| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Inflammatory Bowel Disease Center, Division of Gastroenterology, Department of Medicine,
Division of Pediatric Infectious Diseases, Department of Pediatrics, Steven Spielberg Pediatric Research Center, Burns and Allen Research Institute, and
Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B reporter gene activation and IL-8 secretion. TLR2 protein expression was analyzed by immunofluorescence and flow cytometry. Colonic epithelial cells and lamina propria cells from both uninflamed and inflamed tissue demonstrate low expression of TLR2 mRNA compared with THP-1 monocytes. IECs were unresponsive to TLR2 ligands including the staphylococcal-derived Ags phenol soluble modulin, peptidoglycan, and lipotechoic acid and the mycobacterial-derived Ag soluble tuberculosis factor. Transgenic expression of TLR2 and TLR6 restored responsiveness to phenol soluble modulin and peptidoglycan in IEC. In addition to low levels of TLR2 protein expression, IEC also express high levels of the inhibitory molecule Tollip. We conclude that IEC are broadly unresponsive to TLR2 ligands secondary to deficient expression of TLR2 and TLR6. The relative absence of TLR2 protein expression by IEC and high level of Tollip expression may be important in preventing chronic proinflammatory cytokine secretion in response to commensal Gram-positive bacteria in the gut. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Toll-like receptors (TLRs) are a family of transmembrane receptors homologous to the Drosophila Toll protein (29, 30, 31). These receptors are termed pattern-recognition receptors because they recognize repetitive patterns, i.e., pathogen-associated molecular patterns (PAMPs), present on diverse microbes including Gram-positive and Gram-negative bacteria, fungi, and mycobacteria. TLR ligand recognition occurs via interaction of the extracellular leucine-rich domain of TLR with its PAMP. The interaction of TLR with its PAMP results in activation of multiple intracellular signaling events through its Toll/IL-1R domain, activation of NF-B and the production of cytokines such as the neutrophil chemoattractant IL-8 (32, 33, 34, 35). TLR4 is required for the recognition of LPS and mutations or deletion of TLR4 make animals LPS unresponsive (36, 37, 38). By contrast, TLR2 is required for recognition of Gram-positive and mycobacterial PAMPs including bacterial lipopeptide, lipotechoic acid (LTA), peptidoglycan (PGN), and soluble tuberculosis factor (STF) (39, 40, 41, 42, 43, 44, 45). Mutations in TLR2 are associated with severe mycobacterial, staphylococcal infection and lepromatous leprosy (46, 47, 48). Further studies have shown that combinations of TLR molecules are required for recognition of certain PAMPs. Specifically, combined expression of TLR2 and TLR6 is required for recognition of PGN, yeast cell wall zymosan, and phenol soluble modulin (PSM), a factor secreted by Staphylococcus epidermidis (49, 50, 51, 52, 53). TLR2 in combination with TLR1 recognizes triacylated bacterial lipopeptides (54, 55). Recent studies have demonstrated that both TLR2 and TLR1 signaling are required to generate an immune response to the Borrelia burgdorferi PAMP OspA (56). However, in certain overexpression systems expression of TLR1 inhibited TLR2 or TLR4 signaling (52, 57). Toll inhibitory protein (Tollip), a molecule that interferes with IL-1R-activated kinase (IRAK) signaling, inhibits TLR2 and TLR4 responsiveness and may serve to limit proinflammatory cytokine secretion (58, 59, 60).
Relatively little is known about the role of TLR2 signaling in the intestinal epithelium. A wide variety of bacterial species reside within the human colon (61, 62, 63). Gram-positive aerobes such as Lactobacillus and Streptococcus spp. and Gram-positive anaerobes such as Clostridium spp. account for at least half of the diversity of bacteria in the colon (64, 65). In genetically susceptible rats, intramural injection of PGN results in granulomatous inflammatory bowel disease (66, 67). Animal models of inflammatory bowel disease such as the IL-10 knockout mouse reconstituted with Gram-positive Enterococcus faecalis develop chronic intestinal inflammation (68, 69). Finally, a substrain of C3H/HeJ mice which carry a mutation in the TLR4 gene and are LPS unresponsive develop chronic intestinal inflammation in the presence of commensal bacteria (70). These data suggest that Gram-positive bacteria or their products may play a role in the development or perpetuation of intestinal inflammation in the susceptible host.
Therefore, we wished to understand how the normal intestinal epithelium dealt with continued exposure to commensal Gram-positive bacteria. We hypothesized that IEC are poorly responsive to Gram-positive bacterial cell wall components and other TLR2 ligands. Studies have demonstrated that IEC express TLR2 mRNA but the functional significance of these findings are unclear (71, 72, 73). A recent study using immunohistochemistry demonstrated that lamina propria macrophages express TLR2 and that expression increases with inflammation (74). Expression of TRL2 by IEC is not demonstrated. In the current study, we demonstrate that IEC express low levels of TLR2 mRNA and protein compared with TLR2 ligand-responsive cells and express high levels of the IRAK inhibitor Tollip. Consistent with these observations, IEC are not responsive to a variety of TLR2-specific ligands. Transgenic expression of TLR2 and TLR6 is required for optimal cellular activation in response to these ligands. The results of our studies highlight the potential role of transcriptional regulation of TLR expression and function in specific tissues.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
IEC lines, Caco-2, HT-29, and T84, and the monocyte cell line THP-1 were obtained from the American Type Culture Collection (Rockville, MD). Subconfluent monolayers of these cell lines were kept in a humidified incubator at 37°C with 5% CO2. T84 were cultured on 12-mm transwell polycarbonate membranes (no. 3041; Costar, Cambridge, MA) and maintained in DMEM/F12 (Life Technologies, Gaithersburg, MD) with 5% penicillin/streptomycin (Pen/Strep), 5% L-glutamine, supplemented with 5% FBS, as previously described (75). T84 cells were used between passage number 16 and 35 (76). For experiments in which polarized T84 monolayers were used, transepithelial resistance was measured using a Millipore Millicell-ERS Voltohmeter (Bedford, MA). Experiments were performed when transepithelial resistance was >2000 ohm-cm2. Caco-2 were maintained in MEM (Life Technologies) supplemented with 10% FBS, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, and 5% Pen/Strep. HT-29 were maintained in McCoy’s 5A medium supplemented with 10% FBS and 5% Pen/Strep. THP-1 cells were cultured in RPMI 1640 with 10% FBS, 2 mM L-glutamine, and 5% Pen/Strep. The immortalized human dermal microvessel endothelial cells (HMEC) (a generous gift of Dr. F. J. Candal, Centers for Disease Control and Prevention, Atlanta, GA; Ref.77) were cultured in MCDB-131 medium supplemented with 10% heat-inactivated FBS, 2 mM of glutamine, and 100 µg/ml Pen/Strep in 24-well plates, and used from passages 10 to 14, as described earlier (32, 77, 78).
PGN from Staphylococcus aureus was purchased from Fluka (Buchs, Switzerland) and diluted in PBS. PSM from S. epidermidis was a kind gift of S. Klebanoff (University of Washington, Seattle, WA; Ref.52). STF was a kind gift of Dr. M. Fenton (Boston University School of Medicine, Boston, MA) (45). LTA from S. aureus and S. epidermidis was a kind gift of Dr. J. Mond (Biosynexus, Gaithersburg, MD). The synthetic bacterial lipopeptide palmitoyl-Cys((RS)-2,3-di(palmitoyloxy)-propyl)-Ala-Gly-OH (Pam3-Cys-Ala-Gly-OH) was purchased from Bachem (Torrance, CA) (79). TNF-
was purchased from R&D Systems (Minneapolis, MN).
Expression vectors and cDNA constructs
Endothelial leukocyte adhesion molecule (ELAM)-NF-B luciferase and pCMV-
-galactosidase were used as previously described (32). Human TLR2 cDNA and murine TLR6 were a kind gift of R. Medzhitov (Yale University, New Haven, CT). Human TLR1 plasmid was a gift of D. Segal (National Institutes of Health, Bethesda, MD). Plasmids were prepared with an endotoxin-free Plasmid Maxi-prep kit (Qiagen, Valencia, CA).
Transient gene expression and reporter gene assays
HMEC, Caco-2, or T84 cells were plated at a density of 100,000, 150,000, or 200,000 cells/well, respectively, in 12-well plates 24 h before transfection. HMEC were plated at a concentration of 50,000 cells/well in 24-well plates. Cells were transfected the following day with FuGENE 6 transfection reagent (Roche, Basel, Switzerland) as per the manufacturer’s instructions and as described earlier (32, 78). Reporter genes pCMV--galactosidase, ELAM-NF-B-luciferase (0.4 µg), and pCDNA3 empty vector (0.3–0.6 µg), Flag-tagged wild-type human TLR2 (0.3 µg), or wild-type murine TLR6 (0.3 µg) were cotransfected as indicated in the figure legends. After overnight transfection, cells were stimulated for 5 h with PSM (200 ng/ml), PGN (10 µg/ml), LTA from S. aureus (10 µg/ml), bacterial lipopeptide (100 ng/ml), or STF (2.5 µg/ml). Cells were then lysed in 200 µl of reporter lysis buffer, and luciferase activity was measured with a firefly luciferase kit (Promega, Madison, WI) using a Wallac 1450 Microbeta liquid scintillation counter (PerkinElmer, Wellesley, MA). Data shown are mean ± SD of three or more independent experiments, and are reported as fold-induction over cells transfected with a control vector. Transfection efficiency was determined by assaying for -galactosidase activity using a colorimetric method (Promega) as previously described (32).
RT-PCR and real-time PCR analyses
Total RNA was isolated from T84, Caco-2, HT-29, and HMEC using a Qiagen kit following manufacturer’s instruction and treated with RNase-free DNase I. For the reverse-transcription reaction, the MMLV preamplification system (Invitrogen, Carlsbad, CA; Life Technologies) was used. PCR amplification was performed with Taq Gold polymerase (Perkin-Elmer, Foster City, CA). Amplification of TLR2 was performed using 38 cycles at 95°C for 30 s, 65°C for 30 s, and 72°C for 1 min. The TLR2 forward primer was GCCAAAGTCTTGATTGATTGG and the reverse primer was TATACCACAGGCCATGGAAAC. The -actin forward primer was LB08 GGCTACAGCTTCACCACCACG and the reverse primer LB09 was GCCAGACAGCAGTGTGTTGGC. These primers amplify products that are 150 bp in size. To quantify the level of mRNA expression, RT-PCR products run on a 1% ethidium bromide-stained agarose gel were analyzed on an AlphaImager 2000 densitometer (Alpha Inotech, Wohlen, Switzerland).
Quantitative real-time PCR was conducted for TLR1, TLR2, TLR6, Tollip, and GAPDH using TaqMan probes. TLR1, TLR2, and TLR6 and GAPDH primers were previously published (80). TaqMan probes for Tollip were designed using Primer 3 software (Whitehead Institute for Biomedical Research, Cambridge, MA). A total of 2 µg of RNA was reverse-transcribed using M-MLV RT (Invitrogen). The following conditions were used 50°C for 2 min, 95°C for 10 min, then 45 cycles at 95°C for 15 s, and 60°C for 1 min. Assays were performed following the predeveloped TaqMan assay reagents protocol (Applied Biosystems, Foster City, CA) in an iCycler (Bio-Rad, Hercules, CA). The iCycler Optical System Interface (Bio-Rad) was used to analyze the standards and to quantitate samples (Table I).
|
For human IL-8 ELISA, 10,000 HT-29 cells were plated per well in 96-well plates. Cells were treated with PSM (200 ng/ml), PGN (10 µg/ml), LTA from S. aureus (10 µg/ml), LTA from S. epidermidis (10 µg/ml), bacterial lipopeptide (100 ng/ml), STF (2.5 µg/ml), or TNF- (10 ng/ml) for 18 h and supernatants harvested for measurement of IL-8. IL-8 ELISA (BD Biosciences, Mountain View, CA) were performed as per manufacturer’s instructions.
Flow cytometry and immunofluorescent staining
TLR2 flow cytometry was performed using monoclonal mouse anti-human TLR 2.1 Ab (eBioscience, San Diego, CA) as per manufacturer’s instructions. Briefly, 500,000 cells of HT-29, Caco-2, T84, or THP-1 cells were washed in PBS containing BSA and sodium azide then incubated with TLR2 Ab at a 1/100 dilution for 30 min at 4°C. After washing, FITC-conjugated goat anti-mouse Ab was added and suspension was incubated at 4°C for 30 min. Cells were then fixed in 1% paraformaldehyde at 4°C until analyzed. Negative controls were prepared by incubating with an isotype-matched control Ab. A BD Biosciences flow cytometer was used to analyze cells.
For TLR2 immunofluorescent staining, membranes were fixed in methanol-acetone at room temperature for 5 min, blocked in goat serum-PBS 5% for 1 h, followed by incubation with primary anti-TLR2 Ab (1/50 dilution; eBioscience) and FITC-conjugated anti-mouse Ab (1/64 dilution) (Sigma-Aldrich, St. Louis, MO). Immunofluorescence was visualized with a Leica TCS SP laser scanning inverted confocal microscope (Deerfield, IL). For a given experiment, all images were obtained using the same confocal microscope settings.
Laser capture microscopy
Human intestinal tissue was obtained from patients undergoing colonic resections who consented to having tissue donated for research purposes. This study was reviewed and approved for human subject participation by the Cedars-Sinai Institutional Review Board. The tissue used for this study included uninvolved areas of intestine from patients with colon cancer and paired inflamed and uninflamed areas of colon from patients with ulcerative colitis. After cutting frozen sections, slides were gently fixed in 100% ethanol followed by a light H&E staining. An Arcturus laser capture microscope (Mountain View, CA) was used to microdissect the tissue. Briefly, IEC were identified based on appearance and location, microdissected, and captured on a microfuge cap. The lamina propria was separately microdissected and captured from each intestinal specimen. Photo documentation was obtained before and after dissection. Total RNA was made using the Pico Pure RNA extraction kit (Arcturus) as per manufacturer’s instructions and followed by reverse transcription using random hexamers and Superscript II (Life Technologies).
Statistical analysis
Student’s t tests, SD, and SE were performed using the statistics package within Microsoft Excel (Redmond, WA). Values of p were considered statistically significant when <0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
IEC are in continuous contact with Gram-positive commensal bacteria. Gram-positive bacterial PAMPs including PSM, PGN, and bacterial lipopeptides are recognized by TLR2. We wished to determine whether native colonic epithelial cells and IEC lines expressed TLR2 and its coreceptors TLR1 and TLR6. To address this question, we selectively isolated colonic epithelial cells or lamina propria cells using laser capture microdissection of normal and inflamed human colonic tissue (Fig. 1A) and assayed for the presence of TLR2 mRNA by RT-PCR. TLR2 mRNA was expressed by both native colonic epithelial cells and lamina propria cells (Fig. 1B). To further quantify the level of expression, TLR2, TLR6, and TLR1 mRNA were assessed by real-time PCR using specific TaqMan probes (Fig. 1C). THP-1 cells, a human monocyte line, were used as a positive control for TLR expression. Compared with THP-1 cells, colonic epithelial and lamina propria cells express lower levels of TLR2 mRNA. Cells isolated from inflamed tissue did not demonstrate increased TLR2 or TLR6 expression. TLR1 expression was lower in inflamed colonic epithelial cells and lamina propria cells. These data demonstrate that colonic epithelial cells and lamina propria cells express low levels of TLR2 compared with TLR2 ligand-responsive monocytes.
|
|
Our data demonstrate that IEC lines express TLR2 mRNA. We hypothesized that IEC would be responsive to TLR2 ligands. To test this hypothesis, we measured the ability of the TLR2 ligands PSM, PGN, STF, LTA, and bacterial lipopeptide to activate NF-B transcriptional activity or induce IL-8 secretion in IEC. HMEC expressing a TLR2 transgene were used as a positive control for TLR2 ligand activation (82). IEC lines were poorly responsive to TLR2 ligands (Fig. 3A). Caco-2 cells had a weak response to PSM and PGN (average fold induction, 2.6 (p = 0.04) and 2.0 (p = 0.02), respectively) when compared with unstimulated cells. By contrast, TLR2-transfected HMEC had a robust response to these ligands (average fold induction for three independent experiments performed in triplicate was PSM, 8-fold; PGN, 9-fold; LTA, 6-fold; and STF, 7-fold; p < 0.001). Polarized T84 monolayers were stimulated apically or basolaterally with TLR2 ligands but had no response as measured by NF-B activation to PGN. Bacterial lipopeptide which requires TLR2 and TLR1 did not activate NF-B in T84 or Caco-2 cells (Fig. 3A). We further tested the ability of TLR2 ligands to induce IL-8 secretion from IEC. HT-29 cells were stimulated with PSM, LTA, STF, bacterial lipopeptide, and TNF- (Fig. 3B). HT-29 did not secrete IL-8 in response to TLR2 ligands but secreted IL-8 in response to TNF-. We conclude from these data that despite TLR2 mRNA expression, IEC lines are poorly responsive to TLR2 ligands.
|
TLR2 cooperates with TLR6 for cellular activation by Gram-positive peptidoglycans and PSM and with TLR1 for cellular activation by triacylated bacterial lipopeptides (50, 52, 54, 56, 59). We have previously shown that IEC are functionally deficient in both TLR4 and MD-2 and require both for response to LPS (83). Our data above demonstrate that despite the presence of TLR2 mRNA, IEC are unresponsive to TLR2 ligands. We hypothesized that the reason for TLR2 ligand unresponsiveness was a relative deficiency of TLR2 and/or TLR6 in IEC. To test this hypothesis, we transgenically expressed TLR2 or TLR6 and stimulated cells with the TLR2 ligands, bacterial lipopeptide PSM and PGN. Our results show that TLR2 expression alone was not sufficient to restore TLR2 ligand responsiveness in T84 and Caco-2 cells (Fig. 4, A and B). Neither cell line responded to bacterial lipopeptide despite expression of TLR2 with or without TLR1. However, this preparation of bacterial lipopeptide did induce TNF- secretion by RAW cells, a murine macrophage cell line (data not shown). Expression of TLR6 alone in Caco-2 cells resulted in modest responsiveness to PGN (5-fold over TLR6-transfected unstimulated cells, p = 0.02, for three independent experiments performed in triplicate) (compare column 5 to column 11; Fig. 4B). No significant responses were noted in T84 cells transfected with TLR6 alone (Fig. 4A). Because it has been shown that these ligands require recognition by a heterodimer of TLR2 and TLR6 (51), we hypothesized that transfection of both TLR2 and TLR6 would result in enhanced ligand responsiveness. T84 and Caco-2 cells were transiently transfected with both TLR2 and TLR6 and were stimulated with PSM and PGN. Our data demonstrate that expression of TLR2 and TLR6 resulted in significant activation of NF-B in response to PSM and PGN in both T84 and Caco-2 cells (T84: PSM 3-fold, PGN 8-fold; Caco-2: PSM 6-fold, PGN 18-fold) as compared with unstimulated cells transfected with TLR2 and TLR6. We conclude from these experiments that despite TLR2 and TLR6 mRNA, IEC are functionally deficient in both of these proteins. We further conclude that the remainder of the intracellular signaling pathway from TLR2/TLR6 to NF-B is intact in IEC.
|
Our data above demonstrate that transgenic expression of TLR2 and TLR6 are required to restore TLR2 ligand responsiveness in IEC despite RNA expression of TLR2 and TLR6. Some have demonstrated protein expression of TLR2 by immunohistochemistry in IEC and by Western blotting in T84 cells (71, 72) whereas others have not (74). We reasoned that one explanation for this functional discrepancy in IEC lines is low TLR2 protein expression. To address this question, we performed immunofluorescent staining for the presence of TLR2 in untransfected T84 monolayers and TLR2-responsive THP-1 cells. T84 cells demonstrated weak staining of TLR2 which was predominantly at the cell periphery (Fig. 5A). Using the same confocal microscope settings, THP-1 demonstrated more intense staining with little detectable staining of intracellular compartments. Transfection of TLR2 in T84 cells showed increased TLR2 expression compared with untransfected cells. These data demonstrate that T84 cells express TLR2 protein and the amount of TLR2 protein expressed is increased following transfection.
|
In addition to diminished expression of TLR2, the response to TLR2 ligands may be inhibited by Tollip (58, 59, 60). We hypothesized that an additional mechanism by which IEC may be hyporesponsive to TLR2 ligands may be increased expression of the intracellular IRAK inhibitor Tollip. Therefore, we examined the expression of Tollip in IEC lines (Fig. 5C). All three IEC lines expressed Tollip mRNA. The level of Tollip expression by IEC lines was substantially higher than that seen in TLR2 ligand-responsive THP-1 cells and TLR4 ligand-responsive HMEC. These data suggest that IEC may limit TLR2 ligand responsiveness by overexpression of TLR inhibitory molecules such as Tollip.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We and others have previously demonstrated that IEC express very low levels of TLR4 and its coreceptor MD-2 and are unresponsive to LPS (73, 83, 89). Recent studies demonstrate that intestinal macrophages are also poorly LPS responsive and lack CD14 (90). In this study, we have addressed the regulation of TLR2 signaling by IEC. We have done this through a careful analysis of TLR2 expression in both native IEC and IEC lines. We demonstrate that the normal colonic epithelium and the lamina propria composed of macrophages, lymphocytes, and stromal cells express TLR2, TLR6, and TLR1 mRNA. With respect to TLR2, quantification of expression in colonic epithelial and lamina propria cells from normal or inflamed sites demonstrates relatively low TLR2 expression compared with a TLR2-responsive monocyte cell line. Using immunohistochemistry of intestinal biopsies, Cario and Podolsky (71) demonstrated that normal human IEC express a low level of TLR2 protein. A recent study likewise did not find expression of TLR2 by IEC in inflamed or uninflamed colonic biopsies (74). These data are consistent with our findings in IEC lines by immunofluorescence and flow cytometry which demonstrate low levels of TLR2 on the IEC surface.
Interaction of PAMPs with the extracellular domain of TLR2 occurs on the cell surface and is required for downstream signaling (91). Cario et al. (72) have recently demonstrated that TLR2 is found in a subapical location in polarized T84 cells and traffics to a basolateral location in response to basolateral PGN. However, these studies did not explore the functional consequences of TLR2 signaling in IEC. Our findings demonstrate that IEC are poorly responsive to a variety of TLR2 ligands with respect to proinflammatory gene expression and IL-8 secretion, two outcomes relevant to acute and chronic intestinal inflammation (92, 93, 94). Although the response to certain TLR2 ligands could be restored by transgenic expression of TLR2 and TLR6, IEC remained poorly responsive to bacterial lipopeptide suggesting that, in addition to TLR2 and TLR1, other coreceptors or signaling molecules may be functionally deficient as well. Interestingly, the IEC line most responsive to TLR2 ligands following transfection were Caco-2 cells (Fig. 4B) which resemble small bowel enterocytes and expressed the lowest levels of TLR6 and TLR1 (Fig. 2) (95, 96, 97). These data suggest that there may be differences in expression and function of TLRs along the length of the intestine.
At least one explanation for the absence of TLR2 ligand reactivity by IEC is the low expression of TLR2 protein. This conclusion is supported by the ability to restore TLR2 ligand responsiveness with transgenic expression of TLR2 and TLR6. In addition, our data demonstrate that IEC express high levels of Tollip which is known to inhibit TLR2 signaling through inhibition of IRAK (58, 59, 60). Thus, in vivo, this inhibitory molecule may dampen TLR2 ligand responsiveness. TLR1 cooperates with TLR2 in response to triacylated bacterial lipopeptides (54, 55, 56) but may be inhibitory in the context of mycobacterial and diacylated bacterial lipopeptides (52). We found that TLR1 expression was lowest in inflamed colonic epithelial cells and inflamed lamina propria cells compared with uninflamed tissue (Fig. 1C). Thus, our data suggests that TLR1 may be regulated diversely in inflammation to down-regulate or enhance the response to certain TLR2 ligands.
Finally, recent data has uncovered other functions for TLR2. TLR2 is required for the inflammatory response elicited by necrotic cells (98) and for dendritic cell maturation (99). Studies using TLR2-transfected HEK293 and lung epithelial cells demonstrated production of -defensins in response to bacterial lipoprotein (100). TLR2 activation leads to killing of intracellular Mycobacterium tuberculosis by macrophages (101). Thus, although we did not find activation of NF-B or secretion of IL-8 by IEC in response to TLR2 ligands, there may be other unknown functions of TLRs in the intestinal epithelium. Perhaps the role of TLR2 in the intestinal mucosa is to aid in tissue healing or protection from pathogens through secretion of antimicrobial peptides. Future studies should address the complex regulation of TLR2 and its coreceptors in the intestinal epithelium during inflammation.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Maria T. Abreu, Inflammatory Bowel Disease Center, Cedars-Sinai Medical Center, 8631 West 3rd Street, Suite 245E, Los Angeles, CA 90048. E-mail address: Maria.Abreu{at}cshs.org
3 Abbreviations used in this paper: IEC, intestinal epithelial cell; TLR, Toll-like receptor; PAMP, pathogen-associated molecular pattern; LTA, lipotechoic acid; PGN, peptidoglycan; STF, soluble tuberculosis factor; PSM, phenol soluble modulin; Tollip, Toll inhibitory protein; IRAK, IL-1R-activated kinase; HMEC, human dermal microvessel endothelial cell.
Received for publication February 25, 2002. Accepted for publication November 20, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ligation of Fas antigen. J. Immunol. 155:4147.[Abstract]
B in intestinal epithelial cells by enteropathogenic Escherichia coli. Am. J. Physiol. 273:C1160.
B through interleukin-1 signaling mediators in cultured human dermal endothelial cells and mononuclear phagocytes. J. Biol. Chem. 274:7611.
MyD88IRAKTRAFNIKIKKNF-B signal transduction pathway that induces transcription of interleukin-8. Infect. Immun. 69:2270.B translocation. J. Biol. Chem. 276:22041.B through Toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells: differential expression of TLR-4 and TLR-2 in endothelial cells. J. Biol. Chem. 275:11058.
induce Toll-like receptor 2 and Toll-like receptor 4 expression in human endothelial cells: role of NF-B activation. J. Immunol. 166:2018.B signal transduction. J. Urol. 162:1812.[Medline]
in ulcerative colitis. Am. J. Gastroenterol. 94:2923.[Medline]
B signaling proteins as therapeutic targets for inflammatory bowel diseases. Inflamm. Bowel Dis. 6:206.[Medline]
B/Toll-like receptor pathway in induction of inflammatory and tissue-repair gene expression by necrotic cells. J. Immunol. 166:7128.-defensin 2 in response to bacterial lipoprotein. Eur. J. Immunol. 31:3131.[Medline]
This article has been cited by other articles:
|
|
 |
|
  C. Abraham and J. H. Cho Inflammatory Bowel Disease N. Engl. J. Med., November 19, 2009; 361(21): 2066 - 2078. [Full Text] [PDF]
|
|
|
|
 |
|
 K. Takahashi, Y. Sugi, A. Hosono, and S. Kaminogawa Epigenetic Regulation of TLR4 Gene Expression in Intestinal Epithelial Cells for the Maintenance of Intestinal Homeostasis J. Immunol., November 15, 2009; 183(10): 6522 - 6529. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Piao, C. Song, H. Chen, M. A. Quevedo Diaz, L. M. Wahl, K. A. Fitzgerald, L. Li, and A. E. Medvedev Endotoxin tolerance dysregulates MyD88- and Toll/IL-1R domain-containing adapter inducing IFN-{beta}-dependent pathways and increases expression of negative regulators of TLR signaling J. Leukoc. Biol., October 1, 2009; 86(4): 863 - 875. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Shale and S Ghosh How intestinal epithelial cells tolerise dendritic cells and its relevance to inflammatory bowel disease Gut, September 1, 2009; 58(9): 1291 - 1299. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L Smyth The airway epithelium in health and disease: "calm on the surface, paddling furiously underneath" Thorax, April 1, 2009; 64(4): 277 - 278. [Full Text] [PDF]
|
|
|
|
 |
|
 H. Wu, H. Wang, W. Xiong, S. Chen, H. Tang, and D. Han Expression Patterns and Functions of Toll-Like Receptors in Mouse Sertoli Cells Endocrinology, September 1, 2008; 149(9): 4402 - 4412. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. O. Canny and B. A. McCormick Bacteria in the Intestine, Helpful Residents or Enemies from Within? Infect. Immun., August 1, 2008; 76(8): 3360 - 3373. [Full Text] [PDF]
|
|
|
|
 |
|
 L. Frolova, P. Drastich, P. Rossmann, K. Klimesova, and H. Tlaskalova-Hogenova Expression of Toll-like Receptor 2 (TLR2), TLR4, and CD14 in Biopsy Samples of Patients With Inflammatory Bowel Diseases: Upregulated Expression of TLR2 in Terminal Ileum of Patients With Ulcerative Colitis J. Histochem. Cytochem., March 1, 2008; 56(3): 267 - 274. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Gribar, R. J. Anand, C. P. Sodhi, and D. J. Hackam The role of epithelial Toll-like receptor signaling in the pathogenesis of intestinal inflammation J. Leukoc. Biol., March 1, 2008; 83(3): 493 - 498. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. C. Johnson, X. Li, and E. Pearlman MyD88 Functions as a Negative Regulator of TLR3/TRIF-induced Corneal Inflammation by Inhibiting Activation of c-Jun N-terminal Kinase J. Biol. Chem., February 15, 2008; 283(7): 3988 - 3996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Muthukuru and C. W. Cutler Antigen Capture of Porphyromonas gingivalis by Human Macrophages Is Enhanced but Killing and Antigen Presentation Are Reduced by Endotoxin Tolerance Infect. Immun., February 1, 2008; 76(2): 477 - 485. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Voltan, I. Castagliuolo, M. Elli, S. Longo, P. Brun, R. D'Inca, A. Porzionato, V. Macchi, G. Palu, G. C. Sturniolo, et al. Aggregating Phenotype in Lactobacillus crispatus Determines Intestinal Colonization and TLR2 and TLR4 Modulation in Murine Colonic Mucosa Clin. Vaccine Immunol., September 1, 2007; 14(9): 1138 - 1148. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B.-S. Feng, S.-H. He, P.-Y. Zheng, L. Wu, and P.-C. Yang Mast Cells Play a Crucial Role in Staphylococcus aureus Peptidoglycan-Induced Diarrhea Am. J. Pathol., August 1, 2007; 171(2): 537 - 547. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Sterzenbach, S. K. Lee, B. Brenneke, F. von Goetz, D. B. Schauer, J. G. Fox, S. Suerbaum, and C. Josenhans Inhibitory Effect of Enterohepatic Helicobacter hepaticus on Innate Immune Responses of Mouse Intestinal Epithelial Cells Infect. Immun., June 1, 2007; 75(6): 2717 - 2728. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bogunovic, S. H. Dave, J. S. Tilstra, D. T. W. Chang, N. Harpaz, H. Xiong, L. F. Mayer, and S. E. Plevy Enteroendocrine cells express functional Toll-like receptors Am J Physiol Gastrointest Liver Physiol, June 1, 2007; 292(6): G1770 - G1783. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Karrasch, J.-S. Kim, M. Muhlbauer, S. T. Magness, and C. Jobin Gnotobiotic IL-10-/-;NF-{kappa}BEGFP Mice Reveal the Critical Role of TLR/NF-{kappa}B Signaling in Commensal Bacteria-Induced Colitis J. Immunol., May 15, 2007; 178(10): 6522 - 6532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Zhao, M.-J. Kwon, S. Huang, J. Y. Lee, K. Fukase, N. Inohara, and D. H. Hwang Differential Modulation of Nods Signaling Pathways by Fatty Acids in Human Colonic Epithelial HCT116 Cells J. Biol. Chem., April 20, 2007; 282(16): 11618 - 11628. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Mayer, M. Muehmer, J. Mages, K. Gueinzius, C. Hess, K. Heeg, R. Bals, R. Lang, and A. H. Dalpke Differential Recognition of TLR-Dependent Microbial Ligands in Human Bronchial Epithelial Cells J. Immunol., March 1, 2007; 178(5): 3134 - 3142. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Winkler, D. Ghadimi, J. Schrezenmeir, and J.-P. Kraehenbuhl Molecular and Cellular Basis of Microflora-Host Interactions J. Nutr., March 1, 2007; 137(3): 756S - 772S. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Chen, Z. Ge, J. G. Fox, and D. B. Schauer Disruption of Tight Junctions and Induction of Proinflammatory Cytokine Responses in Colonic Epithelial Cells by Campylobacter jejuni Infect. Immun., December 1, 2006; 74(12): 6581 - 6589. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Riccioli, D. Starace, R. Galli, A. Fuso, S. Scarpa, F. Palombi, P. De Cesaris, E. Ziparo, and A. Filippini Sertoli Cells Initiate Testicular Innate Immune Responses through TLR Activation J. Immunol., November 15, 2006; 177(10): 7122 - 7130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Jilling, D. Simon, J. Lu, F. J. Meng, D. Li, R. Schy, R. B. Thomson, A. Soliman, M. Arditi, and M. S. Caplan The Roles of Bacteria and TLR4 in Rat and Murine Models of Necrotizing Enterocolitis. J. Immunol., September 1, 2006; 177(5): 3273 - 3282. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F.-S. X. Yu and L. D. Hazlett Toll-like Receptors and the Eye. Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1255 - 1263. [Full Text] [PDF]
|
|
|
|
|
|
E. Cario, D. T. Golenbock, A. Visintin, M. Runzi, G. Gerken, and D. K. Podolsky Trypsin-Sensitive Modulation of Intestinal Epithelial MD-2 as Mechanism of Lipopolysaccharide Tolerance J. Immunol., April 1, 2006; 176(7): 4258 - 4266. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chabot, J. S. Wagner, S. Farrant, and M. R. Neutra TLRs Regulate the Gatekeeping Functions of the Intestinal Follicle-Associated Epithelium J. Immunol., April 1, 2006; 176(7): 4275 - 4283. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Hirata, T. Ohmae, W. Shibata, S. Maeda, K. Ogura, H. Yoshida, T. Kawabe, and M. Omata MyD88 and TNF Receptor-Associated Factor 6 Are Critical Signal Transducers in Helicobacter pylori-Infected Human Epithelial Cells J. Immunol., March 15, 2006; 176(6): 3796 - 3803. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Didierlaurent, B. Brissoni, D. Velin, N. Aebi, A. Tardivel, E. Kaslin, J. C. Sirard, G. Angelov, J. Tschopp, and K. Burns Tollip Regulates Proinflammatory Responses to Interleukin-1 and Lipopolysaccharide Mol. Cell. Biol., February 1, 2006; 26(3): 735 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Tyrer, A. R. Foxwell, A. W. Cripps, M. A. Apicella, and J. M. Kyd Microbial Pattern Recognition Receptors Mediate M-Cell Uptake of a Gram-Negative Bacterium Infect. Immun., January 1, 2006; 74(1): 625 - 631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-M. Chen, S. P. O'Hara, J. B. Nelson, P. L. Splinter, A. J. Small, P. S. Tietz, A. H. Limper, and N. F. LaRusso Multiple TLRs Are Expressed in Human Cholangiocytes and Mediate Host Epithelial Defense Responses to Cryptosporidium parvum via Activation of NF-{kappa}B J. Immunol., December 1, 2005; 175(11): 7447 - 7456. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Vinderola, C. Matar, and G. Perdigon Role of Intestinal Epithelial Cells in Immune Effects Mediated by Gram-Positive Probiotic Bacteria: Involvement of Toll-Like Receptors Clin. Vaccine Immunol., September 1, 2005; 12(9): 1075 - 1084. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Fournier and D. J. Philpott Recognition of Staphylococcus aureus by the Innate Immune System Clin. Microbiol. Rev., July 1, 2005; 18(3): 521 - 540. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Tsuchiya, I. Kawamura, A. Takahashi, T. Nomura, C. Kohda, and M. Mitsuyama Listeriolysin O-Induced Membrane Permeation Mediates Persistent Interleukin-6 Production in Caco-2 Cells during Listeria monocytogenes Infection In Vitro Infect. Immun., July 1, 2005; 73(7): 3869 - 3877. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. A. Schneeman, M. E. C. Bruno, H. Schjerven, F.-E. Johansen, L. Chady, and C. S. Kaetzel Regulation of the Polymeric Ig Receptor by Signaling through TLRs 3 and 4: Linking Innate and Adaptive Immune Responses J. Immunol., July 1, 2005; 175(1): 376 - 384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Fukata, K. S. Michelsen, R. Eri, L. S. Thomas, B. Hu, K. Lukasek, C. C. Nast, J. Lechago, R. Xu, Y. Naiki, et al. Toll-like receptor-4 is required for intestinal response to epithelial injury and limiting bacterial translocation in a murine model of acute colitis Am J Physiol Gastrointest Liver Physiol, May 1, 2005; 288(5): G1055 - G1065. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Abreu, M. Fukata, and M. Arditi TLR Signaling in the Gut in Health and Disease J. Immunol., April 15, 2005; 174(8): 4453 - 4460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Ruiz, A. Shkoda, S. C. Kim, R. B. Sartor, and D. Haller IL-10 Gene-Deficient Mice Lack TGF-{beta}/Smad Signaling and Fail to Inhibit Proinflammatory Gene Expression in Intestinal Epithelial Cells after the Colonization with Colitogenic Enterococcus faecalis J. Immunol., March 1, 2005; 174(5): 2990 - 2999. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. I. Singh, S. M. Cruickshank, D. J. Newton, L. Wakenshaw, A. Graham, J. Lan, J. P. A. Lodge, P. J. Felsburg, and S. R. Carding Toll-like receptor-mediated responses of primary intestinal epithelial cells during the development of colitis Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G514 - G524. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Muthukuru, R. Jotwani, and C. W. Cutler Oral Mucosal Endotoxin Tolerance Induction in Chronic Periodontitis Infect. Immun., February 1, 2005; 73(2): 687 - 694. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. Schaefer, J. V. Fahey, J. A. Wright, and C. R. Wira Innate Immunity in the Human Female Reproductive Tract: Antiviral Response of Uterine Epithelial Cells to the TLR3 Agonist Poly(I:C) J. Immunol., January 15, 2005; 174(2): 992 - 1002. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. A. Kurt-Jones, F. Sandor, Y. Ortiz, G. N. Bowen, S. L. Counter, T. C. Wang, and R. W. Finberg Use of murine embryonic fibroblasts to define Toll-like receptor activation and specificity Innate Immunity, December 1, 2004; 10(6): 419 - 424. [Abstract] [PDF]
|
|
|
|
|
|
P. Vora, A. Youdim, L. S. Thomas, M. Fukata, S. Y. Tesfay, K. Lukasek, K. S. Michelsen, A. Wada, T. Hirayama, M. Arditi, et al. {beta}-Defensin-2 Expression Is Regulated by TLR Signaling in Intestinal Epithelial Cells J. Immunol., November 1, 2004; 173(9): 5398 - 5405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kumar, J. Zhang, and F.-S. X. Yu Innate Immune Response of Corneal Epithelial Cells to Staphylococcus aureus Infection: Role of Peptidoglycan in Stimulating Proinflammatory Cytokine Secretion Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3513 - 3522. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Tavener, E. M. Long, S. M. Robbins, K. M. McRae, H. Van Remmen, and P. Kubes Immune Cell Toll-Like Receptor 4 Is Required for Cardiac Myocyte Impairment During Endotoxemia Circ. Res., October 1, 2004; 95(7): 700 - 707. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Hayden and S. Ghosh Signaling to NF-{kappa}B Genes & Dev., September 15, 2004; 18(18): 2195 - 2224. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Armstrong, A. R. L. Medford, K. M. Uppington, J. Robertson, I. R. Witherden, T. D. Tetley, and A. B. Millar Expression of Functional Toll-Like Receptor-2 and -4 on Alveolar Epithelial Cells Am. J. Respir. Cell Mol. Biol., August 1, 2004; 31(2): 241 - 245. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Muir, G. Soong, S. Sokol, B. Reddy, M. I. Gomez, A. van Heeckeren, and A. Prince Toll-Like Receptors in Normal and Cystic Fibrosis Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., June 1, 2004; 30(6): 777 - 783. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Kim, S. J. Lee, and M. F. Kagnoff Nod1 Is an Essential Signal Transducer in Intestinal Epithelial Cells Infected with Bacteria That Avoid Recognition by Toll-Like Receptors Infect. Immun., March 1, 2004; 72(3): 1487 - 1495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Kobayashi and R. A. Flavell Shielding the double-edged sword: negative regulation of the innate immune system J. Leukoc. Biol., March 1, 2004; 75(3): 428 - 433. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kawahara, Y. Kuwano, S. Teshima-Kondo, R. Takeya, H. Sumimoto, K. Kishi, S. Tsunawaki, T. Hirayama, and K. Rokutan Role of Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 in Oxidative Burst Response to Toll-Like Receptor 5 Signaling in Large Intestinal Epithelial Cells J. Immunol., March 1, 2004; 172(5): 3051 - 3058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Monick, T. O. Yarovinsky, L. S. Powers, N. S. Butler, A. B. Carter, G. Gudmundsson, and G. W. Hunninghake Respiratory Syncytial Virus Up-regulates TLR4 and Sensitizes Airway Epithelial Cells to Endotoxin J. Biol. Chem., December 26, 2003; 278(52): 53035 - 53044. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
