isolated from two independent experiments, and PCR amplifications were performed in triplicate for each cDNA to insure the reproducibility of the assay (variation <10%).

Quantitative PCR was conducted in an ABI Prism 7000 Sequence Detection system (Applied Biosystems, Foster City, CA), and the detection was performed by measuring the binding of the fluorescence dye SYBR Green I to dsDNA using the SYBR Green PCR Master Mix kit as recommended by the manufacturer (Applied Biosystems). Each reaction was performed in quadruplicate in a 25 µl reaction volume containing 0.25 µl of cDNA, 0.25 U of AmpErase uracil N-glycosylase (Applied Biosystems), 200 nM forward and reverse primers, and 1x PCR Master Mix with SYBR Green I containing 0.625 U of AmpliTaq Gold DNA polymerase. The reactions were set in an ABI Prism Optical 96-well reaction plate (Applied Biosystems). The PCR primers for {beta}-actin were synthesized according to the published sequences (29): sense TGCGTGACATCAAAGAGAAG, antisense CGGATGTCAACGTCACACTT, product size: 243 bp; and for OPG were designed using Primer Express software (Applied Biosystems): sense AGAGCAAACCTTCCAGCTGC, antisense CTGCTCTGTGGTGAGGTTCG, product size: 142 bp. The primer concentration and cycle conditions were determined in previous experiments. The standards and the samples for {beta}-actin and OPG were simultaneously amplified using the same reaction master mixture. The reactions were incubated at 50°C for 2 min to activate the uracil N-glycosylase and then for 10 min at 95°C to inactivate this enzyme and activate the AmpliTaq Gold polymerase followed by 40 cycles of 15 s at 95°C, 20 s at 60°C, and 40 s 74°C. To reduce the signal generated by possible binding of SYBR Green I to nonspecific products, the fluorescence data were collected at a temperature above the melting temperature (Tm) of the primer dimers (detected in previous experiments). The PCR products were subjected to a heat dissociation protocol following the final PCR cycle by heat denaturing over a 35°C temperature gradient at 0.03°C/s from 60 to 95°C. The presence of a single PCR product was also verified by 2% agarose gel electrophoresis. The data generated from SYBR Green chemistries were analyzed by plotting the real-time PCR data as the fluorescence signal {Delta}Rn (calculated as the difference between fluorescence signal of the reaction and fluorescence signal of the baseline emission) vs the cycle number. An arbitrary threshold was set at the linear phase midpoint of the log {Delta}Rn vs cycle number plot. The cycle threshold value (Ct) was defined as the cycle number at which the {Delta}Rn crosses this threshold. The relative quantities of unknown samples were calculated by using the standard curve designed of five serial dilutions of the calibrator sample (tibial shaft cDNA from B6+/+ mice). According to the standard curve obtained by plotting Ct value vs logarithm quantity, the relative amounts of OPG mRNA were calculated as the ratio of the quantity of OPG normalized to {beta}-actin as endogenous control (30).

Expression of OPG protein was assessed by Western blotting analysis, as described before (31). Briefly, protein extracts (10 µg protein) from tibial bone shaft or diaphyseal bone marrow were separated on a 12% polyacrylamide gel and electrophoretically transferred onto a nitrocellulose membrane. OPG was visualized by polyclonal goat OPG Ab (Santa Cruz Biotechnology), alkaline phosphatase-conjugated affinity-purified secondary rabbit-anti-goat Ab (Dianova), and 5-bromo-4-chloro-3-indolyl phosphate and nitroblue tetrazolium (Sigma-Aldrich) developing system (31).

Statistics

The data were expressed as mean ± SEM of at least four mice per group. Statistical analysis was performed using Mann-Whitney U test for two-group and Kruskal-Wallis test for multiple-group comparisons. Mann-Whitney U test with Bonferroni correction or Dunn’s test were performed when Kruskal-Wallis test showed significant differences (p < 0.05). All experiments were repeated at least twice.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Increased bone mass in B6-gld mice

Body weight of sex- and age-matched B6+/+ and B6-gld female mice was similar (19.1 ± 0.6 vs 19.7 ± 0.5 g, respectively; n = 15). B6-gld female mice had greater whole body BMD than age-matched B6+/+ controls (B6+/+ 54.9 ± 0.7 vs B6-gld 58.1 ± 0.5 mg/cm2, respectively; n = 20; p < 0.05, Mann-Whitney U test). µCT analysis of the trabecular bone in the distal femur and proximal tibia showed that B6-gld mice had greater trabecular number and thickness (5-fold increase for femurs and 3-fold for tibiae) compared with B6+/+ mice (Fig. 1), as well as greater cortical thickness (165.4 ± 19.3 vs 131.1 ± 6.1 µm; n = 6; p < 0.05, Mann-Whitney U test).



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 1. B6-gld mice have denser bones than wild-type controls. A, Three-dimensional µCT images of trabecular architecture in femoral (upper panel) and tibial metaphysis (lower panel) of 12-wk-old B6+/+ and B6-gld mice. B, Histomorphometry of femora and tibiae from B6+/+ and B6-gld mice was assessed by µCT. Trabecular bone (BV/T), trabecular number (Tb.No), trabecular thickness (Tb.Th), and trabecular spacing (Tb.Sp) (data presented as mean ± SEM; n = 5). *, p <= 0.05 vs B6+/+ (Mann-Whitney U test with Bonferroni correction).

 
Decreased osteoclastic resorption is in B6-gld mice

Increased trabecular bone in B6-gld mice could be the result of either an increase in bone formation and/or a decrease in bone resorption (23). To analyze in vivo bone resorption, we examined Ovx-induced bone loss. As expected, B6+/+ mice lost ~50% of trabecular bone 3 wk after Ovx, compared with B6+/+ Sham (Fig. 2A). In contrast, B6-gld mice lost only ~10% of trabecular bone compared with their Sham controls (Fig. 2A). Cortical width did not significantly change after Ovx in either group (B6+/+ Sham 128.6 ± 5.2 µm and B6+/+ Ovx 120.1 ± 4.6 µm vs B6-gld Sham 158.8 ± 13.7 µm and B6-gld Ovx 137.1 ± 7.4 µm; Kruskal-Wallis test, n = 6). The mean number of TRAP-positive osteoclasts on bone surfaces was smaller in both Sham and Ovx B6-gld mice than in B6+/+ mice (Fig. 2B). However, when we tested the osteoclastogenic potential of gld bone marrow in vitro, the number of TRAP-positive OCL that formed in response to increasing concentrations of rmRANKL and rmM-CSF (32) did not differ in bone marrow cultures from B6-gld and B6+/+ controls (Fig. 3), indicating that the number of osteoclast progenitors was not altered in the gld bone marrow.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 2. B6-gld mice lose less bone after Ovx. Histomorphometry of proximal humeri was analyzed 3 wk after Ovx in B6+/+ and B6-gld females. A, Trabecular bone (BV/T), trabecular area (Tb.Ar), trabecular number (Tr.No), and trabecular spacing (Tb.Sp). Data were expressed as treated over control (T/C) ratio (Ovx/Sham) (n = 6). B, Number of TRAP-positive osteoclasts (OCL) on bone surfaces (data presented as mean ± SEM; n = 5). *, p < 0.05 vs B6+/+ (Mann-Whitney U test with Bonferroni correction).

 


View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 3. OCL progenitor number in bone marrow is not changed in B6-gld mice. Cultures of B6+/+ or B6-gld cells were treated with 10 or 20 ng/ml of rmRANKL/rmM-CSF. Bone marrow cells were cultured 7 days at a density of 3 x 106 cells/ml. The number of OCL was scored using TRAP histochemistry (data presented as mean ± SEM; n = 6 wells/group). *, p < 0.05 vs 10 ng/ml rmRANKL/rmM-CSF for respective group (Mann-Whitney U test with Bonferroni correction).

 
Increased bone formation in B6-gld mice

As osteoblasts are key regulators of osteoclastic differentiation and function (33), we tested the bone formation potential of gld mice in vivo, using the model of osteogenic regeneration after bone marrow ablation (22, 34). In B6+/+ mice, the mechanical ablation of bone marrow induced the cellular sequence of capillary invasion of the marrow cavity, proliferation of mesenchymal cells and their differentiation into osteoblasts, cancellous bone formation, reappearance of hemopoietic tissue, osteoclastic resorption, and regeneration of normal marrow space (Fig. 4).



View larger version (79K):
[in this window]
[in a new window]
  		FIGURE 4. B6-gld mice form more trabecular bone during osteogenic regeneration after bone marrow ablation. Tibial bone marrow was mechanically ablated from B6+/+ and B6-gld mice, and bone histomorphometry was analyzed 6, 8, and 10 days after ablation. Nonablated tibiae served as controls (day 0). A, Histomorphometric parameters: trabecular bone (BV/T), trabecular number (Tb.No), trabecular thickness (Tb.Th), and trabecular spacing (Tb.Sp) (data presented as mean ± SEM; n = 5). *, p < 0.05 vs B6+/+ for the same time point (Mann-Whitney U test with Bonferroni correction). B, Photomicrographs of newly induced trabecular bone before and 6, 8, and 10 days after bone marrow ablation B6+/+ (upper panel) and B6-gld (lower panel) mice.

 
At days 6 and 8 postablation, when the osteoblast proliferation and activity reached their peak, the relative volume of the newly formed trabecular bone, number of trabeculae, and their thickness were significantly greater in B6-gld mice than in B6+/+ controls (Fig. 4). These results demonstrated that the absence of Fas/Fas-ligand interaction up-regulated the proliferation and differentiation of endosteal osteoblasts after marrow ablation. B6-gld mice also had less apoptotic osteoblasts during the osteogenic sequence after marrow ablation (Fig. 5). The volume of newly formed trabecular bone did not differ between the two groups at day 10 postablation (Fig. 4). This is probably related to the kinetics of osteogenic regeneration after marrow ablation, which is a rapid and uncoupled cellular sequence of bone formation and resorption (22, 34).



View larger version (134K):
[in this window]
[in a new window]
  		FIGURE 5. B6-gld mice have less apoptotic osteoblasts (arrows) on bone surfaces during osteogenic regeneration of bone marrow ablation. Bone sections were stained 10 days after ablation with an in situ DNA end-labeling method.

 
At day 8 postablation, TRAP-positive osteoclasts could be detected on surfaces of the newly formed bone (Fig. 6). Their number increased at day 10 postablation, when bone resorption was evident and exceeded bone formation (Fig. 4). The number of TRAP-positive osteoclasts on bone surfaces in B6-gld mice was lower than in B6+/+ controls at days 8 and 10 postablation (Fig. 6), indicating that the absence of Fas/Fas ligand interactions consistently down-regulated the number of active osteoclasts on bone surfaces.



View larger version (11K):
[in this window]
[in a new window]
  		FIGURE 6. B6-gld mice have less TRAP-positive osteoclast cells during osteogenic regeneration after bone marrow ablation. TRAP-positive osteoclasts (OCL) on bone surfaces were counted 8 and 10 days after tibial bone marrow ablation in B6+/+ and B6-gld mice (data presented as mean ± SEM in three nonconsecutive tibial sections; n = 5). *, p < 0.01 vs B6+/+ at day 10 (Mann-Whitney U test with Bonferroni correction).

 
Increased OPG expression in bone and bone marrow stromal cells from B6-gld mice

As osteoclastic formation and activity in vivo is determined predominantly by the balance between the stimulatory effects of RANKL and the inhibitory effects of OPG (1), both produced by the osteoblasts (33), we investigated the expression of these genes during the osteogenic regeneration after bone marrow ablation (Fig. 7).



View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 7. B6-gld mice express more OPG mRNA during osteogenic regeneration of bone marrow ablation. RT-PCR for RANK, RANKL, and OPG was conducted from total RNA samples prepared from tibial shafts of B6+/+ and B6-gld mice, collected at days 0, 6, 8, and 10 after marrow ablation. The OD of each band was normalized to the OD of {beta}-actin expression, and the basal mRNA expression at day 0 of control B6+/+ mice was given a relative level of 1.0. RANK and RANKL were amplified for 30 cycles, OPG for 33 cycles, and {beta}-actin for 27 cycles (data presented as mean ± SEM; for a triplicate). *, p < 0.05 vs B6+/+ for the same time point (Mann-Whitney U test with Bonferroni correction).

 
The expression of RANKL and its receptor RANK, as measured by semiquantitative RT-PCR, increased similarly in both B6+/+ and B6-gld mice during the osteogenic sequence. The expression of OPG, which is secreted by both osteoblasts/stromal and hemopoietic cells (35), was highest at day 6 postablation, a time point that coincides with the peak of osteoblastic activity (Fig. 5). At day 10 postablation, when there was advancing resorption of the trabecular network in the diaphyseal cavity, the expression of OPG decreased in B6+/+ controls but was almost 2-fold higher in B6-gld mice (Fig. 7). This result implied that the decreased osteoclast number observed histologically in B6-gld mice postablation was due to an imbalance in RANKL and OPG expression (RANKL/OPG mRNA ratio at day 10 postablation was 1.6 ± 0.3 for B6-gld vs 3.4 ± 0.7 for B6+/+ mice, p < 0.05, Mann-Whitney U test; Fig. 7).

The expression of OPG mRNA was consistently, although not significantly, greater in preablated whole tibial shaft (bone + bone marrow) in intact mice (day 0 in Fig. 7) or Sham-operated B6-gld compared with B6+/+ mice (OD reading normalized to {beta}-actin: 78.1 ± 11.2 for B6-gld vs 72.9 ± 14.1 for B6+/+). However, OPG mRNA expression was significantly higher in B6-gld mice than in wild-type controls at later stages after bone marrow ablation (Fig. 7). Also, OPG mRNA expression significantly increased after Ovx in B6-gld mice (OD reading normalized to {beta}-actin: 104.8 ± 5.4 for B6-gld vs 79.5 ± 7.7 for B6+/+, p = 0.05, Mann-Whitney U test). Semiquantitative RT-PCR analysis of isolated diaphyseal bone shaft showed higher OPG mRNA expression in intact B6-gld mice than in B6+/+ mice, whereas OPG mRNA could not be detected in bone marrow of either mouse strain (data not shown). There was no difference in RANKL or RANK mRNA expression (data not shown). To further verify these differences in OPG mRNA expression, we performed quantitative real-time PCR analysis of separated bone and bone marrow samples (Fig. 8).



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 8. Diaphyseal bone from B6-gld mice express more OPG mRNA and protein. A–C, Quantitative real-time PCR of RNA isolated from the diaphyseal bone shaft. Standard curves were plotted as Ct vs logarithm quantity (Log Qty) of five serial dilutions of the calibrator sample cDNA for {beta}-actin (A) and OPG (B). The relative quantities of amplicons for B6+/+ and B6-gld mice were marked on the standard curves. Data were presented as mean ± SD for quadruplicate samples. C, Dissociation curve analysis was used to verify that SYBR Green I detected only the specific PCR product. The curves were plotted as negative derivative of the fluorescence with respect to temperature (-dF/dT) against temperature, resulting in a single peak for each specific amplicon at the expected Tm. D, Western blot of protein extracts from diaphyseal bone shaft and bone marrow.

 
The relative quantitation was assessed using the standard curve method for {beta}-actin and OPG (Fig. 8, A and B, respectively), and the melting curve analysis confirmed the amplification of specific product resulting in a single peak of dissociation at expected Tm for {beta}-actin or OPG (Fig. 8C). Bone shafts from B6-gld mice expressed significantly more OPG mRNA normalized to {beta}-actin than B6+/+ mice (0.477 ± 0.068 vs 0.128 ± 0.029, respectively; p < 0.05, Mann-Whitney U test). OPG mRNA in the bone marrow could be detected by real-time PCR, although in much smaller quantity compared with bone samples, with Ct values above 30 cycles for both mouse strains and no statistically significant difference between them (0.077 ± 0.018 in B6-gld vs 0.070 ± 0.010 in B6+/+ mice, Mann-Whitney U test). Expression of OPG protein, as assessed by Western blot, paralleled the mRNA expression (Fig. 8D).

In vitro, the number of alkaline phosphatase-positive marrow stromal fibroblast colonies was higher in B6-gld than in B6+/+ mice (Fig. 9A). Semiquantitative RT-PCR performed at day 8 of the stromal cell culture showed similar expression of RANKL but significantly higher expression of OPG in cultures from B6-gld mice than in those from B6+/+ mice (Fig. 9B). Immunostaining for OPG showed that marrow stromal cells from B6-gld mice also expressed more OPG protein than those from B6+/+ mice (Fig. 9C).



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 9. Bone marrow cells from B6-gld mice form more stromal fibroblast colonies and express more OPG mRNA and protein in vitro. A, Alkaline phosphatase-positive colonies in cultures of bone marrow cells from B6+/+ and B6-gld mice. Cells were cultured for 14 days in the presence of ascorbic acid, dexamethasone, and {beta}-glycerophosphate. B, PCR amplification curves for RANKL and OPG. PCR amplification was performed over the range of 27–39 cycles (data presented as mean ± SEM; for a triplicate). *, p < 0.05 vs B6+/+ (Kruskal-Wallis test followed with Dunn’s post-hoc test). C, Expression of OPG protein in cultures of bone marrow cells from B6+/+ and B6-gld mice. Immunohistological staining with OPG Ab was visualized with alkaline phosphatase-conjugated secondary Ab.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The present study was prompted by the recent accumulation of evidence that the regulation of osteogenesis and hemopoiesis is mediated by an overlapping pattern of factors, so that abnormalities in the regulation of one compartment affect the regulation of the other compartment. The importance of the Fas/Fas ligand pathways was recognized and extensively studied in the immune system, showing that the interactions between these two molecules are important not only for the regulation of immune response (18), but also for T and B lymphopoiesis (36, 37) and erythropoiesis (38). Based on the reports that Fas is expressed on osteoblasts in vitro and that it mediates osteoblast apoptosis, we hypothesized that mice with a mutated, nonfunctional Fas ligand and consequent absence of Fas-mediated apoptosis would have an increased number and/or life span of osteoblasts.

Our report demonstrated that mice lacking functional Fas ligand had greater total bone density and trabecular bone volume than their wild-type controls. B6-gld mice also formed more trabecular bone and had less apoptotic osteoblasts during osteoregeneration after mechanical bone marrow ablation, and had more alkaline phosphatase-positive colonies in ex vivo cultures of bone marrow stromal cells. These findings provide evidence that Fas/Fas ligand pathways determine bone mass in vivo by regulating osteoblast differentiation, activation, and life span in the bone marrow environment.

The expression of Fas has also been demonstrated by in situ hybridization in osteoclasts of the developing human mandible (17), suggesting that Fas-mediated mechanisms could be involved in the regulation of survival and function of these bone-resorbing cells. Due to the transient nature of apoptosis in bone cells and difficulties in detecting it in vivo (39), we were not able to detect apoptotic osteoclasts in intact adult bone or in bone tissue formed after bone marrow ablation or in osteoblasts in adult quiescent bone (our unpublished observations). Although we cannot exclude the intrinsic effect of defective Fas/Fas ligand system on osteoclast apoptosis in gld mice, several lines of evidence demonstrate that osteoblasts and bone marrow stromal fibroblasts were, at least in part, responsible for the down-regulation of bone resorption in these mice. Decreased number of osteoclasts in intact gld mice in vivo but unchanged osteoclastogenic potential of their bone marrow in vitro indicated that the down-regulation of osteoclastic bone resorption in gld mice in vivo was mediated by a mechanism that appeared independent of the osteoclast precursor pool size.

The key regulator of osteoclasts in the gld bone and bone marrow stromal microenvironment appeared to be OPG, a soluble molecule secreted by osteoblasts/bone marrow stromal cells (33). OPG belongs to the TNFR family and acts as a decoy receptor for RANKL, an osteoclast-stimulating cytokine. In this way OPG inhibits the formation of osteoclasts and bone resorption both in vivo and in vitro (35). OPG is also secreted by activated B cells, dendritic cells, and follicular dendritic cells, and is involved in the negative regulation of the immune response (40). In B6-gld mice, OPG mRNA and protein was increased in bones of intact animals, as well as during the late phases of osteogenic regeneration after bone marrow ablation. Also, cultures of bone marrow stromal fibroblasts from gld mice, which formed more alkaline phosphatase-positive colonies, expressed more OPG mRNA and protein. It has been recently shown that the expression of OPG by stromal osteoblast lineage cells was developmentally regulated, so that osteoblasts with a mature phenotype produce more osteoclast-inhibiting OPG and less osteoclast-stimulating RANKL (33). Decreased osteoblast apoptosis in B6-gld mice could maintain more terminally differentiated cells on bone surfaces, which produce more OPG than RANKL, and thus further promote a microenvironment that is less supportive for osteoclast formation.

The bone phenotype of mice lacking Fas/Fas ligand apoptotic pathway should be considered in the full complexity of their immunological disturbance. Increased production of OPG in bone/bone marrow stromal microenvironment may be relevant for the development of the immunological manifestations of the gld phenotype. gld bone marrow shows a decrease in the B220highIgM+CD23+ B cell population, which represents either recirculating mature B cells or B cells in late stages of maturation in situ (41). In view of our finding of increased OPG production by bone and stromal cells and the well-known close spatial proximity of B lymphopoiesis and endosteal bone surfaces (42), it is tempting to postulate the role of OPG/RANKL/RANK balance as a regulatory link between the stromal compartment and the lymphoproliferative phenotype which develops in the absence of Fas/Fas ligand interaction. This hypothesis is supported by the recent characterization of OPG knockout mice, which develop osteoporosis but also accumulate B cells in the bone marrow (40). In contrast, RANKL or RANK knockout mice have pronounced osteopetrosis and reduced numbers of B cells in lymphoid tissues (43).

In conclusion, we have shown that gld phenotype includes increased bone mass, which is the result of an intrinsic disturbance of osteoblast apoptosis and consequent disbalance of OPG/RANKL/RANK system in the bone and bone marrow stromal compartment. Further studies are warranted to clarify the role of this cytokine system and stromal microenvironment in the development of the lymphoproliferative phenotype of gld mice.


   Acknowledgments
 
We thank Dr. Douglas Adams (University of Connecticut Health Center, Farmington, CT) for his help with the µCT analysis. We also thank Katerina Zrinski-Petrovic and Sanja Ivcevic for their excellent technical assistance.


   Footnotes
 
1 This work was supported by the US-Croatian Joint Research Fund, Grant JF199, and the Ministry of Science and Technology of the Republic of Croatia, Grants 108148 and 1080110. Back

2 The results of this study were presented in part as an abstract in Vienna, Austria, at the International Conference in Bone and Mineral Research in 2000. Back

3 Address correspondence and reprint requests to Dr. Ana Marusic, Croatian Institute for Brain Research, Zagreb University School of Medicine, Salata 12, HR-10000 Zagreb, Croatia. E-mail address: marusica{at}mef.hr Back

4 Abbreviations used in this paper: gld, generalized lymphoproliferative disorder; BMD, bone mineral density; µCT, microcomputed tomography; OCL, osteoclast-like cell; OPG, osteoprotegerin; Ovx, ovariectomy; RANK, receptor activator of NF-{kappa}B; RANKL, RANK ligand; TRAP, tartrate-resistant acid phosphatase; Sham, sham operated; BV/TV, bone volume/total volume; rm, recombinant mouse; Tm, melting temperature; Ct, cycle threshold value. Back

Received for publication July 5, 2002. Accepted for publication November 20, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hofbauer, L. C., S. Khosla, C. R. Dunstan, D. L. Lacey, W. J. Boyle, B. L. Riggs. 2000. The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption. J. Bone Miner. Res. 15:2.[Medline]
  2. Lorenzo, J.. 2000. Interactions between immune and bone cells: new insights with many remaining questions. J. Clin. Invest. 106:749.[Medline]
  3. Sharrock, W. J.. 1998. Bone and the hematopoietic and immune systems: a report of the proceedings of a scientific workshop. J. Bone Miner. Res. 13:537.[Medline]
  4. Rodan, G. A., T. J. Martin. 2000. Therapeutic approaches to bone diseases. Science 289:1508.[Abstract/Free Full Text]
  5. Teitelbaum, S. L.. 2000. Bone resorption by osteoclasts. Science 289:1504.[Abstract/Free Full Text]
  6. Miyamoto, T., F. Arai, O. Ohneda, K. Takagi, D. M. Anderson, T. Suda. 2000. An adherent condition is required for formation of multinuclear osteoclasts in the presence of macrophage colony-stimulating factor and receptor activator of nuclear factor {kappa}B ligand. Blood 96:4335.[Abstract/Free Full Text]
  7. Ducy, P., T. Schinke, G. Karsenty. 2000. The osteoblast: a sophisticated fibroblast under central surveillance. Science 289:1501.[Abstract/Free Full Text]
  8. Bianco, P., P. Gehron Robey. 2000. Marrow stromal stem cells. J. Clin. Invest. 105:1663.[Medline]
  9. Roodman, G. D.. 1993. Role of cytokines in the regulation of bone resorption. Calcif. Tissue Int. 53:S94.
  10. Rifas, L.. 1999. Bone and cytokines: beyond IL-1, IL-6 and TNF-{alpha}. Calcif. Tissue Int. 64:1.[Medline]
  11. Franzoso, G., L. Carlson, L. Xing, L. Poljak, E. W. Shores, K. D. Brown, A. Leonardi, T. Tran, B. F. Boyce, U. Siebenlist. 1997. Requirement for NF-{kappa}B in osteoclast and B-cell development. Genes Dev. 11:3482.[Abstract/Free Full Text]
  12. Gunther, T., T. Schinke. 2000. Mouse genetics have uncovered new paradigms in bone biology. Trends Endocrinol. Metab. 11:189.[Medline]
  13. Hock, J. M., V. Krishnan, J. E. Onyia, J. P. Bidwell, J. Milas, D. Stanislaus. 2001. Osteoblast apoptosis and bone turnover. J. Bone Miner. Res. 16:975.[Medline]
  14. Weinstein, R. S., R. L. Jilka, A. M. Parfitt, S. C. Manolagas. 1998. Inhibition of osteoblastogenesis and promotion of apoptosis of osteoblasts and osteocytes by glucocorticoids: potential mechanisms of their deleterious effects on bone. J. Clin. Invest. 102:274.[Medline]
  15. Siegel, R. M., F. K. Chan, H. J. Chun, M. J. Lenardo. 2000. The multifaceted role of Fas signaling in immune cell homeostasis and autoimmunity. Nat. Immunol. 1:469.[Medline]
  16. Kawakami, A., K. Eguchi, N. Matsuoka, M. Tsuboi, T. Koji, S. Urayama, K. Fujiyama, T. Kiriyama, T. Nakashima, P. K. Nakane, S. Nagataki. 1997. Fas and Fas ligand interaction is necessary for human osteoblast apoptosis. J. Bone Miner. Res. 12:1637.[Medline]
  17. Hatakeyama, S., N. Tomichi, Y. Ohara-Nemoto, M. Satoh. 2000. The immunohistochemical localization of Fas and Fas ligand in jaw bone and tooth germ of human fetuses. Calcif. Tissue Int. 66:330.[Medline]
  18. Krammer, P. H.. 2000. CD95’s deadly mission in the immune system. Nature 407:789.[Medline]
  19. Takahashi, T., M. Tanaka, C. I. Brannan, N. A. Jenkins, N. G. Copeland, T. Suda, S. Nagata. 1994. Generalized lymphoproliferative disease in mice, caused by a point mutation in the Fas ligand. Cell 76:969.[Medline]
  20. Cohen, P. L., R. A. Eisenberg. 1991. lpr and gld: single gene models of systemic autoimmunity and lymphoproliferative disease. Annu. Rev. Immunol. 9:243.[Medline]
  21. Selvaggi, G., C. Ricordi, E. R. Podack, L. Inverardi. 1996. The role of the perforin and Fas pathways of cytotoxicity in skin graft rejection. Transplantation 62:1912.[Medline]
  22. Marusic, A., D. Grcevic, V. Katavic, N. Kovacic, I. K. Lukic, I. Kalajzic, J. A. Lorenzo. 2000. Role of B lymphocytes in new bone formation. Lab Invest. 80:1761.[Medline]
  23. Lorenzo, J. A., A. Naprta, Y. Rao, C. Alander, M. Glaccum, M. Widmer, G. Gronowicz, J. Kalinowski, C. C. Pilbeam. 1998. Mice lacking the type I interleukin-1 receptor do not lose bone mass after ovariectomy. Endocrinology 139:3022.[Abstract/Free Full Text]
  24. Parfitt, A. M., M. K. Drezner, F. H. Glorieux, J. A. Kanis, H. Malluche, P. J. Meunier, S. M. Ott, R. R. Recker. 1987. Bone histomorphometry: standardization of nomenclature, symbols, and units: report of the ASBMR Histomorphometry Nomenclature Committee. J. Bone Miner. Res. 2:595.[Medline]
  25. Moser, B.. 1995. A silver stain for the detection of apoptosis at the light microscope. Microscopy and Analysis Sept:27.
  26. Grcevic, D., S. K. Lee, A. Marusic, J. A. Lorenzo. 2000. Depletion of CD4 and CD8 T lymphocytes in mice in vivo enhances 1,25-dihydroxyvitamin D3-stimulated osteoclast-like cell formation in vitro by a mechanism that is dependent on prostaglandin synthesis. J. Immunol. 165:4231.[Abstract/Free Full Text]
  27. Dacic, S., I. Kalajzic, D. Visnjic, A. C. Lichtler, D. W. Rowe. 2001. Col1a1-driven transgenic markers of osteoblast lineage progression. J. Bone Miner. Res. 16:1228.[Medline]
  28. Lee, S. K., J. A. Lorenzo. 1999. Parathyroid hormone stimulates TRANCE and inhibits osteoprotegerin messenger ribonucleic acid expression in murine bone marrow cultures: correlation with osteoclast-like cell formation. Endocrinology 140:3552.[Abstract/Free Full Text]
  29. Steuerwald, N., J. Cohen, R. J. Herrera, C. A. Brenner. 2000. Quantification of mRNA in single oocytes and embryos by real-time rapid cycle fluorescence monitored RT-PCR. Mol. Hum. Reprod. 6:448.[Abstract/Free Full Text]
  30. Rajeevan, M. S., D. G. Ranamukhaarachchi, S. D. Vernon, E. R. Unger. 2001. Use of real-time quantitative PCR to validate the results of cDNA array and differential display PCR technologies. Methods 25:443.[Medline]
  31. Kovacic, N., J. Muthing, A. Marusic. 2000. Immunohistological and flow cytometric analysis of glycosphingolipid expression in mouse lymphoid tissues. J. Histochem. Cytochem. 48:1677.[Abstract/Free Full Text]
  32. Lacey, D. L., H. L. Tan, J. Lu, S. Kaufman, G. Van, W. Qiu, A. Rattan, S. Scully, F. Fletcher, T. Juan, et al 2000. Osteoprotegerin ligand modulates murine osteoclast survival in vitro and in vivo. Am. J. Pathol. 157:435.[Abstract/Free Full Text]
  33. Gori, F., L. C. Hofbauer, C. R. Dunstan, T. C. Spelsberg, S. Khosla, B. L. Riggs. 2000. The expression of osteoprotegerin and RANK ligand and the support of osteoclast formation by stromal-osteoblast lineage cells is developmentally regulated. Endocrinology 141:4768.[Abstract/Free Full Text]
  34. Suva, L. J., J. G. Seedor, N. Endo, H. A. Quartuccio, D. D. Thompson, I. Bab, G. A. Rodan. 1993. Pattern of gene expression following rat tibial marrow ablation. J. Bone Miner. Res. 8:379.[Medline]
  35. Simonet, W. S., D. L. Lacey, C. R. Dunstan, M. Kelley, M. S. Chang, R. Luthy, H. Q. Nguyen, S. Wooden, L. Bennet, T. Boone, et al 2000. Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 89:309.
  36. Laouar, Y., A. Sarukhan, V. Pasqualetto, C. Garcia, S. Ezine. 1998. Involvement of the Fas (CD95) system in peripheral cell death and lymphoid organ development. Eur. J. Immunol. 28:1078.[Medline]
  37. Laouar, Y., F. Vasseur, G. Moreau, C. Garcia, V. Pasqualetto, A. C. Wache, S. Ezine. 2000. Selective involvement of the Fas (CD95)/Fas ligand pathway in bone marrow B cell progenitors. Eur. J. Immunol. 30:1402.[Medline]
  38. De Maria, R., U. Testa, L. Luchetti, A. Zeuner, G. Stassi, E. Pelosi, R. Riccioni, N. Felli, P. Samoggia, C. Peschle. 1999. Apoptotic role of Fas/Fas ligand system in the regulation of erythropoiesis. Blood 93:796.[Abstract/Free Full Text]
  39. Jilka, R. L., R. S. Weinstein, T. Bellido, A. M. Parfitt, S. C. Manolagas. 1998. Osteoblast programmed cell death (apoptosis): modulation by growth factors and cytokines. J. Bone Miner. Res. 13:793.[Medline]
  40. Yun, T. J., M. D. Tallquist, A. Aicher, K. L. Rafferty, A. J. Marshall, J. J. Moon, M. E. Ewings, M. Mohaupt, S. W. Herring, E. A. Clark. 2001. Osteoprotegerin, a crucial regulator of bone metabolism, also regulates B cell development and function. J. Immunol. 166:1482.[Abstract/Free Full Text]
  41. Reap, E. A., M. L. Piecyk, A. Oliver, E. S. Sobel, T. Waldschmidt, P. L. Cohen, R. A. Eisenberg. 1996. Phenotypic abnormalities of splenic and bone marrow B cells in lpr and gld mice. Clin. Immunol. Immunopathol. 78:21.[Medline]
  42. Lichtman, M. A.. 1981. The ultrastructure of the hemopoietic environment of the marrow: a review. Exp. Hematol. 9:391.[Medline]
  43. Theill, L. E., W. J. Boyle, J. M. Penninger. 2002. RANK-L and RANK: T cells, bone loss, and mammalian evolution. Annu. Rev. Immunol. 20:795.[Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2003 170: 1129-1130. [Full Text]  



This article has been cited by other articles:


Home page
 Endocr. Rev.Home page
J. Lorenzo, M. Horowitz, and Y. Choi
Osteoimmunology: Interactions of the Bone and Immune System
Endocr. Rev., June 1, 2008; 29(4): 403 - 440.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
N. Kovacic, I. K. Lukic, D. Grcevic, V. Katavic, P. Croucher, and A. Marusic
The Fas/Fas Ligand System Inhibits Differentiation of Murine Osteoblasts but Has a Limited Role in Osteoblast and Osteoclast Apoptosis
J. Immunol., March 15, 2007; 178(6): 3379 - 3389.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Park, Y.-K. Jung, O.-J. Park, Y. J. Lee, J.-Y. Choi, and Y. Choi
Interaction of Fas Ligand and Fas Expressed on Osteoclast Precursors Increases Osteoclastogenesis
J. Immunol., December 1, 2005; 175(11): 7193 - 7201.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
X. Wu, M. A. McKenna, X. Feng, T. R. Nagy, and J. M. McDonald
Osteoclast Apoptosis: The Role of Fas in Vivo and in Vitro
Endocrinology, December 1, 2003; 144(12): 5545 - 5555.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S.-I. Hayashi, T. Yamada, M. Tsuneto, T. Yamane, M. Takahashi, L. D. Shultz, and H. Yamazaki
Distinct Osteoclast Precursors in the Bone Marrow and Extramedullary Organs Characterized by Responsiveness to Toll-Like Receptor Ligands and TNF-{alpha}
J. Immunol., November 15, 2003; 171(10): 5130 - 5139.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Katavic, V.
Right arrow Articles by Marusic, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Katavic, V.
Right arrow Articles by Marusic, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS