The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maruyama, S.
Right arrow Articles by Asano, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maruyama, S.
Right arrow Articles by Asano, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2003, 170: 997-1001.
Copyright © 2003 by The American Association of Immunologists

Identification of IFN Regulatory Factor-1 Binding Site in IL-12 p40 Gene Promoter1

Saho Maruyama*, Kohsuke Sumita*, Hua Shen*, Makoto Kanoh*, Xin Xu2,*, Mitsuharu Sato3,{dagger}, Masahito Matsumoto4,{dagger}, Hiroto Shinomiya* and Yoshihiro Asano5,*

* Department of Immunology and Host Defenses, Ehime University School of Medicine, Shigenobu, Ehime, Japan; and {dagger} Department of Immunology, Graduate School of Medicine, University of Tokyo, Tokyo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-12 is a heterodimer composed of p40 and p35 and is a key cytokine that functions to protect the host from viral and microbial infections. IL-12 links the innate immune system with the acquired immune system during infection, and induces differentiation of type 1 T cells that play an important role in the eradication of microbes. The induction of the IL-12 p40 gene is regulated by NF-{kappa}B in the presence of IFN-{gamma}. IFN-{gamma} induces IFN regulatory factor-1 (IRF-1), which in turn induces the transcription of the IL-12 p40 gene. However, the IRF-1 binding site in the promoter region of the IL-12 p40 gene has not yet been formally determined. In the present study, we demonstrated that IRF-1 directly binds to the IL-12 p40 gene promoter and identified its binding site. The IRF-1 binding site in the promoter region of the IL-12 p40 gene is shown to be in the -72 to -58 area of the 5'-upstream region. The -63 to -61 position is the critical site within this region for the binding of IRF-1 to the IL-12 p40 gene promoter. While IFN-{gamma} must be present for IL-12 p40 gene induction, the p35 gene is strongly induced by LPS, even in the absence of IFN-{gamma}, and therefore the induction of the p35 gene is IRF-1 independent.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-12 is a key cytokine that functions to protect the host from viral and microbial infections (1, 2). IL-12 is a heterodimer composed of p40 and p35. The former is induced by microbial infection, whereas the latter is constitutively expressed (2, 3). Macrophages and NK cells function to link the innate immune system with the acquired immune system during viral or bacterial infection (4, 5, 6, 7). This linkage is mediated mainly by IFN-{gamma} and IL-12. Bacterial stimuli activate macrophages and subsequently NK cells in the innate immune response to produce IL-12 and IFN-{gamma}, respectively (8). IL-12 subsequently induces NK cells to produce IFN-{gamma} (9, 10, 11), which in turn activates macrophages to present Ags to Ag-specific T cells (12). The involvement of IL-12 in type 1 T cell differentiation is well established in many systems (8, 13, 14, 15, 16, 17). This type of innate immune response and its accompanying Ag-specific T cell response work to eradicate microbial pathogens (1, 4, 5).

The induction of the IL-12 p40 gene in macrophages is regulated by NF-{kappa}B in the presence of IFN-{gamma} (3, 18). Signals from IFN-{gamma} receptors are initially transduced by IFN-stimulated gene factor (ISGF)6-3 and IFN-{gamma}-activated factor (GAF). Transcription factors such as IFN regulatory factor-1 (IRF-1) are used for further proper regulation of the broad range of genes induced by IFN, e.g., inducible NO and IL-1{beta} converting enzyme (19, 20, 21, 22). In a previous study, we demonstrated that IRF-1 gene-disrupted mice are defective in inducing IL-12 p40 mRNA, suggesting that gene expression is regulated by transcription factor IRF-1 (23, 24). However, the binding site of IRF-1 to the promoter region of the IL-12 p40 gene has not yet been formally determined. We further analyzed within this study the regulation of IL-12 p40 gene expression and showed that IRF-1 directly binds to the IL-12 p40 gene promoter and up-regulates gene expression. Although IL-12 p35 is thought to be constitutively expressed, we show the IL-12 p35 gene is also inducible by LPS stimulation, even in the absence of IFN-{gamma}, and is regulated differently from the IL-12 p40 gene.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytokines and reagents

Recombinant murine IFN-{gamma} was purchased from Genzyme (Cambridge, MA). Bacterial LPS was purchased from Sigma-Aldrich (Tokyo, Japan). Ab specific for IRF-1 protein was purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Mice

C57BL/6 mice were purchased from Charles River Japan (Yokohama, Japan). IRF-1-deficient mice have been described earlier (25) and were maintained by backcrossing to C57BL/6 mice. ISGF3{gamma}-deficient (p48) mice have been described previously (26). The littermates of each mutant strain were used as control mice. These mutant mice and their littermates were reared under specific pathogen-free conditions in the animal facility of either the University of Tokyo or Ehime University School of Medicine. All mice were used in accordance with our institutional guidelines for animal experimentation.

Culture conditions for cells

Cells were cultured at 37°C in a 5% CO2 humidified air atmosphere. The medium used was RPMI 1640 supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, 1 mM sodium pyruvate, 1-time nonessential amino acid, 50 µM 2-ME, and 10% heat-inactivated FCS.

Isolation and stimulation of peritoneal exudate cells (PECs) for IL-12 induction

PECs taken from mice treated with thioglycolate 3 days earlier were allowed to adhere to tissue culture plates for 1 h, and nonadherent cells were removed. Adherent cells were cultured in the presence of medium alone, LPS (10 µg/ml), or LPS plus recombinant mouse IFN-{gamma} (100 U/ml). Total RNA was extracted 16 h later and subjected to Northern blotting with probes for IL-12 p40 (a gift from Dr. H. Yamamoto, Osaka University) and TNF-{alpha} (a gift from Dr. T. Yokota, University of Tokyo).

RNA isolation and Northern blot analysis

Total cellular RNA was isolated by the guanidinium-thiocyanate method. The procedure for Northern blot analysis is described by Harada et al. (27). To prepare DNA probes, fragments of TNF-{alpha}, IL-12 p35, IL-12 p40, and {beta}-actin cDNA were labeled by the random primer method. The specific activity of the IL-12 p35 probe and that of the IL-12 p40 probe were comparable. The intensity of the band was measured by BAS2000 (Fuji Film, Tokyo, Japan).

DNA transfection and luciferase assay

Cos7 cells were resuspended in 10% FCS-containing RPMI 1640 medium at 1 x 106 cells/ml. Further, 10 µg of plasmid DNA was mixed with Cos7 cells in a 1-ml electrochamber (PKG/36; Life Technologies, Gaithersburg, MD). DNA was electroporated to Cos7 cells at 750 V/cm and 880 µF using the Electroporation System I (Life Technologies). The cells for luciferase assay were harvested 60 h after transfection. The same amount of cell extract was used in each experiment.

Electrophoretic mobility shift analysis

Electrophoretic mobility shift analysis was done as described by Harada et al. (27). A total of 2 µl of in vitro-translated IRF-1 were incubated with a 32P-labeled DNA probe in a buffer containing 10 mM Tris-HCl (pH 7.6), 50 mM NaCl, 1 mM DTT, 1 mM EDTA, and 5% glycerol at 25°C for 60 min. Protein-DNA complexes were analyzed by 4% polyaclylamide gel electrophoresis.

DNase I footprinting assay

A PCR fragment of -133 to +51 in the IL-12 p40 promoter region was labeled with 32P by incubating with T4 kinase and followed by digestion with SacI and HindIII. The sense strand was mixed with rIRF-1 protein and incubated at 30°C for 1 h. The mixture was digested with DNase I (0.2 U/µl) at 25°C for 1 min, treated with phenol, and precipitated with ethanol. The pellet was dissolved in a loading buffer and analyzed on an 8% polyacrylamide-8 M urea gel (28).

Chromatin immunoprecipitation (ChIP) assay

PECs were stimulated with LPS (10 µg/ml) plus recombinant mouse IFN-{gamma} (100 U/ml). At 0 and 2 h later, formaldehyde solution was added directly to the culture at a final concentration of 1%. Cross-linking of proteins on chromatin was allowed to occur at 37°C for 10 min, and the cells were lysed by Nonidet P-40 lysis buffer with protease inhibitors. Chromatin in the lysate was sonicated to an average length of 200–500 bp as determined by agarose gel electrophoresis. IRF-1 protein binding to chromatin was immunoprecipitated, washed, and eluted. Cross-links were reversed by 0.5 M NaCl. After proteinase K digestion, DNA in samples was phenol extracted, ethanol precipitated, and used for PCR amplication to detect IL-12 p40 promoter segment.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Induction of IL-12 p40 mRNA requires IRF-1, whereas that of IL-12 p35 mRNA requires neither IRF-1 nor ISGF3{gamma}

We first examined the requirement of IFN-{gamma} for IL-12 p35 and IL-12 p40 gene expression. Although the IL-12 p40 gene is thought to be inducible and IL-12 p35 gene is constitutively expressed, both genes are induced by stimulation with LPS plus IFN-{gamma} (Fig. 1, A and B). However, the requirement for IFN-{gamma} is distinctly different in the two genes. The induction of IL-12 p40 is minimal in the absence of IFN-{gamma} and is enhanced by the presence of IFN-{gamma}, confirming previous findings (2). In contrast, the effect of IFN-{gamma} on IL-12 p35 gene induction is minimal. Therefore, IL-12 p70 production is profoundly influenced by the presence of IFN-{gamma}.



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 1. IL-12 p40 gene induction is impaired in IRF-1-deficient mice. A, PECs of thioglycolate-treated C57BL/6 mice were stimulated in vitro with medium alone (C), 10 µg/ml LPS (L), 100 U/ml IFN-{gamma} (L), or 10 µg/ml LPS plus 100 U/ml IFN-{gamma} (L+{gamma}). At the indicated period, expression of mRNA IL-12 p40 and IL-12 p35 were evaluated by Northern blot analysis. B, The intensity of the band of IL-12 p35 and p40 mRNA in the presence (•) or absence ({circ}) of IFN-{gamma} was measured by BAS2000. The IL-12 p70 produced was measured by ELISA at the indicated points in time. C, Peritoneal macrophages (PEC) from thioglycolate-treated wild-type (WT) and deficient mice (-/-) of IRF-1 or p48 (ISGF3{gamma}) gene were stimulated in vitro with medium alone (C), 10 µg/ml LPS (L), or 10 µg/ml LPS plus 100 U/ml IFN-{gamma} (L+{gamma}). Expressions of mRNA of TNF-{alpha} and IL-12 p40 gene were detected by Northern blot analysis. Note that treatment of IRF-1-/- macrophages with LPS plus IFN-{gamma} failed to induce IL-12 p40 mRNA, whereas the same treatment induced TNF-{alpha} mRNA in IRF-1-/- macrophages.

 
Because the signal from the IFN-{gamma} receptor is transduced by IRF-1 and ISGF3{gamma} (p48), IL-12 p40 and p35 gene induction with LPS plus IFN-{gamma} was evaluated by Northern blot analysis using thioglycorate-induced peritoneal adherent cells from IRF-1-/- mice, p48-/- mice, and their littermates as wild-type mice (Fig. 1C). Costimulation with LPS and IFN-{gamma} induced the IL-12 p40 gene in wild-type mice, whereas the same stimulation failed to induce the gene in IRF-1-/- mice. Gene induction in p48-/- mice was achieved by costimulation with LPS plus IFN-{gamma}, and the induction level was comparable to their wild-type littermates. This result suggests that IRF-1 but not p48 is responsible for the regulation of the IL-12 p40 gene. In contrast with IL-12 p40 gene induction, neither IRF-1 nor p48 is required for IL-12 p35 gene induction. The result proves that induction of the IL-12 p40 and p35 genes is differentially regulated by IFN-{gamma} via IRF-1 gene induction. The former is IRF-1 dependent and the latter is IRF-1 independent.

IRF-1 up-regulates the transcription of IL-12 p40 gene

To determine the IRF-1 regulatory region of the IL-12 p40 gene, the promoter region in the published DNA sequence at -677 to +51 of the IL-12 p40 gene (18, 29) was obtained by PCR using an IL-12 p40 genomic clone of C57BL/6 origin as a template. The DNA region obtained was inserted into the 5'-upstream region of a luciferase gene lacking the promoter region (basic vector, pLuc) and the reporter plasmid (p40–677-pLuc) was constructed. RAW264.7 cells were transfected with this plasmid. The transfectant was stimulated with LPS plus IFN-{gamma} and the luciferase activity of the cells was measured. As shown in Fig. 2A, the treatment activated the transfectant and resulted in the induction of luciferase activity. This result proved that the chosen promoter region of the IL-12 p40 gene is appropriate for further study. Because it has been shown that the LPS signal required for IL-12 p40 gene activation was mediated by NF-{kappa}B (18), and that the p65 subunit of the NF-{kappa}B complex is a potent transcriptional activator in the apparent absence of the p50 subunit (30), we used a NF-{kappa}B p65 expression plasmid (CMIN-p65, a gift of Dr. Ruben, Roche Institute of Molecular Biology, Nutley, NJ) as a substitute for treatment with LPS. The reporter plasmid containing the IL-12 p40 (p40–677-pLuc) promoter region was electrically transfected to Cos7 cells and luciferase activity was measured. Transfection of the plasmid to Cos7 cells gave baseline enzyme activity. Cotransfection of CMIN-p65 with p40–677-pLuc to Cos7 cells did not augment luciferase activity. On the other hand, cotransfection of IRF-1 expression plasmid (pAct-1, containing actin-promoter and full length of IRF-1 cDNA) with p40–677-pLuc to Cos7 cells augmented the luciferase activity. This augmentation was further enhanced by the copresence of CMIN-p65 (Fig. 2B). These results show that the binding region for IRF-1 is present within the DNA sequence at -677 to +51 of the IL-12 p40 gene.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 2. IRF-1 up-regulates the gene expression of IL-12 p40. A, RAW264.7 cells transfected with IL-12 p40 promoter-inserted expression plasmid of luciferase gene were stimulated with 10 µg/ml LPS plus 100 U/ml IFN-{gamma}. The luciferase activity of the cells was measured and expressed as relative activity. B, The p40–677-pLuc plasmid was transfected to Cos7 cells with or without the expression plasmid of NF-{kappa}B (CMIN-p65) or IRF-1 (pAct-1). The resulting enzyme activity of luciferase was compared with that of the basic vector plasmid (pLuc). C, The p40–133-pLuc plasmid was transfected to Cos7 cells with or without the expression plasmid of IRF-1 (pAct-1). The resulting enzyme activity of luciferase was compared with that of the basic vector plasmid (pLuc).

 
The putative IRF-1 binding site is contained in the published DNA sequence at -75 to -56 in the upstream region of the IL-12 p40 gene (AGTTTCTACTTTGGGTTTCC) (18, 29, 31). The -133 to +51 DNA region of the IL-12 p40 gene (which contains the NF-{kappa}B half site) was obtained by PCR and inserted into the 5'-upstream region of pLuc. The constructed plasmid (p40–133-pLuc) was electrically transfected to Cos7 cells and luciferase activity was measured (Fig. 2C). Cotransfection of pAct-1 with p40–133-pLuc to Cos7 cells augmented the luciferase activity. These results show that the IRF-1 binding site in the IL-12 p40 gene is present in -133 to +51 of the 5'-upstream region of the gene.

The -63 to -61 position of the IL-12 p40 promoter region is critical for the binding of IRF-1 protein

Whether IRF-1 protein binds to the putative IRF-1 binding site of the IL-12 p40 promoter region was directly tested by EMSA. An in vitro-translated IRF-1 protein, which contains a His tag, was incubated with the -133 to -31 region of the IL-12 p40 promoter (which lacks a TATA box), and the resulting solution was applied to the gel. As shown in Fig. 3, the recombinant IRF-1 protein formed a band, and the addition of Ab specific for the His tag of the recombinant IRF-1 altered the electrophoretic mobility of the band. The result shows that IRF-1 binds to the used promoter region of the IL-12 p40 gene.



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 3. rIRF-1 protein binds to IL-12 p40 promoter region. Gel shift analysis was done as described by Harada et al. (27 ). In vitro-translated IRF-1 (containing His tag) was incubated with 32P-labeled -133 to -31 of IL-12 p40 promoter region in a buffer containing 10 mM Tris-HCl (pH 7.6), 50 mM NaCl, 1 mM DTT, 1 mM EDTA, and 5% glycerol. The specificity of the band was confirmed by addition of the Ab specific for His tag on IRF-1 protein.

 
To detect the critical promoter region for IRF-1 function, deleted segments of the promoter region were obtained by PCR and inserted into the 5'-upstream region of the luciferase gene of pLuc after confirming the sequence of the PCR products. Thus constructed plasmids were transfected into Cos7 cells with pAct-1 plasmid and, the luciferase activity of the transfectants was measured (Fig. 4A). The promoter activity was obtained in the -83 to +51 region, partially reduced in the -73 to +51 region, and completely absent in the -63 to +51 region. This result shows that the important DNA segment for IRF-1 promoter activity is present between -83 to -63 of the 5'-upstream region of the IL-12 p40 gene, and consistent with our prediction.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 4. Introduction of mutation in promoter region results in the failure of activating the enzyme. A, The deleted segment of the promoter region was inserted into the luciferase gene. The constructed plasmid was transfected into Cos7 cells together with pAct-1 plasmid. The resulting enzyme activity of luciferase was measured. B, Mutation was introduced in the putative IRF-1 binding sequence (mut-1-promoter, mut-2-promoter, and mut-3-promoter) and inserted upstream of the basic vector of luciferase assay. C, The plasmid containing a mutation at the putative IRF-1 binding site was transfected to Cos7 cells together with the expression plasmid of IRF-1 (pAct-1). The resulting enzyme activity of luciferase was compared with that of the plasmid containing the wild-type sequence (WT). D, The plasmid containing a mutation at the putative IRF-1-binding site was labeled with 32P-labeled, incubated with rIRF-1 protein, and used for gel shift analysis.

 
We accidentally found that the DNA sequence at -63 to -61 of the IL-12 p40 gene is the critical binding site of IRF-1 by introducing point mutation. The wild-type DNA sequence of the promoter region of the p40–133-pLuc plasmid was replaced by three kinds of mutant sequences. The resultant plasmids were subjected to the luciferase assay by cotransfection with an IRF-1-expression plasmid (Fig. 4, B and C). The augmentation of luciferase activity by IRF-1 was observed with plasmid containing a wild-type promoter, while the augmentation was reduced with the promoters containing a mutation. This point was further tested by EMSA using the promoters containing a mutation (Fig. 4D). The result was consistent with that obtained by luciferase assay described previously. These results show that the sequence of the -63 to -61 of the 5'-upstream region is critical for the binding of IRF-1 transcription factor to the promoter of the IL-12 p40 gene.

The position of the actual binding site was further determined by DNase I footprinting assay (Fig. 5A). The -72 to -58 region was protected from DNase I digestion, which demonstrates that this region is the binding site of IRF-1 protein to the IL-12 p40 promoter. Actual binding of IRF-1 to IL-12 p40 promoter of PECs in vivo was demonstrated by ChIP assay. The anti-IRF-1 Ab precipitated the IL-12 p40 promoter region from LPS plus IFN-{gamma}-stimulated PECs (Fig. 5B).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 5. IRF-1 binding to IL-12 p40 promoter fragments. A, DNase I footprinting analysis of the promoter fragments. The 184 bp fragment 32P-labeled at 5'-end containing IL-12 p40 promoter was incubated with recombinant IRF-1 protein. The mixture was subjected to partial digestion by DNase I. The product was fractionated on a denatured 8% polyacrylamide gel. The region that was protected from DNase I digestion is underlined. B, ChIP assay of activated PECs (see Materials and Methods).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The gene expression of IL-12 p40 was induced by stimulation with LPS in macrophages that had been pretreated with IFN-{gamma} (2, 18, 32). IL-12 p40 was shown to be one of the IFN-{gamma}-inducible genes that are activated by a phosphorylated complex, GAF, which consists of dimerized STAT1{alpha} and possibly another DNA binding protein (19, 20). IRF-1 is one of the GAF-activated proteins and has been shown to modulate the cellular response to IFN-{gamma} (19). IL-12 is a heterodimer composed of p40 and p35. The former is induced by microbial infection, whereas the latter is known to be constitutively expressed (2, 3). Although IL-12 p40 gene induction requires costimulation with IFN-{gamma}, the IL-12 p35 gene is rapidly and strongly induced in PECs during bacterial infection even in the absence of IFN-{gamma} (Y. Asano, unpublished observation). Because signals from IFN-{gamma} receptor are transduced by transcription factors, IRF-1 and p48, we assessed the requirement of these transcription factors for IL-12 p40 and p35 genes expression in the present study. We demonstrated that induction of IL-12 p40 and p35 genes is differentially regulated by IFN-{gamma} via IRF-1 but not by p48. IL-12 p40 is IRF-1-dependent and IL-12 p35 is IRF-1-independent.

We analyzed the promoter region required for the regulation by the transcription factor IRF-1. Stimulation of RAW cells transfected with the -677 to +51 region of the IL-12 p40 gene resulted in the induction of luciferase activity. This finding suggested that the transcription factors induced by LPS and IFN-{gamma} bind to this DNA region, and it was further confirmed by cotransfection experiments using NF-{kappa}B and IRF-1 expression plasmids. The cotransfection of CMIN-p65 and pACt-1 induced the luciferase activity in a synergistic manner confirming that a LPS and IFN-{gamma} responsive region is present in this promoter segment. Although IL-12 p40 is barely induced in PECs by stimulation with IFN-{gamma} alone, IRF-1 (pAct-1) augmented the -677 promoter activity of IL-12 p40 in the absence of CMIN-p65 (Fig. 2B). This finding suggests the possibility that the negative regulatory element might be present in the upstream area of the promoter region. Because we found that IRF-1 binds to the promoter region of the IL-12 p40 gene, we further determined the binding site of IRF-1. We showed by an EMSA using the DNA segment at -133 to -31 of the IL-12 p40 promoter region that the important DNA segment for IRF-1 binding is present between -72 to -58 of the 5'-upstream region of the IL-12 p40 gene (Figs. 3 and 5). In addition, we found through the mutation experiment that the DNA sequence at -63 to -61 of IL-12 p40 gene is the critical site for binding of IRF-1 (Fig. 4). This is the first direct demonstration of the binding site of IRF-1 in the promoter region of the IL-12 p40 gene. The copresence of NF-{kappa}B and IRF-1 maximally up-regulates the gene transcription, consistent with the observation of in vitro induction of the gene by LPS plus IFN-{gamma}.

Although we demonstrated the direct binding of IRF-1 protein to the promoter of the mouse IL-12 p40 gene in the present study, the copresence of NF-{kappa}B (CMIN-p65) with IRF-1 (pAct-1) resulted in the maximum augmentation of the promoter activity. It is demonstrated that IRF-1 forms a complex with other nuclear factors during stimulation with IFN-{gamma} or LPS and the complex up-regulates the promoter activity of the human IL-12 p40 gene (33). However, the formation of an IRF-1 complex does not always up-regulate promoter activity. We determined in a previous study that an IRF-1-containing complex was found in the nuclear extract of Plasmodium berghei-infected PECs and the complex bound to the IRF-1-binding motif. The IL-12 p40 transcription and IL-12 p70 production was inhibited in these PECs (34). This finding also suggests the possibility of the presence of a negative regulatory component in the IL-12 p40 promoter region.


    Acknowledgments
 
We thank Dr. Hiroshi Yamamoto, Dr. Takashi Yokota, Taeko Fukuda, and the Genetic Institute for an IL-12 p40 probe, TNF-{alpha} probe, animal care, and recombinant mouse IL-12, respectively. We also thank Dr. Tadatsugu Taniguchi for his warm support.


    Footnotes
 
1 This work was supported in part by a Grant-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan. Back

2 Current address: Division of Clinical Immunology and Rheumatology, Department of Medicine, University of Alabama, Birmingham, AL 35294. Back

3 Current address: Institute of Medical Sciences, University of Tokyo, Tokyo 108-8639, Japan. Back

4 Current address: Second Department of Medical Chemistry, Saitama Medical College, Saitama 350-0495, Japan. Back

5 Address correspondence and reprint requests to Dr. Yoshihiro Asano, Department of Immunology and Host Defenses, Ehime University School of Medicine, Shigenobu, Ehime 791-0295, Japan. E-mail address: asanoy{at}m.ehime-u.ac.jp Back

6 Abbreviations used in this paper: ISGF, IFN-stimulated gene factor; GAF, {gamma}-activated factor; IRF-1, IFN regulatory factor-1; PECs, peritoneal exudate cells; ChIP, chromatin immunoprecipitation. Back

Received for publication July 1, 2002. Accepted for publication November 5, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Scott, P.. 1993. IL12: initiation cytokine for cell-mediated immunity. Science 260:496.[Free Full Text]
  2. Trinchieri, G.. 1998. Interleukin-12: a cytokine at the interface of inflammation and immunity. Adv. Immunol. 70:83.[Medline]
  3. Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13:251.[Medline]
  4. Unanue, E. R.. 1997. Studies in listeriosis show the strong symbiosis between the innate cellular system and the T-cell response. Immunol. Rev. 158:11.[Medline]
  5. Medzhitov, R., C. A. Janeway. 1997. Innate immunity: impact on the adaptive immune response. Curr. Opin. Immunol. 9:4.[Medline]
  6. Revy, P., M. Sospedra, B. Barbour, A. Trautman. 2001. Functional antigen-independent synapses formed between T cells and dendritic cells. Nature Immunol. 2:925.[Medline]
  7. Jankovic, D., A. Sher, G. Yap. 2001. Th1/Th2 effector choice in parasitic infection: decision making by committee. Curr. Opin. Immunol. 13:403.[Medline]
  8. Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, K. M. Murphy. 1993. Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 260:547.[Abstract/Free Full Text]
  9. Afonso, L. C., T. M. Scharton, L. Q. Vieria, M. Wysocka, G. Trinchieri, P. Scott. 1994. The adjuvant effect of interleukin-12 in a vaccine against Leishmania major. Science 263:235.[Abstract/Free Full Text]
  10. Scharton-Kersten, T., L. C. Afonso, M. Wysocka, G. Trichieri, P. Scott. 1995. IL-12 is required for natural killer cell activation and subsequent T helper 1 cell development in experimental leishmaniasis. J. Immunol. 154:5320.[Abstract]
  11. Tripp, C. S., S. F. Wolf, U. R. Unanue. 1993. Interleukin 12 and tumor necrosis factor {alpha} are costimulators of interferon-{gamma} production by natural killer cells in severe combined immunodeficiency mice with listeriosis, and interleukin 10 is a physiologic antagonist. Proc. Natl. Acad. Sci. USA 90:3725.[Abstract/Free Full Text]
  12. Farra, M. A., R. D. Schreiber. 1993. The molecular cell biology of interferon-{gamma} and its receptor. Annu. Rev. Immunol. 11:571.[Medline]
  13. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Medline]
  14. Magram, J.. 1996. IL-12-deficient mice are defective in IFN{gamma} production and type I cytokine responses. Immunity 4:471.[Medline]
  15. Matter, F., F. Mattner, J. Magram, J. Ferrante, P. Launois, K. D. Padova, R. Behin, M. K. Gately, J. A. Louis, G. Alber. 1996. Genetically resistant mice lacking interleukin-12 are susceptible to infection with Leishmania major and mount a polarized Th2 cell response. Eur. J. Immunol. 26:1553.[Medline]
  16. Sher, A., R. L. Coffman. 1992. Regulation of immunity to parasites by T cells and T cell derived cytokines. Annu. Rev. Immunol. 10:385.[Medline]
  17. O’Garra, A.. 1998. Cytokines induce the development of functionally heterogeneous T helper cell subsets. Immunity 8:275.[Medline]
  18. Murphy, T. L., M. G. Cleveland, P. Kulesza, J. Magram, K. M. Murphy. 1995. Regulation of interleukin 12p40 expression through an NF-{kappa}B half-site. Mol. Cell. Biol. 15:5258.[Abstract]
  19. Lamphier, M., T. Taniguchi. 1994. The transcription factors IRF-1 and IRF-2. Immunologist 2:167.
  20. Taniguchi, T.. 1995. Cytokine signal through nonreceptor protein tyrosine kinases. Science 268:251.[Abstract/Free Full Text]
  21. Kamijo, R., H. Harada, T. Matsuyama, M. Bosland, J. Gerecitano, D. Shapiro, J. Le, S. I. Koh, T. Kimura, S. J. Green, et al 1994. Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science 263:1612.[Abstract/Free Full Text]
  22. Tamura, T., M. Ishihara, M. S. Lamphier, N. Tanaka, I. Oishi, S. Aizawa, T. Matsuyama, T. W. Mak, S. Taki, T. Taniguchi. 1995. An IRF-1-dependent pathway of DNA damage-induced apoptosis in mitogen-activated T lymphocytes. Nature 376:596.[Medline]
  23. Taki, S., T. Sato, K. Ogasawara, T. Fukuda, M. Sato, S. Hida, G. Suzuki, M. Mitsuyama, E.-H. Shin, S. Kojima, et al 1997. Multistage regulation of Th1-type immune responses by the transcription factor IRF-1. Immunity 6:673.[Medline]
  24. Feng, C., S. Watanabe, S. Maruyama, G. Suzuki, M. Sato, T. Furuta, S. Kojima, S. Taki, Y. Asano. 1999. An alternative pathway for type 1 T cell differentiation. Int. Immunol. 11:1185.[Abstract/Free Full Text]
  25. Matsuyama, T., T. Kimura, M. Kitagawa, K. Pfeffer, T. Kawakami, N. Watanabe, T. M. Kundig, R. Amakawa, K. Kishihara, A. Wakeham, et al 1993. Targeted disruption of IRF-1 or IRF-2 results in abnormal type I IFN gene induction and aberrant lymphocyte development. Cell 75:83.[Medline]
  26. Kimura, T., Y. Kadokawa, H. Harada, M. Matsumoto, M. Sata, Y. Kashiwazaki, M. Tarutani, R. S. Tan, T. Takasugi, T. Matsuyama, et al 1996. Essential and non redundant roles of p48 (ISGF3{gamma}) and IRF-1 in both type I and type II interferon responses, as revealed by gene targeting studies. Genes Cells 1:115.[Abstract]
  27. Harada, H., T. Fujita, K. Willso, J. Sakakibara, M. Miyamoto, T. Fujita, T. Taniguchi. 1990. Absence of the type I IFN system in EC cells: transcriptional activator (IRF-1) and repressor (IRF-2) genes are developmentally regulated. Cell 63:303.[Medline]
  28. Tagami, H., H. Aiba. 1995. Role of CRP in transcription activation at Escherichia coli lac promoter: CRP is dispensable after the formation of open complex. Nucleic Acids Res. 23:599.[Abstract/Free Full Text]
  29. Yoshimoto, T., K. Kojima, T. Funakoshi, Y. Endo, T. Fujita, H. Nariuchi. 1996. Molecular cloning and characterization of murine IL-12 genes. J. Immunol. 156:1082.[Abstract]
  30. Ruben, S. M., R. Narayanan, J. F. Klement, C. H. Chen, C. A. Rosen. 1992. Functional characterization of the NF-{kappa}B p65 transcriptional activator and an alternatively spliced derivative. Mol. Cell Biol. 12:444.[Abstract/Free Full Text]
  31. Tanaka, N., T. Kawakami, T. Taniguchi. 1993. Recognition DNA sequences of interferon regulatory factor I (IRF-1) and IRF-2, regulators of cell growth and the interferon system. Mol. Cell Biol. 13:4531.[Abstract/Free Full Text]
  32. Ma, X., J. M. Chow, G. Gri, G. Carra, F. Gerosa, S. F. Wolf, R. Dzialo, G. Trinchieri. 1996. The interleukin 12 p40 gene promoter is primed by interferon {gamma} in monocytic cells. J. Exp. Med. 183:147.[Abstract/Free Full Text]
  33. Ma, X., M. Neurah, G. Gri, G. Trinchieri. 1997. Identification and characterization of a novel Ets-2-related nuclear complex implicated in the activation of the human interleukin-12 p40 gene promoter. J. Biol. Chem. 272:10389.[Abstract/Free Full Text]
  34. Xu, X., K. Sumita, C. Feng, X. Xiong, H. Shen, S. Maruyama, M. Kanoh, Y. Asano. 2001. Down-regulation of IL-12 p40 gene in Plasmodium berghei-infected mice. J. Immunol. 167:235.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JEMHome page
A. la Sala, J. He, L. Laricchia-Robbio, S. Gorini, A. Iwasaki, M. Braun, G. S. Yap, A. Sher, K. Ozato, and B. Kelsall
Cholera toxin inhibits IL-12 production and CD8{alpha}+ dendritic cell differentiation by cAMP-mediated inhibition of IRF8 function
J. Exp. Med., June 8, 2009; 206(6): 1227 - 1235.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. Ghisletti, W. Huang, K. Jepsen, C. Benner, G. Hardiman, M. G. Rosenfeld, and C. K. Glass
Cooperative NCoR/SMRT interactions establish a corepressor-based strategy for integration of inflammatory and anti-inflammatory signaling pathways
Genes & Dev., March 15, 2009; 23(6): 681 - 693.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. R. Ciccaglione, E. Stellacci, C. Marcantonio, V. Muto, M. Equestre, G. Marsili, M. Rapicetta, and A. Battistini
Repression of Interferon Regulatory Factor 1 by Hepatitis C Virus Core Protein Results in Inhibition of Antiviral and Immunomodulatory Genes
J. Virol., January 1, 2007; 81(1): 202 - 214.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Xiong, H. Li, H. J. Kong, Y. Chen, J. Zhao, S. Xiong, B. Huang, H. Gu, L. Mayer, K. Ozato, et al.
Ubiquitin-dependent Degradation of Interferon Regulatory Factor-8 Mediated by Cbl Down-regulates Interleukin-12 Expression
J. Biol. Chem., June 24, 2005; 280(25): 23531 - 23539.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Liu, Z. Xiang, and X. Ma
Role of IFN Regulatory Factor-1 and IL-12 in Immunological Resistance to Pathogenesis of N-Methyl-N-Nitrosourea-Induced T Lymphoma
J. Immunol., July 15, 2004; 173(2): 1184 - 1193.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Luo, X. Ma, S. M. Wahl, J. J. Bieker, M. Crossley, and L. J. Montaner
Activation and Repression of Interleukin-12 p40 Transcription by Erythroid Kruppel-like Factor in Macrophages
J. Biol. Chem., April 30, 2004; 279(18): 18451 - 18456.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. Liu, S. Cao, L. M. Herman, and X. Ma
Differential Regulation of Interleukin (IL)-12 p35 and p40 Gene Expression and Interferon (IFN)-{gamma}-primed IL-12 Production by IFN Regulatory Factor 1
J. Exp. Med., October 20, 2003; 198(8): 1265 - 1276.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Zhu, K. Rao, H. Xiong, K. Gagnidze, F. Li, C. Horvath, and S. Plevy
Activation of the Murine Interleukin-12 p40 Promoter by Functional Interactions between NFAT and ICSBP
J. Biol. Chem., October 10, 2003; 278(41): 39372 - 39382.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Cataisson, E. Joseloff, R. Murillas, A. Wang, C. Atwell, S. Torgerson, M. Gerdes, J. Subleski, J.-L. Gao, P. M. Murphy, et al.
Activation of Cutaneous Protein Kinase C{alpha} Induces Keratinocyte Apoptosis and Intraepidermal Inflammation by Independent Signaling Pathways
J. Immunol., September 1, 2003; 171(5): 2703 - 2713.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Cuesta, C. A. Salkowski, K. E. Thomas, and S. N. Vogel
Regulation of Lipopolysaccharide Sensitivity by IFN Regulatory Factor-2
J. Immunol., June 1, 2003; 170(11): 5739 - 5747.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maruyama, S.
Right arrow Articles by Asano, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maruyama, S.
Right arrow Articles by Asano, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS