The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Melmed, G.
Right arrow Articles by Abreu, M. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Melmed, G.
Right arrow Articles by Abreu, M. T.
The Journal of Immunology, 2003, 170: 1406-1415.
Copyright © 2003 by The American Association of Immunologists

Human Intestinal Epithelial Cells Are Broadly Unresponsive to Toll-Like Receptor 2-Dependent Bacterial Ligands: Implications for Host-Microbial Interactions in the Gut 1

Gil Melmed*, Lisa S. Thomas*, Nahee Lee*, Samuel Y. Tesfay*, Katie Lukasek*, Kathrin S. Michelsen{dagger}, Yuehua Zhou{ddagger}, Bing Hu{ddagger}, Moshe Arditi{dagger} and Maria T. Abreu2,*

* Inflammatory Bowel Disease Center, Division of Gastroenterology, Department of Medicine, {dagger} Division of Pediatric Infectious Diseases, Department of Pediatrics, Steven Spielberg Pediatric Research Center, Burns and Allen Research Institute, and {ddagger} Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Intestinal epithelial cells (IEC) interact with a high density of Gram-positive bacteria and are active participants in mucosal immune responses. Recognition of Gram-positive organisms by Toll-like receptor (TLR)2 induces proinflammatory gene expression by diverse cells. We hypothesized that IEC are unresponsive to Gram-positive pathogen-associated molecular patterns and sought to characterize the functional responses of IEC to TLR2-specific ligands. Human colonic epithelial cells isolated by laser capture microscopy and IEC lines (Caco-2, T84, HT-29) were analyzed for expression of TLR2, TLR6, TLR1, and Toll inhibitory protein (Tollip) mRNA by RT-PCR and quantitative real-time PCR. Response to Gram-positive bacterial ligands was measured by NF-{kappa}B reporter gene activation and IL-8 secretion. TLR2 protein expression was analyzed by immunofluorescence and flow cytometry. Colonic epithelial cells and lamina propria cells from both uninflamed and inflamed tissue demonstrate low expression of TLR2 mRNA compared with THP-1 monocytes. IECs were unresponsive to TLR2 ligands including the staphylococcal-derived Ags phenol soluble modulin, peptidoglycan, and lipotechoic acid and the mycobacterial-derived Ag soluble tuberculosis factor. Transgenic expression of TLR2 and TLR6 restored responsiveness to phenol soluble modulin and peptidoglycan in IEC. In addition to low levels of TLR2 protein expression, IEC also express high levels of the inhibitory molecule Tollip. We conclude that IEC are broadly unresponsive to TLR2 ligands secondary to deficient expression of TLR2 and TLR6. The relative absence of TLR2 protein expression by IEC and high level of Tollip expression may be important in preventing chronic proinflammatory cytokine secretion in response to commensal Gram-positive bacteria in the gut.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Intestinal epithelial cells (IEC) serve as a barrier between the body and the bacteria present in the intestinal lumen. Rather than a passive barrier, the intestinal epithelium is an active participant in the mucosal immune response through its expression of proinflammatory genes, secretion of inflammatory cytokines, and recruitment of inflammatory cells in response to pathogenic bacteria and their products (1, 2, 3, 4, 5, 6, 7, 8, 9, 10). Inflammatory bowel disease is characterized by acute and chronic immune-mediated inflammation of the gut mucosa in the absence of a specific pathogen. These diseases have been increasingly thought to result from an aberrant interaction between the environment and the genetically susceptible host. Specifically, several lines of evidence point to a dysregulated immune response to a commensal or uncharacterized pathogenic bacteria in the gut. First, patients with inflammatory bowel disease demonstrate immunological reactivity to their own commensal flora (11, 12) and fecal diversion is effective in modifying intestinal inflammation (13, 14, 15). Second, manipulation of the bacterial flora either through the use of antibiotics or probiotics is effective in ameliorating inflammatory bowel disease (16, 17, 18, 19, 20, 21). Finally, over 30 animal models have been described that mimic human inflammatory bowel disease (22). In general, these animals do not develop intestinal inflammation in the absence of commensal bacteria (23, 24, 25, 26, 27, 28). These data support a role for bacterial epithelial interactions in the development or perpetuation of intestinal inflammation.

Toll-like receptors (TLRs) are a family of transmembrane receptors homologous to the Drosophila Toll protein (29, 30, 31). These receptors are termed pattern-recognition receptors because they recognize repetitive patterns, i.e., pathogen-associated molecular patterns (PAMPs), present on diverse microbes including Gram-positive and Gram-negative bacteria, fungi, and mycobacteria. TLR ligand recognition occurs via interaction of the extracellular leucine-rich domain of TLR with its PAMP. The interaction of TLR with its PAMP results in activation of multiple intracellular signaling events through its Toll/IL-1R domain, activation of NF-{kappa}B and the production of cytokines such as the neutrophil chemoattractant IL-8 (32, 33, 34, 35). TLR4 is required for the recognition of LPS and mutations or deletion of TLR4 make animals LPS unresponsive (36, 37, 38). By contrast, TLR2 is required for recognition of Gram-positive and mycobacterial PAMPs including bacterial lipopeptide, lipotechoic acid (LTA), peptidoglycan (PGN), and soluble tuberculosis factor (STF) (39, 40, 41, 42, 43, 44, 45). Mutations in TLR2 are associated with severe mycobacterial, staphylococcal infection and lepromatous leprosy (46, 47, 48). Further studies have shown that combinations of TLR molecules are required for recognition of certain PAMPs. Specifically, combined expression of TLR2 and TLR6 is required for recognition of PGN, yeast cell wall zymosan, and phenol soluble modulin (PSM), a factor secreted by Staphylococcus epidermidis (49, 50, 51, 52, 53). TLR2 in combination with TLR1 recognizes triacylated bacterial lipopeptides (54, 55). Recent studies have demonstrated that both TLR2 and TLR1 signaling are required to generate an immune response to the Borrelia burgdorferi PAMP OspA (56). However, in certain overexpression systems expression of TLR1 inhibited TLR2 or TLR4 signaling (52, 57). Toll inhibitory protein (Tollip), a molecule that interferes with IL-1R-activated kinase (IRAK) signaling, inhibits TLR2 and TLR4 responsiveness and may serve to limit proinflammatory cytokine secretion (58, 59, 60).

Relatively little is known about the role of TLR2 signaling in the intestinal epithelium. A wide variety of bacterial species reside within the human colon (61, 62, 63). Gram-positive aerobes such as Lactobacillus and Streptococcus spp. and Gram-positive anaerobes such as Clostridium spp. account for at least half of the diversity of bacteria in the colon (64, 65). In genetically susceptible rats, intramural injection of PGN results in granulomatous inflammatory bowel disease (66, 67). Animal models of inflammatory bowel disease such as the IL-10 knockout mouse reconstituted with Gram-positive Enterococcus faecalis develop chronic intestinal inflammation (68, 69). Finally, a substrain of C3H/HeJ mice which carry a mutation in the TLR4 gene and are LPS unresponsive develop chronic intestinal inflammation in the presence of commensal bacteria (70). These data suggest that Gram-positive bacteria or their products may play a role in the development or perpetuation of intestinal inflammation in the susceptible host.

Therefore, we wished to understand how the normal intestinal epithelium dealt with continued exposure to commensal Gram-positive bacteria. We hypothesized that IEC are poorly responsive to Gram-positive bacterial cell wall components and other TLR2 ligands. Studies have demonstrated that IEC express TLR2 mRNA but the functional significance of these findings are unclear (71, 72, 73). A recent study using immunohistochemistry demonstrated that lamina propria macrophages express TLR2 and that expression increases with inflammation (74). Expression of TRL2 by IEC is not demonstrated. In the current study, we demonstrate that IEC express low levels of TLR2 mRNA and protein compared with TLR2 ligand-responsive cells and express high levels of the IRAK inhibitor Tollip. Consistent with these observations, IEC are not responsive to a variety of TLR2-specific ligands. Transgenic expression of TLR2 and TLR6 is required for optimal cellular activation in response to these ligands. The results of our studies highlight the potential role of transcriptional regulation of TLR expression and function in specific tissues.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells and reagents

IEC lines, Caco-2, HT-29, and T84, and the monocyte cell line THP-1 were obtained from the American Type Culture Collection (Rockville, MD). Subconfluent monolayers of these cell lines were kept in a humidified incubator at 37°C with 5% CO2. T84 were cultured on 12-mm transwell polycarbonate membranes (no. 3041; Costar, Cambridge, MA) and maintained in DMEM/F12 (Life Technologies, Gaithersburg, MD) with 5% penicillin/streptomycin (Pen/Strep), 5% L-glutamine, supplemented with 5% FBS, as previously described (75). T84 cells were used between passage number 16 and 35 (76). For experiments in which polarized T84 monolayers were used, transepithelial resistance was measured using a Millipore Millicell-ERS Voltohmeter (Bedford, MA). Experiments were performed when transepithelial resistance was >2000 ohm-cm2. Caco-2 were maintained in MEM (Life Technologies) supplemented with 10% FBS, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, and 5% Pen/Strep. HT-29 were maintained in McCoy’s 5A medium supplemented with 10% FBS and 5% Pen/Strep. THP-1 cells were cultured in RPMI 1640 with 10% FBS, 2 mM L-glutamine, and 5% Pen/Strep. The immortalized human dermal microvessel endothelial cells (HMEC) (a generous gift of Dr. F. J. Candal, Centers for Disease Control and Prevention, Atlanta, GA; Ref.77) were cultured in MCDB-131 medium supplemented with 10% heat-inactivated FBS, 2 mM of glutamine, and 100 µg/ml Pen/Strep in 24-well plates, and used from passages 10 to 14, as described earlier (32, 77, 78).

PGN from Staphylococcus aureus was purchased from Fluka (Buchs, Switzerland) and diluted in PBS. PSM from S. epidermidis was a kind gift of S. Klebanoff (University of Washington, Seattle, WA; Ref.52). STF was a kind gift of Dr. M. Fenton (Boston University School of Medicine, Boston, MA) (45). LTA from S. aureus and S. epidermidis was a kind gift of Dr. J. Mond (Biosynexus, Gaithersburg, MD). The synthetic bacterial lipopeptide palmitoyl-Cys((RS)-2,3-di(palmitoyloxy)-propyl)-Ala-Gly-OH (Pam3-Cys-Ala-Gly-OH) was purchased from Bachem (Torrance, CA) (79). TNF-{alpha} was purchased from R&D Systems (Minneapolis, MN).

Expression vectors and cDNA constructs

Endothelial leukocyte adhesion molecule (ELAM)-NF-{kappa}B luciferase and pCMV-{beta}-galactosidase were used as previously described (32). Human TLR2 cDNA and murine TLR6 were a kind gift of R. Medzhitov (Yale University, New Haven, CT). Human TLR1 plasmid was a gift of D. Segal (National Institutes of Health, Bethesda, MD). Plasmids were prepared with an endotoxin-free Plasmid Maxi-prep kit (Qiagen, Valencia, CA).

Transient gene expression and reporter gene assays

HMEC, Caco-2, or T84 cells were plated at a density of 100,000, 150,000, or 200,000 cells/well, respectively, in 12-well plates 24 h before transfection. HMEC were plated at a concentration of 50,000 cells/well in 24-well plates. Cells were transfected the following day with FuGENE 6 transfection reagent (Roche, Basel, Switzerland) as per the manufacturer’s instructions and as described earlier (32, 78). Reporter genes pCMV-{beta}-galactosidase, ELAM-NF-{kappa}B-luciferase (0.4 µg), and pCDNA3 empty vector (0.3–0.6 µg), Flag-tagged wild-type human TLR2 (0.3 µg), or wild-type murine TLR6 (0.3 µg) were cotransfected as indicated in the figure legends. After overnight transfection, cells were stimulated for 5 h with PSM (200 ng/ml), PGN (10 µg/ml), LTA from S. aureus (10 µg/ml), bacterial lipopeptide (100 ng/ml), or STF (2.5 µg/ml). Cells were then lysed in 200 µl of reporter lysis buffer, and luciferase activity was measured with a firefly luciferase kit (Promega, Madison, WI) using a Wallac 1450 Microbeta liquid scintillation counter (PerkinElmer, Wellesley, MA). Data shown are mean ± SD of three or more independent experiments, and are reported as fold-induction over cells transfected with a control vector. Transfection efficiency was determined by assaying for {beta}-galactosidase activity using a colorimetric method (Promega) as previously described (32).

RT-PCR and real-time PCR analyses

Total RNA was isolated from T84, Caco-2, HT-29, and HMEC using a Qiagen kit following manufacturer’s instruction and treated with RNase-free DNase I. For the reverse-transcription reaction, the MMLV preamplification system (Invitrogen, Carlsbad, CA; Life Technologies) was used. PCR amplification was performed with Taq Gold polymerase (Perkin-Elmer, Foster City, CA). Amplification of TLR2 was performed using 38 cycles at 95°C for 30 s, 65°C for 30 s, and 72°C for 1 min. The TLR2 forward primer was GCCAAAGTCTTGATTGATTGG and the reverse primer was TATACCACAGGCCATGGAAAC. The {beta}-actin forward primer was LB08 GGCTACAGCTTCACCACCACG and the reverse primer LB09 was GCCAGACAGCAGTGTGTTGGC. These primers amplify products that are 150 bp in size. To quantify the level of mRNA expression, RT-PCR products run on a 1% ethidium bromide-stained agarose gel were analyzed on an AlphaImager 2000 densitometer (Alpha Inotech, Wohlen, Switzerland).

Quantitative real-time PCR was conducted for TLR1, TLR2, TLR6, Tollip, and GAPDH using TaqMan probes. TLR1, TLR2, and TLR6 and GAPDH primers were previously published (80). TaqMan probes for Tollip were designed using Primer 3 software (Whitehead Institute for Biomedical Research, Cambridge, MA). A total of 2 µg of RNA was reverse-transcribed using M-MLV RT (Invitrogen). The following conditions were used 50°C for 2 min, 95°C for 10 min, then 45 cycles at 95°C for 15 s, and 60°C for 1 min. Assays were performed following the predeveloped TaqMan assay reagents protocol (Applied Biosystems, Foster City, CA) in an iCycler (Bio-Rad, Hercules, CA). The iCycler Optical System Interface (Bio-Rad) was used to analyze the standards and to quantitate samples (Table I).


View this table:
[in this window]
[in a new window]
 
Table I. Real-time PCR primers

 
ELISA

For human IL-8 ELISA, 10,000 HT-29 cells were plated per well in 96-well plates. Cells were treated with PSM (200 ng/ml), PGN (10 µg/ml), LTA from S. aureus (10 µg/ml), LTA from S. epidermidis (10 µg/ml), bacterial lipopeptide (100 ng/ml), STF (2.5 µg/ml), or TNF-{alpha} (10 ng/ml) for 18 h and supernatants harvested for measurement of IL-8. IL-8 ELISA (BD Biosciences, Mountain View, CA) were performed as per manufacturer’s instructions.

Flow cytometry and immunofluorescent staining

TLR2 flow cytometry was performed using monoclonal mouse anti-human TLR 2.1 Ab (eBioscience, San Diego, CA) as per manufacturer’s instructions. Briefly, 500,000 cells of HT-29, Caco-2, T84, or THP-1 cells were washed in PBS containing BSA and sodium azide then incubated with TLR2 Ab at a 1/100 dilution for 30 min at 4°C. After washing, FITC-conjugated goat anti-mouse Ab was added and suspension was incubated at 4°C for 30 min. Cells were then fixed in 1% paraformaldehyde at 4°C until analyzed. Negative controls were prepared by incubating with an isotype-matched control Ab. A BD Biosciences flow cytometer was used to analyze cells.

For TLR2 immunofluorescent staining, membranes were fixed in methanol-acetone at room temperature for 5 min, blocked in goat serum-PBS 5% for 1 h, followed by incubation with primary anti-TLR2 Ab (1/50 dilution; eBioscience) and FITC-conjugated anti-mouse Ab (1/64 dilution) (Sigma-Aldrich, St. Louis, MO). Immunofluorescence was visualized with a Leica TCS SP laser scanning inverted confocal microscope (Deerfield, IL). For a given experiment, all images were obtained using the same confocal microscope settings.

Laser capture microscopy

Human intestinal tissue was obtained from patients undergoing colonic resections who consented to having tissue donated for research purposes. This study was reviewed and approved for human subject participation by the Cedars-Sinai Institutional Review Board. The tissue used for this study included uninvolved areas of intestine from patients with colon cancer and paired inflamed and uninflamed areas of colon from patients with ulcerative colitis. After cutting frozen sections, slides were gently fixed in 100% ethanol followed by a light H&E staining. An Arcturus laser capture microscope (Mountain View, CA) was used to microdissect the tissue. Briefly, IEC were identified based on appearance and location, microdissected, and captured on a microfuge cap. The lamina propria was separately microdissected and captured from each intestinal specimen. Photo documentation was obtained before and after dissection. Total RNA was made using the Pico Pure RNA extraction kit (Arcturus) as per manufacturer’s instructions and followed by reverse transcription using random hexamers and Superscript II (Life Technologies).

Statistical analysis

Student’s t tests, SD, and SE were performed using the statistics package within Microsoft Excel (Redmond, WA). Values of p were considered statistically significant when <0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IEC express TLR2 mRNA

IEC are in continuous contact with Gram-positive commensal bacteria. Gram-positive bacterial PAMPs including PSM, PGN, and bacterial lipopeptides are recognized by TLR2. We wished to determine whether native colonic epithelial cells and IEC lines expressed TLR2 and its coreceptors TLR1 and TLR6. To address this question, we selectively isolated colonic epithelial cells or lamina propria cells using laser capture microdissection of normal and inflamed human colonic tissue (Fig. 1A) and assayed for the presence of TLR2 mRNA by RT-PCR. TLR2 mRNA was expressed by both native colonic epithelial cells and lamina propria cells (Fig. 1B). To further quantify the level of expression, TLR2, TLR6, and TLR1 mRNA were assessed by real-time PCR using specific TaqMan probes (Fig. 1C). THP-1 cells, a human monocyte line, were used as a positive control for TLR expression. Compared with THP-1 cells, colonic epithelial and lamina propria cells express lower levels of TLR2 mRNA. Cells isolated from inflamed tissue did not demonstrate increased TLR2 or TLR6 expression. TLR1 expression was lower in inflamed colonic epithelial cells and lamina propria cells. These data demonstrate that colonic epithelial cells and lamina propria cells express low levels of TLR2 compared with TLR2 ligand-responsive monocytes.



View larger version (103K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of TLR2 signaling molecules by human IEC. A, Laser capture microscope dissection was performed on normal and inflamed colonic tissue from patients undergoing colonic resections for ulcerative colitis to isolate colonic epithelial cells and lamina propria cells. Dissection of the colonic crypts from uninflamed tissue (top row) and from inflamed tissue (bottom row) using a laser beam to remove colonic epithelial cells from the tissue (left panel, before; middle panel, after dissection) and transfer to a microfuge cap (right panel). B, Expression of TLR2 was analyzed by PCR following reverse transcription of total RNA from colonic crypt epithelial cells (Epithelium) or lamina propria cells (Lamina propria) isolated from resections of normal colonic tissue in four patients. THP-1 cells were used as a positive control. {beta}-actin was analyzed to verify similar cDNA loading (data not shown). Both colonic epithelial cells and lamina propria cells express TLR2. C, Quantitated expression of TLR2, TLR6, and TLR1 by human colonic epithelial cells based on real-time PCR. Laser capture microscope dissection was performed on normal or inflamed colonic tissue from two patients undergoing colonic resections for ulcerative colitis. Colonic epithelial cells and lamina propria cells were isolated from inflamed and uninflamed sections of colon. Expression of TLR2, TLR6, and TLR1 were analyzed by real-time PCR using TaqMan probes. GAPDH was used as an internal control for all reactions. THP-1 cDNA was used as a positive control for a TLR2-responsive cell line. Each reaction was performed in triplicate.

 
Our findings in colonic epithelial cells demonstrate expression of TLR2 and its coreceptors TLR1 and TLR6 but the functional implications of this expression are unclear. We wished to determine whether IEC lines could serve as a model for native colonic epithelial cells with respect to TLR2 expression and function. Previous studies have demonstrated expression of TLR2 protein in Caco-2 and T84 by Western blotting but not in HT-29 cells (81). We thus quantified the level of TLR2, TLR6, and TLR1 mRNA expression in three well-characterized IEC lines by real-time PCR (Fig. 2). As with native colonic epithelial cells, IEC lines express TLR2 and the expression is lower than that of THP-1 cells but higher than that of TLR2-negative endothelial cells, HMEC. Caco-2 cells which resemble villous enterocytes had lower expression of TLR1 and TLR6 than T84 and HT-29 cells. Based on these results, we used IEC lines to study the functional response of IEC to TLR2 ligands.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 2. Expression of TLR2 signaling molecules in IEC lines. Expression of TLR2 (A), TLR6 (B), and TLR1 (C) were analyzed by real-time PCR following reverse transcription of mRNA from IEC lines. GAPDH was analyzed to verify similar cDNA loading. THP-1 was used as a positive control. HMEC are TLR2-negative. All reactions were performed in triplicate and this is one representative experiment of three with similar results.

 
IECs are poorly responsive to TLR2 ligands

Our data demonstrate that IEC lines express TLR2 mRNA. We hypothesized that IEC would be responsive to TLR2 ligands. To test this hypothesis, we measured the ability of the TLR2 ligands PSM, PGN, STF, LTA, and bacterial lipopeptide to activate NF-{kappa}B transcriptional activity or induce IL-8 secretion in IEC. HMEC expressing a TLR2 transgene were used as a positive control for TLR2 ligand activation (82). IEC lines were poorly responsive to TLR2 ligands (Fig. 3A). Caco-2 cells had a weak response to PSM and PGN (average fold induction, 2.6 (p = 0.04) and 2.0 (p = 0.02), respectively) when compared with unstimulated cells. By contrast, TLR2-transfected HMEC had a robust response to these ligands (average fold induction for three independent experiments performed in triplicate was PSM, 8-fold; PGN, 9-fold; LTA, 6-fold; and STF, 7-fold; p < 0.001). Polarized T84 monolayers were stimulated apically or basolaterally with TLR2 ligands but had no response as measured by NF-{kappa}B activation to PGN. Bacterial lipopeptide which requires TLR2 and TLR1 did not activate NF-{kappa}B in T84 or Caco-2 cells (Fig. 3A). We further tested the ability of TLR2 ligands to induce IL-8 secretion from IEC. HT-29 cells were stimulated with PSM, LTA, STF, bacterial lipopeptide, and TNF-{alpha} (Fig. 3B). HT-29 did not secrete IL-8 in response to TLR2 ligands but secreted IL-8 in response to TNF-{alpha}. We conclude from these data that despite TLR2 mRNA expression, IEC lines are poorly responsive to TLR2 ligands.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. IEC are poorly responsive to TLR2 ligand activation. A, IEC lines (T84 and Caco-2 cells) or HMEC as indicated were transfected with 0.4 µg of ELAM-NF-{kappa}B luciferase as described in Materials and Methods. HMEC were additionally transfected with human TLR2 cDNA. The day following transfection, cells were exposed to PSM (200 ng/ml), PGN (10 µg/ml), STF (2.5 µg/ml), LTA from S. Aureus (10 µg/ml), or bacterial lipopeptide (BL) (100 ng/ml) for 5 h and cells were lysed for luciferase activity. Neither T84 cells nor Caco-2 showed significant response to stimulation with any of the five ligands tested as compared with unstimulated cells. TLR2-expressing HMEC had a robust response to all ligands tested. The biological activity of bacterial lipopeptide was confirmed in RAW murine macrophage line as measured by TNF-{alpha} production (data not shown). These data are a representative experiment of three performed in triplicate and y-error bars indicate SD. B, HT-29 cells were stimulated with PSM, PGN, LTA, STF, and bacterial lipopeptide (BL) as above and IL-8 production was measured in the supernatants. TNF-{alpha} was used as a positive control for IL-8 production. TLR2 ligands do not result in IL-8 production. These data are a representative experiment of three performed in triplicate and y-error bars indicate SD.

 
Transgenic expression of TLR2 and TLR6 restores TLR2 ligand responsiveness in IECs

TLR2 cooperates with TLR6 for cellular activation by Gram-positive peptidoglycans and PSM and with TLR1 for cellular activation by triacylated bacterial lipopeptides (50, 52, 54, 56, 59). We have previously shown that IEC are functionally deficient in both TLR4 and MD-2 and require both for response to LPS (83). Our data above demonstrate that despite the presence of TLR2 mRNA, IEC are unresponsive to TLR2 ligands. We hypothesized that the reason for TLR2 ligand unresponsiveness was a relative deficiency of TLR2 and/or TLR6 in IEC. To test this hypothesis, we transgenically expressed TLR2 or TLR6 and stimulated cells with the TLR2 ligands, bacterial lipopeptide PSM and PGN. Our results show that TLR2 expression alone was not sufficient to restore TLR2 ligand responsiveness in T84 and Caco-2 cells (Fig. 4, A and B). Neither cell line responded to bacterial lipopeptide despite expression of TLR2 with or without TLR1. However, this preparation of bacterial lipopeptide did induce TNF-{alpha} secretion by RAW cells, a murine macrophage cell line (data not shown). Expression of TLR6 alone in Caco-2 cells resulted in modest responsiveness to PGN (5-fold over TLR6-transfected unstimulated cells, p = 0.02, for three independent experiments performed in triplicate) (compare column 5 to column 11; Fig. 4B). No significant responses were noted in T84 cells transfected with TLR6 alone (Fig. 4A). Because it has been shown that these ligands require recognition by a heterodimer of TLR2 and TLR6 (51), we hypothesized that transfection of both TLR2 and TLR6 would result in enhanced ligand responsiveness. T84 and Caco-2 cells were transiently transfected with both TLR2 and TLR6 and were stimulated with PSM and PGN. Our data demonstrate that expression of TLR2 and TLR6 resulted in significant activation of NF-{kappa}B in response to PSM and PGN in both T84 and Caco-2 cells (T84: PSM 3-fold, PGN 8-fold; Caco-2: PSM 6-fold, PGN 18-fold) as compared with unstimulated cells transfected with TLR2 and TLR6. We conclude from these experiments that despite TLR2 and TLR6 mRNA, IEC are functionally deficient in both of these proteins. We further conclude that the remainder of the intracellular signaling pathway from TLR2/TLR6 to NF-{kappa}B is intact in IEC.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. Expression of TLR2 and TLR6 restores TLR2 ligand responsiveness to human IEC lines. T84 (A) and Caco-2 cells (B) were transfected with ELAM-NF-{kappa}B-luciferase (0.4 µg) and cotransfected with 0.3 µg of TLR2, TLR6, or TLR1 (T84 only) as indicated. The amount of transfected DNA was kept constant using a pCDNA3 vector control. The day following the transfection, indicated cells were exposed to bacterial lipopeptide (BL) (100 ng/ml), PSM (200 ng/ml), or PGN (10 µg/ml) for 5 h and lysed for luciferase activity. The data are expressed as fold-induction of relative light units when compared with transfection of the vector control. These data are one representative experiment of three independent experiments performed in triplicate and y-error bars indicate SD.

 
IECs express low levels of TLR2 protein and increased levels of the inhibitory molecule Tollip

Our data above demonstrate that transgenic expression of TLR2 and TLR6 are required to restore TLR2 ligand responsiveness in IEC despite RNA expression of TLR2 and TLR6. Some have demonstrated protein expression of TLR2 by immunohistochemistry in IEC and by Western blotting in T84 cells (71, 72) whereas others have not (74). We reasoned that one explanation for this functional discrepancy in IEC lines is low TLR2 protein expression. To address this question, we performed immunofluorescent staining for the presence of TLR2 in untransfected T84 monolayers and TLR2-responsive THP-1 cells. T84 cells demonstrated weak staining of TLR2 which was predominantly at the cell periphery (Fig. 5A). Using the same confocal microscope settings, THP-1 demonstrated more intense staining with little detectable staining of intracellular compartments. Transfection of TLR2 in T84 cells showed increased TLR2 expression compared with untransfected cells. These data demonstrate that T84 cells express TLR2 protein and the amount of TLR2 protein expressed is increased following transfection.



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 5. IEC lines express low levels of surface TLR2 and increased levels of Tollip. A, Immunofluorescent staining of TLR2 in T84 cells. T84 cells and THP-1 cells were stained with anti-human TLR2 Ab. THP-1 cells demonstrated plasma membrane staining and T84 cells demonstrated weak plasma membrane staining. Immunofluorescent staining of TLR-2-transfected T84 cells shows increased TLR2 expression. Omission of the primary Ab did not demonstrate any staining using the same confocal microscope scanning parameters. B, Expression of surface TLR2 on IEC lines was examined using a FITC-conjugated anti-human TLR2 Ab (T84 and Caco-2, bottom panel) and compared with expression on THP-1 cells (top panel, right). M1 represents TLR2-positive cells. A negative control Ab did not demonstrate staining (top panel, left). C, Expression of Tollip was analyzed by real-time PCR using TaqMan probes. GAPDH was used as an internal control for all reactions. THP-1 and HMEC cDNA were used as positive controls for Tollip. All three cell lines expressed a high level of Tollip compared with THP-1 and HMEC. All reactions were performed in triplicate and this is one representative experiment of three with similar results.

 
Previous studies have demonstrated that the extracellular domain of TLR2 interacts with PAMPs initiating a downstream signaling cascade (84). We next wished to quantify the level of expression of TLR2 on the surface of IEC lines. To address this issue, we performed flow cytometry for the presence of surface TLR2 on IEC lines. THP-1 cells were used as a positive control because they are known to respond to TLR2 ligands and express TLR2 on their surface (82). Compared with TLR2-responsive THP-1 cells, IEC lines express low levels of surface TLR2 (Fig. 5B). These data suggest that TLR2 is weakly expressed on the surface of IEC and may explain the hyporesponsiveness of IEC to TLR2 ligands.

In addition to diminished expression of TLR2, the response to TLR2 ligands may be inhibited by Tollip (58, 59, 60). We hypothesized that an additional mechanism by which IEC may be hyporesponsive to TLR2 ligands may be increased expression of the intracellular IRAK inhibitor Tollip. Therefore, we examined the expression of Tollip in IEC lines (Fig. 5C). All three IEC lines expressed Tollip mRNA. The level of Tollip expression by IEC lines was substantially higher than that seen in TLR2 ligand-responsive THP-1 cells and TLR4 ligand-responsive HMEC. These data suggest that IEC may limit TLR2 ligand responsiveness by overexpression of TLR inhibitory molecules such as Tollip.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The intestinal epithelium is continually confronted by a variety of commensal bacteria and PAMPs (72). However, in the absence of pathogenic bacteria, the lamina propria maintains a controlled state of inflammation. Recent data demonstrate that in addition to the specialized epithelial M cells, dendritic cells may also send out projections between IEC to sample the lumenal contents (85). We hypothesized that the intestinal epithelium has developed a careful system by which to induce an inflammatory response to select bacterial pathogens but not in response to nonpathogenic commensal organisms. Other epithelia such as the uroepithelium or pulmonary epithelium induce a potent inflammatory response to the same gut commensals (86, 87). Expression of TLR2 by human middle ear or airway epithelial cells is normally low but increases in response to Haemophilus influenzae infection (88) suggesting that specific bacterial stimuli regulate TLR expression in diverse epithelia. Therefore the question is how does the intestinal epithelium down-regulate a response to commensal bacteria, in particular, Gram-positive commensals and mycobacteria?

We and others have previously demonstrated that IEC express very low levels of TLR4 and its coreceptor MD-2 and are unresponsive to LPS (73, 83, 89). Recent studies demonstrate that intestinal macrophages are also poorly LPS responsive and lack CD14 (90). In this study, we have addressed the regulation of TLR2 signaling by IEC. We have done this through a careful analysis of TLR2 expression in both native IEC and IEC lines. We demonstrate that the normal colonic epithelium and the lamina propria composed of macrophages, lymphocytes, and stromal cells express TLR2, TLR6, and TLR1 mRNA. With respect to TLR2, quantification of expression in colonic epithelial and lamina propria cells from normal or inflamed sites demonstrates relatively low TLR2 expression compared with a TLR2-responsive monocyte cell line. Using immunohistochemistry of intestinal biopsies, Cario and Podolsky (71) demonstrated that normal human IEC express a low level of TLR2 protein. A recent study likewise did not find expression of TLR2 by IEC in inflamed or uninflamed colonic biopsies (74). These data are consistent with our findings in IEC lines by immunofluorescence and flow cytometry which demonstrate low levels of TLR2 on the IEC surface.

Interaction of PAMPs with the extracellular domain of TLR2 occurs on the cell surface and is required for downstream signaling (91). Cario et al. (72) have recently demonstrated that TLR2 is found in a subapical location in polarized T84 cells and traffics to a basolateral location in response to basolateral PGN. However, these studies did not explore the functional consequences of TLR2 signaling in IEC. Our findings demonstrate that IEC are poorly responsive to a variety of TLR2 ligands with respect to proinflammatory gene expression and IL-8 secretion, two outcomes relevant to acute and chronic intestinal inflammation (92, 93, 94). Although the response to certain TLR2 ligands could be restored by transgenic expression of TLR2 and TLR6, IEC remained poorly responsive to bacterial lipopeptide suggesting that, in addition to TLR2 and TLR1, other coreceptors or signaling molecules may be functionally deficient as well. Interestingly, the IEC line most responsive to TLR2 ligands following transfection were Caco-2 cells (Fig. 4B) which resemble small bowel enterocytes and expressed the lowest levels of TLR6 and TLR1 (Fig. 2) (95, 96, 97). These data suggest that there may be differences in expression and function of TLRs along the length of the intestine.

At least one explanation for the absence of TLR2 ligand reactivity by IEC is the low expression of TLR2 protein. This conclusion is supported by the ability to restore TLR2 ligand responsiveness with transgenic expression of TLR2 and TLR6. In addition, our data demonstrate that IEC express high levels of Tollip which is known to inhibit TLR2 signaling through inhibition of IRAK (58, 59, 60). Thus, in vivo, this inhibitory molecule may dampen TLR2 ligand responsiveness. TLR1 cooperates with TLR2 in response to triacylated bacterial lipopeptides (54, 55, 56) but may be inhibitory in the context of mycobacterial and diacylated bacterial lipopeptides (52). We found that TLR1 expression was lowest in inflamed colonic epithelial cells and inflamed lamina propria cells compared with uninflamed tissue (Fig. 1C). Thus, our data suggests that TLR1 may be regulated diversely in inflammation to down-regulate or enhance the response to certain TLR2 ligands.

Finally, recent data has uncovered other functions for TLR2. TLR2 is required for the inflammatory response elicited by necrotic cells (98) and for dendritic cell maturation (99). Studies using TLR2-transfected HEK293 and lung epithelial cells demonstrated production of {beta}-defensins in response to bacterial lipoprotein (100). TLR2 activation leads to killing of intracellular Mycobacterium tuberculosis by macrophages (101). Thus, although we did not find activation of NF-{kappa}B or secretion of IL-8 by IEC in response to TLR2 ligands, there may be other unknown functions of TLRs in the intestinal epithelium. Perhaps the role of TLR2 in the intestinal mucosa is to aid in tissue healing or protection from pathogens through secretion of antimicrobial peptides. Future studies should address the complex regulation of TLR2 and its coreceptors in the intestinal epithelium during inflammation.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants DK02635 and 1 R29 A152266 (to M.T.A.) and HL66436 and AI40275 (to M.A.). Back

2 Address correspondence and reprint requests to Dr. Maria T. Abreu, Inflammatory Bowel Disease Center, Cedars-Sinai Medical Center, 8631 West 3rd Street, Suite 245E, Los Angeles, CA 90048. E-mail address: Maria.Abreu{at}cshs.org Back

3 Abbreviations used in this paper: IEC, intestinal epithelial cell; TLR, Toll-like receptor; PAMP, pathogen-associated molecular pattern; LTA, lipotechoic acid; PGN, peptidoglycan; STF, soluble tuberculosis factor; PSM, phenol soluble modulin; Tollip, Toll inhibitory protein; IRAK, IL-1R-activated kinase; HMEC, human dermal microvessel endothelial cell. Back

Received for publication February 25, 2002. Accepted for publication November 20, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kim, J. M., L. Eckmann, T. C. Savidge, D. C. Lowe, T. Witthoft, M. F. Kagnoff. 1998. Apoptosis of human intestinal epithelial cells after bacterial invasion. J. Clin. Invest. 102:1815.[Medline]
  2. Hecht, G.. 1999. Innate mechanisms of epithelial host defense: spotlight on intestine. Am. J. Physiol. 277:C351.[Abstract/Free Full Text]
  3. Abreu-Martin, M. T., A. Vidrich, D. H. Lynch, S. R. Targan. 1995. Divergent induction of apoptosis and IL-8 secretion in HT-29 cells in response to TNF-{alpha} and ligation of Fas antigen. J. Immunol. 155:4147.[Abstract]
  4. Eckmann, L., H. C. Jung, C. Schurer-Maly, A. Panja, E. Morzycka-Wroblewska, M. F. Kagnoff. 1993. Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8. Gastroenterology 105:1689.[Medline]
  5. Jung, H. C., L. Eckmann, S. K. Yang, A. Panja, J. Fierer, E. Morzycka-Wroblewska, M. F. Kagnoff. 1995. A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion. J. Clin. Invest. 95:55.
  6. Eckmann, L., M. F. Kagnoff, M. T. Falco. 1994. Colonic epithelial cell lines as a source of interleukin-8: stimulation by inflammatory cytokines and bacterial lipopolysaccharide. Immunology 82:505.[Medline]
  7. Savkovic, S. D., A. Koutsouris, G. Hecht. 1996. Attachment of a noninvasive enteric pathogen, enteropathogenic Escherichia coli, to cultured human intestinal epithelial monolayers induces transmigration of neutrophils. Infect. Immun. 64:4480.[Abstract]
  8. Savkovic, S. D., A. Koutsouris, G. Hecht. 1997. Activation of NF-{kappa}B in intestinal epithelial cells by enteropathogenic Escherichia coli. Am. J. Physiol. 273:C1160.
  9. Schuerer-Maly, C. C., L. Eckmann, M. F. Kagnoff, M. T. Falco, F. E. Maly. 1994. Colonic epithelial cell lines as a source of interleukin-8: stimulation by inflammatory cytokines and bacterial lipopolysaccharide. Immunology 81:85.[Medline]
  10. Wick, M. J., J. L. Madara, B. N. Fields, S. J. Normark. 1991. Molecular cross talk between epithelial cells and pathogenic microorganisms. Cell 67:651.[Medline]
  11. Duchmann, R., I. Kaiser, E. Hermann, W. Mayet, K. Ewe, K. H. Meyer zum Buschenfelde. 1995. Tolerance exists towards resident intestinal flora but is broken in active inflammatory bowel disease (IBD). Clin. Exp. Immunol. 102:448.[Medline]
  12. Cohavy, O., D. Bruckner, L. K. Gordon, R. Misra, B. Wei, M. E. Eggena, S. R. Targan, J. Braun. 2000. Colonic bacteria express an ulcerative colitis pANCA-related protein epitope. Infect. Immun. 68:1542.[Abstract/Free Full Text]
  13. Rutgeerts, P., K. Goboes, M. Peeters, M. Hiele, F. Penninckx, R. Aerts, R. Kerremans, G. Vantrappen. 1991. Effect of faecal stream diversion on recurrence of Crohn’s disease in the neoterminal ileum. Lancet 338:771.[Medline]
  14. Janowitz, H. D., E. C. Croen, D. B. Sachar. 1998. The role of the fecal stream in Crohn’s disease: an historical and analytic review. Inflamm. Bowel Dis. 4:29.[Medline]
  15. Sartor, R. B.. 1998. Postoperative recurrence of Crohn’s disease: the enemy is within the fecal stream. Gastroenterology 114:398.[Medline]
  16. Sandborn, W., R. McLeod, D. Jewell. 2000. Pharmacotherapy for inducing and maintaining remission in pouchitis. Cochrane Database Syst. Rev. 2:CD001176.
  17. Sartor, R. B.. 2000. Probiotics in chronic pouchitis: restoring luminal microbial balance. Gastroenterology 119:584.[Medline]
  18. Gionchetti, P., F. Rizzello, A. Venturi, P. Brigidi, D. Matteuzzi, G. Bazzocchi, G. Poggioli, M. Miglioli, M. Campieri. 2000. Oral bacteriotherapy as maintenance treatment in patients with chronic pouchitis: a double-blind, placebo-controlled trial. Gastroenterology 119:305.[Medline]
  19. Rembacken, B. J., A. M. Snelling, P. M. Hawkey, D. M. Chalmers, A. T. Axon. 1999. Non-pathogenic Escherichia coli versus mesalazine for the treatment of ulcerative colitis: a randomised trial. Lancet 354:635.[Medline]
  20. Prantera, C., F. Zannoni, M. L. Scribano, E. Berto, A. Andreoli, A. Kohn, C. Luzi. 1996. An antibiotic regimen for the treatment of active Crohn’s disease: a randomized, controlled clinical trial of metronidazole plus ciprofloxacin. Am. J. Gastroenterol. 91:328.[Medline]
  21. Hulten, K., A. Almashhrawi, F. A. El-Zaatari, D. Y. Graham. 2000. Antibacterial therapy for Crohn’s disease: a review emphasizing therapy directed against mycobacteria. Dig. Dis. Sci. 45:445.[Medline]
  22. Blumberg, R. S., L. J. Saubermann, W. Strober. 2000. Animal models of mucosal inflammation and their relation to human inflammatory bowel disease. Curr. Opin. Immunol. 12:226.
  23. Sellon, R. K., S. Tonkonogy, M. Schultz, L. A. Dieleman, W. Grenther, E. Balish, D. M. Rennick, R. B. Sartor. 1998. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect. Immun. 66:5224.[Abstract/Free Full Text]
  24. Schultz, M., R. B. Sartor. 2000. Probiotics and inflammatory bowel diseases. Am. J. Gastroenterol. 95:S19.[Medline]
  25. Rath, H. C., J. S. Ikeda, H. J. Linde, J. Scholmerich, K. H. Wilson, R. B. Sartor. 1999. Varying cecal bacterial loads influences colitis and gastritis in HLA-B27 transgenic rats. Gastroenterology 116:310.[Medline]
  26. MacDonald, T. T., S. Pettersson. 2000. Bacterial regulation of intestinal immune responses. Inflamm. Bowel Dis. 6:116.[Medline]
  27. French, N., S. Pettersson. 2000. Microbe-host interactions in the alimentary tract: the gateway to understanding inflammatory bowel disease. Gut 47:162.[Free Full Text]
  28. Rath, H. C., M. Schultz, R. Freitag, L. A. Dieleman, F. Li, H. J. Linde, J. Scholmerich, R. B. Sartor. 2001. Different subsets of enteric bacteria induce and perpetuate experimental colitis in rats and mice. Infect. Immun. 69:2277.[Abstract/Free Full Text]
  29. Mushegian, A., R. Medzhitov. 2001. Evolutionary perspective on innate immune recognition. J. Cell Biol. 155:705.[Abstract/Free Full Text]
  30. Akira, S., K. Takeda, T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2:675.[Medline]
  31. Muzio, M., N. Polentarutti, D. Bosisio, M. K. Prahladan, A. Mantovani. 2000. Toll-like receptors: a growing family of immune receptors that are differentially expressed and regulated by different leukocytes. J. Leukocyte Biol. 67:450.[Abstract]
  32. Zhang, F. X., C. J. Kirschning, R. Mancinelli, X. P. Xu, Y. Jin, E. Faure, A. Mantovani, M. Rothe, M. Muzio, M. Arditi. 1999. Bacterial lipopolysaccharide activates nuclear factor-{kappa}B through interleukin-1 signaling mediators in cultured human dermal endothelial cells and mononuclear phagocytes. J. Biol. Chem. 274:7611.[Abstract/Free Full Text]
  33. Xu, Y., X. Tao, B. Shen, T. Horng, R. Medzhitov, J. L. Manley, L. Tong. 2000. Structural basis for signal transduction by the Toll/interleukin-1 receptor domains. Nature 408:111.[Medline]
  34. Medzhitov, R., C. Janeway, Jr. 2000. The Toll receptor family and microbial recognition. Trends Microbiol. 8:452.[Medline]
  35. Wang, Q., R. Dziarski, C. J. Kirschning, M. Muzio, D. Gupta. 2001. Micrococci and peptidoglycan activate TLR2->MyD88->IRAK->TRAF->NIK->IKK->NF-{kappa}B signal transduction pathway that induces transcription of interleukin-8. Infect. Immun. 69:2270.[Abstract/Free Full Text]
  36. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. V. Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, et al 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in TLR4 gene. Science 282:2085.[Abstract/Free Full Text]
  37. Beutler, B.. 2000. TLR4: central component of the sole mammalian LPS sensor. Curr. Opin. Immunol. 12:20.[Medline]
  38. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the LPS gene product. J. Immunol. 162:3749.[Abstract/Free Full Text]
  39. Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, C. J. Kirschning. 1999. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by Toll-like receptor 2. J. Biol. Chem. 274:17406.[Abstract/Free Full Text]
  40. Takeuchi, O., K. Hoshino, T. Kawai, H. Sanjo, H. Takada, T. Ogawa, K. Takeda, S. Akira. 1999. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity 11:443.[Medline]
  41. Yoshimura, A., E. Lien, R. R. Ingalls, E. Tuomanen, R. Dziarski, D. Golenbock. 1999. Cutting edge: recognition of Gram-positive bacterial cell wall components by the innate immune system occurs via Toll-like receptor 2. J. Immunol. 163:1.[Abstract/Free Full Text]
  42. Lien, E., T. J. Sellati, A. Yoshimura, T. H. Flo, G. Rawadi, R. W. Finberg, J. D. Carroll, T. Espevik, R. R. Ingalls, J. D. Radolf, D. T. Golenbock. 1999. Toll-like receptor 2 functions as a pattern recognition receptor for diverse bacterial products. J. Biol. Chem. 274:33419.[Abstract/Free Full Text]
  43. Opitz, B., N. W. Schroder, I. Spreitzer, K. S. Michelsen, C. J. Kirschning, W. Hallatschek, U. Zahringer, T. Hartung, U. B. Gobel, R. R. Schumann. 2001. Toll-like receptor-2 mediates Treponema glycolipid and lipoteichoic acid-induced NF-{kappa}B translocation. J. Biol. Chem. 276:22041.[Abstract/Free Full Text]
  44. Means, T. K., B. W. Jones, A. B. Schromm, B. A. Shurtleff, J. A. Smith, J. Keane, D. T. Golenbock, S. N. Vogel, M. J. Fenton. 2001. Differential effects of a Toll-like receptor antagonist on Mycobacterium tuberculosis-induced macrophage responses. J. Immunol. 166:4074.[Abstract/Free Full Text]
  45. Jones, B. W., T. K. Means, K. A. Heldwein, M. A. Keen, P. J. Hill, J. T. Belisle, M. J. Fenton. 2001. Different Toll-like receptor agonists induce distinct macrophage responses. J. Leukocyte Biol. 69:1036.[Abstract/Free Full Text]
  46. Takeuchi, O., K. Hoshino, S. Akira. 2000. Cutting edge: TLR2-deficient and MyD88-deficient mice are highly susceptible to Staphylococcus aureus infection. J. Immunol. 165:5392.[Abstract/Free Full Text]
  47. Lorenz, E., J. P. Mira, K. L. Cornish, N. C. Arbour, D. A. Schwartz. 2000. A novel polymorphism in the Toll-like receptor 2 gene and its potential association with staphylococcal infection. Infect. Immun. 68:6398.[Abstract/Free Full Text]
  48. Kang, T. J., G. T. Chae. 2001. Detection of Toll-like receptor 2 (TLR2) mutation in the lepromatous leprosy patients. FEMS Immunol. Med. Microbiol. 31:53.[Medline]
  49. Yang, R. B., M. R. Mark, A. Gray, A. Huang, M. H. Xie, M. Zhang, A. Goddard, W. I. Wood, A. L. Gurney, P. J. Godowski. 1998. Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signalling. Nature 395:284.[Medline]
  50. Ozinsky, A., D. M. Underhill, J. D. Fontenot, A. M. Hajjar, K. D. Smith, C. B. Wilson, L. Schroeder, A. Aderem. 2000. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between Toll-like receptors. Proc. Natl. Acad. Sci. USA 97:13766.[Abstract/Free Full Text]
  51. Ozinsky, A., K. D. Smith, D. Hume, D. M. Underhill. 2000. Co-operative induction of pro-inflammatory signaling by Toll-like receptors. J. Endotoxin Res. 6:393.
  52. Hajjar, A. M., D. S. O’Mahony, A. Ozinsky, D. M. Underhill, A. Aderem, S. J. Klebanoff, C. B. Wilson. 2001. Cutting edge: functional interactions between Toll-like receptor (TLR) 2 and TLR1 or TLR6 in response to phenol-soluble modulin. J. Immunol. 166:15.[Abstract/Free Full Text]
  53. Means, T. K., S. Wang, E. Lien, A. Yoshimura, D. T. Golenbock, M. J. Fenton. 1999. Human toll-like receptors mediate cellular activation by Mycobacterium tuberculosis. J. Immunol. 163:3920.[Abstract/Free Full Text]
  54. Takeuchi, O., S. Sato, T. Horiuchi, K. Hoshino, K. Takeda, Z. Dong, R. L. Modlin, S. Akira. 2002. Cutting edge: role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins. J. Immunol. 169:10.[Abstract/Free Full Text]
  55. Wyllie, D. H., E. Kiss-Toth, A. Visintin, S. C. Smith, S. Boussouf, D. M. Segal, G. W. Duff, S. K. Dower. 2000. Evidence for an accessory protein function for Toll-like receptor 1 in anti-bacterial responses. J. Immunol. 165:7125.[Abstract/Free Full Text]
  56. Alexopoulou, L., V. Thomas, M. Schnare, Y. Lobet, J. Anguita, R. T. Schoen, R. Medzhitov, E. Fikrig, R. A. Flavell. 2002. Hyporesponsiveness to vaccination with Borrelia burgdorferi OspA in humans and in TLR1- and TLR2-deficient mice. Nat. Med. 8:878.[Medline]
  57. Spitzer, J. H., A. Visintin, A. Mazzoni, M. N. Kennedy, D. M. Segal. 2002. Toll-like receptor 1 inhibits Toll-like receptor 4 signaling in endothelial cells. Eur. J. Immunol. 32:1182.[Medline]
  58. Burns, K., J. Clatworthy, L. Martin, F. Martinon, C. Plumpton, B. Maschera, A. Lewis, K. Ray, J. Tschopp, F. Volpe. 2000. Tollip, a new component of the IL-1RI pathway, links IRAK to the IL-1 receptor. Nat. Cell Biol. 2:346.[Medline]
  59. Bulut, Y., E. Faure, L. Thomas, O. Equils, M. Arditi. 2001. Cooperation of Toll-like receptor 2 and 6 for cellular activation by soluble tuberculosis factor and Borrelia burgdorferi outer surface protein A lipoprotein: role of Toll-interacting protein and IL-1 receptor signaling molecules in Toll-like receptor 2 signaling. J. Immunol. 167:987.[Abstract/Free Full Text]
  60. Zhang, G., S. Ghosh. 2002. Negative regulation of Toll-like receptor-mediated signaling by Tollip. J. Biol. Chem. 277:7059.[Abstract/Free Full Text]
  61. Dunne, C.. 2001. Adaptation of bacteria to the intestinal niche: probiotics and gut disorder. Inflamm. Bowel Dis. 7:136.[Medline]
  62. Naidu, A. S., W. R. Bidlack, R. A. Clemens. 1999. Probiotic spectra of lactic acid bacteria (LAB). Crit. Rev. Food Sci. Nutr. 39:13.[Medline]
  63. Rolfe, R. D.. 2000. The role of probiotic cultures in the control of gastrointestinal health. J. Nutr. 130:396S.
  64. Pryde, S. E., A. J. Richardson, C. S. Stewart, H. J. Flint. 1999. Molecular analysis of the microbial diversity present in the colonic wall, colonic lumen, and cecal lumen of a pig. Appl. Environ. Microbiol. 65:5372.[Abstract/Free Full Text]
  65. Suau, A., R. Bonnet, M. Sutren, J. J. Godon, G. R. Gibson, M. D. Collins, J. Dore. 1999. Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. Appl. Environ. Microbiol. 65:4799.[Abstract/Free Full Text]
  66. Sartor, R. B., R. A. DeLa Cadena, K. D. Green, A. Stadnicki, S. W. Davis, J. H. Schwab, A. A. Adam, P. Raymond, R. W. Colman. 1996. Selective kallikrein-kinin system activation in inbred rats differentially susceptible to granulomatous enterocolitis. Gastroenterology 110:1467.[Medline]
  67. Kandil, H. M., R. A. Argenzio, R. B. Sartor. 2000. Low endogenous prostaglandin E2 predisposes to relapsing inflammation in experimental rat enterocolitis. Dig. Dis. Sci. 45:2091.[Medline]
  68. Balish, E., T. Warner. 2002. Enterococcus faecalis induces inflammatory bowel disease in interleukin-10 knockout mice. Am. J. Pathol. 160:2253.[Abstract/Free Full Text]
  69. Kim, S. C., S. L. Tonkonogy, E. Balish, R. B. Sartor. 2002. Bacterial antigen specific T-cell activation precedes intestinal inflammation in Enterococcus faecalis monoassociated IL-10 deficient mice. Gastroenterology 122:A692.
  70. Cong, Y., S. L. Brandwein, R. P. McCabe, A. Lazenby, E. H. Birkenmeier, J. P. Sundberg, C. O. Elson. 1998. CD4+ T cells reactive to enteric bacterial antigens in spontaneously colitic C3H/HeJBir mice: increased T helper cell type 1 response and ability to transfer disease. J. Exp. Med. 187:855.[Abstract/Free Full Text]
  71. Cario, E., D. K. Podolsky. 2000. Differential alteration in intestinal epithelial cell expression of Toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect. Immun. 68:7010.[Abstract/Free Full Text]
  72. Cario, E., D. Brown, M. McKee, K. Lynch-Devaney, G. Gerken, D. K. Podolsky. 2002. Commensal-associated molecular patterns induce selective Toll-like receptor-trafficking from apical membrane to cytoplasmic compartments in polarized intestinal epithelium. Am. J. Pathol. 160:165.[Abstract/Free Full Text]
  73. Naik, S., E. J. Kelly, L. Meijer, S. Pettersson, I. R. Sanderson. 2001. Absence of Toll-like receptor 4 explains endotoxin hyporesponsiveness in human intestinal epithelium. J. Pediatr. Gastroenterol. Nutr. 32:449.[Medline]
  74. Hausmann, M., S. Kiessling, S. Mestermann, G. Webb, T. Spottl, T. Andus, J. Scholmerich, H. Herfarth, K. Ray, W. Falk, G. Rogler. 2002. Toll-like receptors 2 and 4 are up-regulated during intestinal inflammation. Gastroenterology 122:1987.[Medline]
  75. Abreu, M. T., A. A. Palladino, E. T. Arnold, R. S. Kwon, J. A. McRoberts. 2000. Modulation of barrier function during Fas-mediated apoptosis in human intestinal epithelial cells. Gastroenterology 119:1524.[Medline]
  76. Dharmsathaphorn, K., J. A. McRoberts, K. G. Mandel, L. D. Tisdale, H. Masui. 1984. A human colonic tumor cell line that maintains vectorial electrolyte transport. Am. J. Physiol. 246:G204.[Abstract/Free Full Text]
  77. Ades, E. W., F. J. Candal, R. A. Swerlick, V. G. George, S. Summers, D. C. Bosse, T. J. Lawley. 1992. HMEC-1: establishment of an immortalized human microvascular endothelial cell line. J. Invest. Dermatol. 99:683.[Medline]
  78. Faure, E., O. Equils, P. A. Sieling, L. Thomas, F. X. Zhang, C. J. Kirschning, N. Polentarutti, M. Muzio, M. Arditi. 2000. Bacterial lipopolysaccharide activates NF-{kappa}B through Toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells: differential expression of TLR-4 and TLR-2 in endothelial cells. J. Biol. Chem. 275:11058.[Abstract/Free Full Text]
  79. Muller, M. R., S. D. Pfannes, M. Ayoub, P. Hoffmann, W. G. Bessler, K. Mittenbuhler. 2001. Immunostimulation by the synthetic lipopeptide P3CSK4: TLR4-independent activation of the ERK1/2 signal transduction pathway in macrophages. Immunology 103:49.[Medline]
  80. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres, G. Hartmann. 2002. Quantitative expression of Toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168:4531.[Abstract/Free Full Text]
  81. Cario, E., I. M. Rosenberg, S. L. Brandwein, P. L. Beck, H. C. Reinecker, D. K. Podolsky. 2000. Lipopolysaccharide activates distinct signaling pathways in intestinal epithelial cell lines expressing Toll-like receptors. J. Immunol. 164:966.[Abstract/Free Full Text]
  82. Faure, E., L. Thomas, H. Xu, A. Medvedev, O. Equils, M. Arditi. 2001. Bacterial lipopolysaccharide and IFN-{gamma} induce Toll-like receptor 2 and Toll-like receptor 4 expression in human endothelial cells: role of NF-{kappa}B activation. J. Immunol. 166:2018.[Abstract/Free Full Text]
  83. Abreu, M. T., P. Vora, E. Faure, L. S. Thomas, E. T. Arnold, M. Arditi. 2001. Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide. J. Immunol. 167:1609.[Abstract/Free Full Text]
  84. Mitsuzawa, H., I. Wada, H. Sano, D. Iwaki, S. Murakami, T. Himi, N. Matsushima, Y. Kuroki. 2001. Extracellular Toll-like receptor 2 region containing Ser40-Ile64 but not Cys30-Ser39 is critical for the recognition of Staphylococcus aureus peptidoglycan. J. Biol. Chem. 276:41350.[Abstract/Free Full Text]
  85. Rescigno, M., M. Urbano, B. Valzasina, M. Francolini, G. Rotta, R. Bonasio, F. Granucci, J. P. Kraehenbuhl, P. Ricciardi-Castagnoli. 2001. Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nat. Immunol. 2:361.[Medline]
  86. Michel, O., A. M. Nagy, M. Schroeven, J. Duchateau, J. Neve, P. Fondu, R. Sergysels. 1997. Dose-response relationship to inhaled endotoxin in normal subjects. Am. J. Respir. Crit. Care Med. 156:1157.[Abstract/Free Full Text]
  87. Rackley, R. R., S. K. Bandyopadhyay, S. Fazeli-Matin, M. S. Shin, R. Appell. 1999. Immunoregulatory potential of urothelium: characterization of NF-{kappa}B signal transduction. J. Urol. 162:1812.[Medline]
  88. Shuto, T., A. Imasato, H. Jono, A. Sakai, H. Xu, T. Watanabe, D. D. Rixter, H. Kai, A. Andalibi, F. Linthicum, et al 2002. Glucocorticoids synergistically enhance nontypeable Haemophilus influenzae-induced Toll-like receptor 2 expression via a negative cross-talk with p38 MAP kinase. J. Biol. Chem. 277:17263.[Abstract/Free Full Text]
  89. Fusunyan, R. D., N. N. Nanthakumar, M. E. Baldeon, W. A. Walker. 2001. Evidence for an innate immune response in the immature human intestine: Toll-like receptors on fetal enterocytes. Pediatr. Res. 49:589.[Medline]
  90. Smith, P. D., L. E. Smythies, M. Mosteller-Barnum, D. A. Sibley, M. W. Russell, M. Merger, M. T. Sellers, J. M. Orenstein, T. Shimada, M. F. Graham, H. Kubagawa. 2001. Intestinal macrophages lack CD14 and CD89 and consequently are down-regulated for LPS- and IgA-mediated activities. J. Immunol. 167:2651.[Abstract/Free Full Text]
  91. Iwaki, D., H. Mitsuzawa, S. Murakami, H. Sano, M. Konishi, T. Akino, Y. Kuroki. 2002. The extracellular Toll-like receptor 2 domain directly binds peptidoglycan derived from Staphylococcus aureus. J. Biol. Chem. 277:24315.[Abstract/Free Full Text]
  92. Daig, R., G. Rogler, E. Aschenbrenner, D. Vogl, W. Falk, V. Gross, J. Scholmerich, T. Andus. 2000. Human intestinal epithelial cells secrete interleukin-1 receptor antagonist and interleukin-8 but not interleukin-1 or interleukin-6. Gut 46:350.[Abstract/Free Full Text]
  93. Nielsen, O. H., P. Gionchetti, M. Ainsworth, B. Vainer, M. Campieri, N. Borregaard, L. Kjeldsen. 1999. Rectal dialysate and fecal concentrations of neutrophil gelatinase-associated lipocalin, interleukin-8, and tumor necrosis factor-{alpha} in ulcerative colitis. Am. J. Gastroenterol. 94:2923.[Medline]
  94. Jobin, C., R. B. Sartor. 2000. NF-{kappa}B signaling proteins as therapeutic targets for inflammatory bowel diseases. Inflamm. Bowel Dis. 6:206.[Medline]
  95. Madara, J. L., K. Dharmsathaphorn. 1985. Occluding junction structure-function relationships in a cultured epithelial monolayer. J. Cell Biol. 101:2124.[Abstract/Free Full Text]
  96. Merlin, D., A. Steel, A. T. Gewirtz, M. Si-Tahar, M. A. Hediger, J. L. Madara. 1998. hPepT1-mediated epithelial transport of bacteria-derived chemotactic peptides enhances neutrophil-epithelial interactions. J. Clin. Invest. 102:2011.[Medline]
  97. Musch, M. W., K. Sugi, D. Straus, E. B. Chang. 1999. Heat-shock protein 72 protects against oxidant-induced injury of barrier function of human colonic epithelial Caco2/bbe cells. Gastroenterology 117:115.[Medline]
  98. Li, M., D. F. Carpio, Y. Zheng, P. Bruzzo, V. Singh, F. Ouaaz, R. M. Medzhitov, A. A. Beg. 2001. An essential role of the NF-{kappa}B/Toll-like receptor pathway in induction of inflammatory and tissue-repair gene expression by necrotic cells. J. Immunol. 166:7128.[Abstract/Free Full Text]
  99. Michelsen, K. S., A. Aicher, M. Mohaupt, T. Hartung, S. Dimmeler, C. J. Kirschning, R. R. Schumann. 2001. The role of Toll-like receptors (TLRs) in bacteria-induced maturation of murine dendritic cells (DCS): peptidoglycan and lipoteichoic acid are inducers of DC maturation and require TLR2. J. Biol. Chem. 276:25680.[Abstract/Free Full Text]
  100. Birchler, T., R. Seibl, K. Buchner, S. Loeliger, R. Seger, J. P. Hossle, A. Aguzzi, R. P. Lauener. 2001. Human Toll-like receptor 2 mediates induction of the antimicrobial peptide human {beta}-defensin 2 in response to bacterial lipoprotein. Eur. J. Immunol. 31:3131.[Medline]
  101. Thoma-Uszynski, S., S. M. Kiertscher, M. T. Ochoa, D. A. Bouis, M. V. Norgard, K. Miyake, P. J. Godowski, M. D. Roth, R. L. Modlin. 2000. Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10. J. Immunol. 165:3804.