|
|
||||||||




* Section of Hematology and Oncology and Department of Medicine, Boston Medical Center,
Department of Pathology, Boston University School of Medicine, and
Department of Environmental Health, Boston University School of Public Health, Boston, MA 02118; and
Division of Basic Science, Fox Chase Cancer Center, Philadelphia, PA 19111
| Abstract |
|---|
|
|
|---|
-induced B cell
polarization. These studies suggest that p130Cas and HEF1-associated
AND-34 may regulate B cell adhesion and motility through a
Cdc42-mediated signaling pathway. | Introduction |
|---|
|
|
|---|
Ras and Rho subfamily GTPases alternate between inactive GDP-bound and active GTP-bound conformations. The ratio of GTPases in these two conformations is regulated by GDP exchange factors (GEFs), enzymes that catalyze release of GDP, allowing the more abundant intracellular GTP to bind and activate the GTPase. The majority of Ras and Rho GEFs are identifiable by two types of catalytic domains: a Cdc25-like domain for Ras family GEFs and a Dbl-like domain in tandem with a pleckstrin homology domain for Rho family GEFs (40). Ras and Rho family signaling pathways interact extensively, although the precise mechanisms linking signal transduction by these two families often remains elusive. Significantly, studies with dominant-negative Rho family members have demonstrated that functional Rac and Cdc42 are required for Ras-mediated transformation (6, 7).
Several Ras and Rho subfamily GEFs associate with scaffold proteins that may serve to colocalize molecules or more directly catalyze activation of signaling by physical arrangement of components (8, 9). p130Cas and HEF1 are a structurally related pair of such docking molecules that localize to the focal adhesion complex, assembling members of adhesion and growth factor-related signaling cascades (10, 11). Integrin-mediated adhesion recruits two GEFs to p130Cas: C3G, a Rap1 GEF, and Sos, a protein with both Cdc25 and Dbl GEF domains (12). Integrin signaling also induces formation of a complex of p130Cas, the adapter protein Crk, and a third molecule, DOCK 180, that is required for membrane ruffling, a component of cell migration (13, 14). Overexpression of DOCK 180 induces activation of Rac, and DOCK 180 binds to Rac1, but not RhoA or Cdc42 (15). Significantly, p130Cas promotes cell migration in a process dependent on Rac but not Ras, although the precise mechanism by which p130Cas complexes induce Rac activation remains unclear (16). In contrast, although Cdc42 is also important in both lymphoid polarization and motility, no studies have reported activation of Cdc42 linked to p130Cas complex signal transduction.
We recently cloned a murine cDNA encoding a novel protein, AND-34, whose C terminus has distant homology to a Cdc25 domain (17, 18). In a study in which GTPase-bound 32P-labeled guanine nucleotides were assessed in transfected Cos cells, AND-34 had GDP exchange activity for Ral, and to a lesser extent, Rap1 and R-Ras, but was inactive against H-Ras (19). Immunoprecipitation studies demonstrated that AND-34 associates with a 130-kDa protein that is inducibly tyrosine phosphorylated following serum stimulation. Western analysis identified this protein as p130Cas. Consistent with this association, AND-34 itself is tyrosine phosphorylated following adhesion of epithelial cells (18).Transient transfection with epitope-tagged deletion constructs for AND-34 and p130Cas have demonstrated that the C-terminal GEF domain of AND-34 associates with the C-terminal region of p130Cas (19). Association of AND-34 with HEF1 has not been assessed.
The human homolog of AND-34, BCAR3, was identified by Dorssers and colleagues (20) as a gene whose overexpression results in conversion of anti-estrogen-sensitive breast cancer cell lines to anti-estrogen resistance. Remarkably, a similar genetic analysis by the same group has more recently identified p130Cas as second gene whose overexpression confers anti-estrogen insensitivity (21). Although the physical interaction of BCAR3 and p130Cas has not been assessed in human cells, these studies suggest that these two proteins may function in a signaling pathway that confers independence from estrogen in human breast cancer. BCAR3 (NSP2) is a member of a family of homologous human genes, NSP1, NSP2, and NSP3 (22). NSP1 has also been shown to bind to p130Cas, as has the murine homolog of NSP3, CHAT (23).
Focal adhesion complexes are dynamic cellular structures that undergo disassembly during cellular detachment, mitosis, and apo-ptosis. Interestingly, both p130Cas and HEF1 have also been shown to undergo regulated proteolysis during these events. During mitosis, a relatively stable N-terminal 55-kDa form of HEF1 is generated, a process that is abrogated upon mutation of a candidate caspase cleavage site at aa 360 to 363 from DLVD to DLVA (24). Remarkably, HEF1s N-terminal 55-kDa fragment remains relatively stable during this process and associates with the mitotic spindle (24). During mitosis, less stable C-terminal 65- and 28-kDa fragments of HEF1 are also generated, the latter (p28) thought to be the result of caspase cleavage at a conserved DDYD site at aa 627 to 630 (25). p55, p65, and p28 can also be detected during cellular apoptosis (25). Overexpression of HEF1 in MCF-7 or HeLa cells induces apoptosis, and the death-promoting activity of HEF1 has been mapped to p28 (25). p130Cas has also been shown to undergo caspase-mediated proteolysis during apoptosis (26, 27). Finally, HEF1 undergoes proteolytic cleavage, generating at least the p28 fragment, in response to cellular detachment, a process that is prevented by integrin receptor ligation (28). The p28 HEF1 fragment formed following cellular detachment is itself capable of inducing cellular rounding when overexpressed (28). Studies of the C termini of p130Cas and HEF1 suggest that this region of these proteins is also important for their association with focal adhesions (28, 29).
In this study, we have investigated the expression and function of
AND-34 in the B lineage. We find that AND-34 is expressed in B
lymphocytes and that its expression is regulated by signaling through
the B cell receptor (BCR). AND-34 binds to B cell HEF1 and to
the HEF1 p28 fragment by its GEF domain. Unexpectedly, we observed
activation of Cdc42 in B cells overexpressing AND-34, as well as PAK1
autophosphorylation and inhibition of stromal cell-derived factor
(SDF)-1
-induced B cell polarization. Our work suggests that AND-34
may join the list of P130Cas and HEF1-associated proteins regulating
lymphoid cell motility and adhesion.
| Materials and Methods |
|---|
|
|
|---|
The murine B cell lines WEHI-231 and Bal17 were used to assess endogenous AND-34. Mouse primary splenic B cells and T cells were prepared from Balb/c mice using negative selection with commercial available magnetic beads (Miltenyi Biotec, Auburn, CA). Mouse thymocytes were obtained by gentle mechanical dissociation of thymii from young mice. The purity of the cell populations obtained was verified by flow cytometry using fluorescent-conjugated Abs to CD3 and CD19 (BD PharMingen, San Diego, CA). S194 cells were a gift from Dr. B. Nikolajczyk (Department of Medicine, Boston Medical Center, Boston University School of Medicine, Boston, MA). B cell lines were maintained in RPMI 1640 medium containing 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 10 µM 2-ME. When grown in serum-free conditions, cells were maintained in X-VIVO 20 medium (BioWhittaker, Walkersville, MD). Human embryonic kidney (HEK) 293 cells, a mesenchymal HEK cell line, were used to perform the domain association analysis of AND-34 and HEF1.
Antibodies
The following Abs were used in this study: mouse anti-HA
(Covance, Richmond, CA), mouse anti-p130Cas (Transduction
Laboratories, Lexington, KY), mouse anti-
tubulin (clone
B-5-1-2; Sigma-Aldrich, St. Louis, MO), rabbit anti-myc
(Upstate Biotechnology, Lake Placid, NY), mouse anti-Rac,
anti-Cdc42, anti-RalA, and anti-Rap-1 (Transduction
Laboratories), rabbit anti-Rho (Upstate Biotechnology), rabbit
anti-PAK1 (Santa Cruz Biotechnology, Santa Cruz, CA), and rabbit
anti-phospho-PAK1 (Ser 199/204) specific (Cell
Signaling, Beverly, MA). Both the polyclonalrabbit
anti-AND-34 and anti-HEF1 Abs have been previously described
(18, 24).
Plasmid constructs
The generation of full-length, hemagglutinin (HA)-tagged
HEF1 has been previously described (31). pcDNA3-HA55
contains the N-terminal fragment (363 aa) of HEF1 with an HA tag at its
N terminus (25). PSRR-65 contains the C-terminal portion
of HEF1 (aa 351 to 835) which can be detected by the anti-p130Cas
Ab used in this study (25). The p28-myc-His construct
contains the HEF1 C terminus (aa 626 to 835) which can be detected by
anti-myc (25). The full-length HA-AND-34,
myc-AND-34, and AND-34 deletion mutants
SH2/Pro,
GEF, and
SH2/750 have been previously described (19). The
full-length p130Cas construct was a kind gift from Drs. T. Nakamoto and
H. Hirai (University of Tokyo, Tokyo, Japan) (32).
The p130Cas truncation mutants 775968 and 833968 were generated by
PCR using full-length p130Cas as a template. The PCR products were
cloned into a previously described pcDNA1 vector that included a Kozak
consensus sequence, a start codon, and a 12-aa HA epitope
(33).
AND-34/IRES/GFP murine stem cell virus (MSCV) construct and retroviral transduction
Murine HA-AND-34 was subcloned by PCR into the Xho and R1 sites of the retroviral vector pMSCV-IRES-GFP, a construct that contains a multiple cloning site followed by an internal ribosome entry site sequence and hGFP. The following oligonucleotides were utilized: 5'MSCVXhoGAGCTCGAGTTACCATGGCCTTACCCCTACG and 3'MSCV-R1 TTGAATTCTCACAGCTCGGCCTGCTTT. The PCR resulted in a single band in agarose gels which was subsequently isolated (QuiexII; Qiagen, Valencia, CA), cleaved with Xho and EcoRI, and cloned into pMSCV-IRES-GFP. Retroviral-mediated gene transfer was performed as previously described (34). BOSC cells were transiently cotransfected with pCL-Eco packaging plasmid and pMSCV-IRES-GFP or pMSCV-HA-AND-34-IRES-GFP (35). The medium was changed at 24 and 48 h after transfection. At 72 h the medium was collected, filtered through a 0.22-µm filter (Costar, Cambridge, MA), and 1.25 µg/ml of polybrene (American Bioanalytical, Natick, MA) was added. WEHI-231 or S194 cells were cultured for 1620 h with the retrovirus and polybrene-containing media, followed by culture in fresh media. Cells were utilized for experiments within 23 days of infection. Transduction efficiencies were determined by analyzing cells for GFP positivity using a FACScan flow cytometer.
Transient transfection
Plasmids were transfected into Bosc or HEK 293 cells using Fugene reagent (Roche Diagnostics, Indianapolis, IN). Briefly, HEK 293 cells were grown to 50% confluence in 6-well cell culture plates. A total of 100 µl FCS-free DMEM medium was mixed with 3 or 6 µl Fugene reagent and left at room temperature for 5 min. Then, 1 or 2 µg of constructs were added into the Fugene solution and maintained at room temperature for additional 15 min before adding the final mixture into cell cultures. Fresh medium was added into the cell culture on the second day and whole-cell lysates were collected 48 h after transfection.
Immunoprecipitation and Western blot analysis
Western blot analysis was performed as previously described (19). Briefly, cells were lysed in Nonidet P-40 (NP40) buffer (0.1% NP40, 200 mM NaCl, 50 mM TrisCl (pH 7.4), 1 mM NaVO4, and protease inhibitors). After centrifugation at 14,000 rpm (relative centrifugal force = 16,000) for 5 min, the supernatants were collected. The AND-34 or HEF1/p130Cas protein from 250 to 500 µg of whole-cell lysate was immunoprecipitated with 2 µg Ab for 2 h. Five microliters of protein A/G agarose beads were added and incubated for an additional 2 h. The beads were washed three times with lysis buffer. Proteins were released from the beads by boiling in protein sample buffer for 5 min and separated on a SDS-PAGE gel. After transfer to a nitrocellulose membrane, Western blots were developed by ECL following the vendors protocol (Pierce, Rockford, IL).
GTPase activation assays
The levels of activated Rap-1, Ral A, Rac, Cdc42, and Rho were
determined by "pulldown" analysis. The technique for the pulldown
analysis has been previously described (36). Cells
transduced with control retrovirus and cells transduced with the
HA-AND34 retrovirus were cultured in serum-free medium for 24 h. In
all pulldown assays except that for Rho, 1215 million cells were
harvested in lysis buffer (50 mM TrisCl (pH 7.2), 200 mM NaCl, 5 mM
MgCl2, 1% NP40, 10% glycerol, and protease inhibitors).
For Rho pulldowns, lysis buffer consisted of 50 mM TrisCl (pH 7.2), 1%
Triton X-100, 0.5% deoxycholic acid, 0.1% SDS, 500 mM NaCl, and 10 mM
MgCl2. Whole-cell lysate was incubated for 2 h with 6
µl of glutathione sepharose 4B beads preassociated with 6 µg
GST-PAK for Rac and Cdc42 assay, GST-rhotekin-RBD for Rho assay,
GST-RalGDS for Rap-1 assay, and GST-RalBP-1 for Ral assay. The
GST-PAK-RBD protein was constructed by subcloning aa 70 to 149 of rat
PAK1 (National Center for Biotechnology Information accession
no. P35465) into the BamH1 and Sal1 sites of pGEX
(Amersham Pharmacia Biotech, Piscataway, NJ) and was a kind gift of Dr.
Z. Luo (Section of Endocrinology, Boston Medical Center, Boston
University School of Medicine). The GST-Rhotekin-RBD construct was
generously provided by Drs. X. Ren and M. Schwartz (Department of
Vascular Biology, Scripps Research Institute, La Jolla, CA). In
all pulldown assays except that for Rho, the beads were washed three
times with cell lysis buffer and GTP-bound GTPases were released from
the beads by addition of 1x protein sample buffer and boiling for 5
min. For Rho pulldowns, wash buffer consisted of 1% Triton X-100, 150
mM NaCl, and 10 mM MgCl2. The released GTPases were then
detected by Western blot analysis. For the GTP
S pulldown, before
addition of the conjugated beads, whole-cell lysates were treated with
100 µM GTP
S (Sigma-Aldrich) for 10 min at 30°C.
PAK1 kinase and autophosphorylation assay
Control and HA-AND34-transduced WEHI-231 cells were harvested in
NP40 lysis buffer. PAK1 was immunoprecipitated from whole-cell lysate
with 2 µg of anti-PAK1 Ab for 2 h, followed by further
incubation with 5 µl of protein A/G agarose beads for an additional
2 h. The beads were washed twice with NP40 lysis buffer and two
times with PAK kinase buffer (25 mM TrisCl (pH 7.4), 50 mM NaCl, 5 mM
MgCl2, and 1 mM DTT). The kinase reaction was initiated by
the addition of 1 µg myelin basic protein (MBP) as a substrate
followed by addition of 10 µCi of [
-32P] ATP and 100
µM cold ATP. The reaction was carried out at 30°C for 30 min and
was terminated by adding 2x protein sample buffer and boiling for 5
min. Proteins were separated in a 12% SDS-PAGE gel and transferred
onto a polyvinylidene fluoride membrane. The phosphorylated MBP
were detected by autoradiography. For the PAK autophosphorylation
assay, endogenous PAK1 was immunoprecipitated from whole-cell lysates
of transduced WEHI-231 cells as described above. Lysate protein was
separated on a 9% SDS-PAGE gel and transferred onto a nitrocellulose
membrane. The membrane was blotted with anti-phospho-PAK1
(Ser199/204)-specific polyclonal Ab (Cell Signaling).
Actin staining
Retrovirally transduced WEHI-231 were stained for F-actin as described (37). Cells were fixed in 3.7% formaldehyde in PBS for 10 min, washed twice with PBS, and permeabilized with 0.1% Triton X-100 in PBS for 5 min at room temperature. The cells were then incubated with 5 U of Alexa594-phalloidin (Molecular Probes, Eugene, OR) for 20 min at room temperature. Cells were washed twice with PBS, examined with a Nikon Diaphot fluorescent microscope (Nikon, Melville, NY), and photographed with a Hamamatsu digital camera (Hamamatsu Photonics, Hamamatsu City, Japan).
Polarization assay
One million cells were cultured for 1 h on 24-well
tissue culture plates (Costar) coated with 20 µg/ml fibronectin.
Cells were then treated with 100 ng/ml of SDF-1
(R&D Systems) for 30
min, fixed with 3.7% formaldehyde/PBS, washed once with PBS, counted,
and photographed using an inverted light microscope. Eight different
fields were counted and the percentage of polarized cells in each field
was calculated according to the following formula: % polarized
cells = (polarized cell number/total cell number) x 100.
Polarization was scored according to the criteria of Wilkinson
(38).
Statistical analysis
Data are reported as means ± SE. Comparisons between multiple groups were performed using single factor ANOVA and secondary comparisons were performed using the Tukey test. Statistical analysis was performed using the SPSS statistical software package (SPSS, Chicago, IL).
| Results |
|---|
|
|
|---|
As our prior studies demonstrated expression of AND-34 transcript in murine spleen and lymph node, we sought to determine whether AND-34 transcripts were regulated by physiologic signaling in murine B cell lines (18). In the immature B cell line WEHI-231, cross-linking of sIgM increased AND-34 transcript levels 2 h after stimulation (Fig. 1A). Similarly, cross-linking of sIgM in the more mature B cell line Bal17 augmented AND-34 transcript levels within 3 h (Fig. 1B). Constitutive AND-34 transcript was detected in both lines and was not altered within the first hour after anti-IgM treatment.
|
|
In prior studies of epithelial and stromal cells, we found association of AND-34 with the docking protein p130Cas. As B cells are reported to express both p130Cas and HEF1, we next determined whether B cell AND-34 associated with either of these proteins. Lysates derived from Bal17 cells were immunoprecipitated with anti-AND34 antisera, followed by immunoblotting with either monoclonal anti-p130Cas or polyclonal anti-HEF1 Abs. The mAb used to detect p130Cas was raised against a C-terminal peptide known to be conserved in HEF1, therefore, it is reactive with both proteins. In contrast, the HEF1 Ab was raised against a peptide specific to HEF1, and is not cross-reactive (24). Immunoprecipitates from Bal17 lysates contained both 130- and 115-kDa species reactive with the anti-p130Cas Ab, consistent with the hypothesis that AND-34 associates with both a 130 kD p130Cas species and a 115 kD HEF1 species in this B cell line (Fig. 3A, left lane). The 115-kDa but not the 130-kDa species contained in anti-AND-34 Bal17 immunoprecipitates was reactive with anti-HEF1 (Fig. 3A, right lane). In agreement with these results, anti-p130Cas immunoprecipitates of primary splenic B cells (Fig. 2B, right panel) or Bal17 cells (Fig. 3B) but not splenic T cells (Fig. 2B) enriched a 95-kDa protein immunoreactive with anti-AND-34 antisera which comigrated with the immunoreactive species detected in whole-cell lysates.
|
|
|
To determine which AND-34 domain associates with HEF1, HEK 293
cells were transfected with p65 along with HA-tagged AND-34 deletion
mutants containing the Src homology (SH)2 domain and the
adjacent proline-rich region (
GEF), the GEF domain and an adjacent
amino-terminal region (
SH2/Pro), or the proline-rich region and a
truncated GEF domain (
SH2/750) (Fig. 4A). After
immunoprecipitation with anti-HA Ab, only the AND-34 construct
containing the full GEF domain in conjunction with a small region of
flanking N-terminal sequence (
SH2/Pro) was found to associate with
the p65 HEF1 peptide (Fig. 5E). Thus, again in keeping with
our previous results assessing the association of AND-34 with p130Cas,
truncation of as few as 70 aa from the C terminus of the AND-34 GEF
domain abrogates its association with p65 HEF1.
Following treatment of human breast carcinoma cell lines with apoptotic
stimuli, HEF1 is cleaved by caspases to generate a 28-kDa fragment
(p28) encompassing aa 630834 (25). To determine whether
this fragment associates with AND-34, HEK 293 cells were transfected
with a HA-tagged construct expressing the GEF domain of AND-34
(
SH2/Pro) along with myc-tagged p28 HEF1.
Anti-myc immunoprecipitates contained HA-
SH2/Pro/AND-34
(Fig. 5F) and anti-HA immunoprecipitates contained
myc-tagged p28-HEF1 (Fig. 5G), demonstrating that
the C-terminal 28-kDa portion of HEF1 binds to the C-terminal GEF
domain of AND-34.
In prior studies, we have demonstrated that AND-34 associates with the C-terminal 330 residues of p130Cas (638968; numbering according to Sakai and colleagues, Refs. 32 and 39) (19). To delineate further the minimal domain required for association of p130Cas with AND-34, we engineered three further p130Cas truncation mutants (Fig. 4C) containing the C-terminal 193 (Cas775; 775968), 135 (Cas833; 833968), or 67 aa residues (Cas901; 901968). While transfection of the Cas901 construct failed to yield a detectable HA-tagged protein, perhaps because of instability (data not shown), both Cas775 and Cas833 produced HA-tagged proteins of the appropriate size (Fig. 5H, left panel). After transfection of each of these constructs in conjunction with myc-tagged full-length AND-34, anti-myc immunoprecipitates contained the HA-tagged p130Cas truncation mutants, demonstrating that no more than the C-terminal 135 aa of p130Cas are required for association with AND-34 (Fig. 5H, right panel).
AND-34 overexpression in B cells activates endogenous Cdc42
To examine the effect of overexpression of AND-34 in murine B cells, WEHI-231 and S194 cells, a nonsecreting plasmacytoma cell line, were transduced with a MSCV retrovirus that drives expression of both GFP and HA-tagged AND-34 (AND-34 RV). As a control, cells were transduced with the same retrovirus expressing GFP only (CT RV). As judged by flow cytometry analysis, the transduction efficiencies were >95% for CT RV and >75% for AND-34 RV (Fig. 6A) for WEHI-231 cells. The reduced GFP fluorescence observed in AND-34 RV-transduced cells is likely to be due to the insertion of the HA-AND-34 open reading frame 5' of the GFP open reading frame. S194 cells showed comparable transduction efficiencies by flow cytometry (data not shown). Western blot analysis confirmed expression of HA-AND-34 in AND-34 RV-transduced WEHI-231 cells (Fig. 6B). Hoechst 33342 staining of live cells showed no significant difference in the cell cycle profile of either CT RV or AND-34 RV-transduced cells (data not shown).
|
Since activation of Cdc42, a member of the Rho subfamily of small
GTPases, results in formation of F-actin-rich filopodia
(4), we performed "pulldown assays" to determine
whether AND-34 overexpression activated endogenous Rho family GTPases
in WEHI-231 cells. We used a GST-PAK-RBD construct and a GST-Rhotekin
construct to selectively isolate the GTP-bound forms of endogenous
Cdc42 and Rac, or Rho, respectively. Significantly higher levels of
GTP-bound Cdc42 (Fig. 7A,
right panel) but not Rac (Fig. 7B, right
panel) or Rho (Fig. 7C, right panel) were
present in AND-34 RV-transduced WEHI-231 cells than in CT RV-transduced
cells. Consistent with these results, AND-34 overexpression augmented
levels of GTP-bound Cdc42 but not Rac (Fig. 7F, right
panel, and data not shown) in S194 cells as well (Fig. 7F). Of note, levels of GTP-bound Rac were constitutively
high in murine B cell lines, reducing the sensitivity of this assay to
detect AND-34-mediated Rac activation. When control whole-cell lysates
were first incubated with GTP-
-S, a nonhydrolyzable analog of GTP,
for 10 min at 30°C, high levels of GTP-bound GTPases were detected,
confirming the ability of the chimeric proteins used in these assays to
detect activated GTPases (Fig. 7, AC,
left panel).
|
-S demonstrated the
ability of the assay to detect endogenous GTP-bound RalA and Rap-1
(Fig. 7, D and E, left panel). R-Ras
was not examined, as pulldown assays specific for this GTPase are not
currently available. In summary, these results suggest that AND-34
overexpression in murine B cell lines can result in activation of
endogenous Cdc42, but not of Rac, Rho, RalA, or Rap-1.
AND-34 overexpression in B cells activates PAK1 and blocks
SDF
-induced cell polarization
Cdc42 and Rac are known to activate the p21-activated serine/threonine kinase PAK1 by binding to a PAK1 CRIB domain, resulting in PAK1 autophosphorylation at serines 199 and 204 (40). To examine whether AND-34 overexpression activated endogenous lymphoid PAK1, this enzyme was immunoprecipitated from AND-34-RV and CT-RV-transduced WEHI-231 cells and immunoblotted with a Ser199/204-phosphospecific Ab. As shown in Fig. 8A, overexpression of AND-34 augmented the levels of endogenous PAK1 autophosphorylated at serines 199 and/or 204. As a control, immunoblotting of the immunoprecipitates with a PAK1-specific Ab confirmed comparable levels of PAK1 in the AND-34 RV and CT RV samples (Fig. 8B). Autophosphorylation of PAK1 results in activation of its kinase activity (40). To determine whether AND-34 augments PAK1 kinase activity in lymphoid cells, we performed an in vitro kinase assay using MBP as a substrate. Overexpression of AND-34 in transduced WEHI-231 cells led to an increase of PAK1 activity as judged by higher levels of phosphorylated MBP (Fig. 8C). Again, Western blot analysis demonstrated comparable levels of immunoprecipitated PAK1 (Fig. 8D). Of note, we detected substantial levels of both autophosphorylated PAK1 and basal kinase activity in PAK1 immunoprecipitates from control RV-transduced WEHI-231 cells, consistent with our prior observation of high basal levels of activated Rac1 in these cells. These results suggest that consistent with AND-34s ability to activate endogenous lymphoid Cdc42, overexpression of AND-34 activates endogenous PAK1 in murine B cells.
|
results in
cell polarization characterized by a tapered phenotype with
lamellipodia at the leading edge and a trailing uropod
(38). Cdc42 has been implicated in this process as a
constitutively active form of this GTPase abrogates such
chemokine-induced cell polarization (41). Given our
observation that AND-34 overexpression led to activation of Cdc42, we
sought to determine whether such overexpression also altered B cell
polarization. As expected, treatment of CT-RV-transduced S194 cells
cultured on fibronectin-coated tissue culture flasks with 100 ng/mL of
SDF-1
led to an increase in the percentage of polarized cells from
5.7 ± 0.5 to 43.4 ± 2.8% (Fig. 9). Comparable treatment of
AND-34-RV-transduced SDF-1
-treated S194 cells led to significantly
less cell polarization (5.4 ± 0.4 to 19.0 ± 1.2%;
p < 0.0001). Similarly, SDF-1
-induced polarization
was essentially eliminated by AND-34 overexpression in WEHI-231 cells
(CT-RV 5.1 ± 0.6 to 9.7 ± 0.9 vs AND-34-RV 6.2 ± 0.7
to 5.0 ± 0.9%, p < 0.001), although the
magnitude of the chemokine-induced polarization was less than that
observed in S194 cells. Thus, in keeping with prior studies
demonstrating that constitutively active Cdc42 impairs lymphoid cell
polarization, AND-34 overexpression markedly impeded the normal
polarization response of B cell lines to chemokine treatment.
|
| Discussion |
|---|
|
|
|---|
We find that, as with p130Cas, AND-34 associates with the C-terminal 28 kDa of HEF1 and further delineates the binding region of p130Cas to the terminal 135 aa of this protein. In studies of a distinct but related gene product, CHAT/NSP3, Sakakibara and Hattori (23) reported that while the C terminus of this 78-kDa protein associated predominantly with p130Cas, anti-CHAT antisera also identified a 115-kDa protein designated CHAT-H in hemopoietic tissues such as spleen, lymph node, and thymus that associated with HEF1. Although CHAT-H was not cloned in this study, its size and high-level constitutive expression in thymus and spleen make it unlikely that it is AND-34. A cDNA for an alternatively spliced transcript of the CHAT/NSP3 locus has been subsequently identified (National Center for Biotechnology Information no. AB043953) that is likely to represent CHAT-H. Transcript for SH2 domain-containing Eph receptor-binding protein 1, a longer form of murine NSP3 that is reported to associate with Eph receptors, is also present in spleen and thymus cDNA samples, although the association of this protein with Cas family members has not been studied (42).
Prior studies have demonstrated that the C terminus of HEF1 may mediate protein-protein interactions and is transformed into a stable peptide with biologic functions distinct from full-length HEF1 by a physiologically regulated proteolytic process. The C-terminal 137 residues of HEF1 (aa 695 to 832) contain a divergent helix-loop-helix domain that allows homodimerization or heterodimerization of HEF1 as judged by a LexA DNA-binding domain/B42-activation domain two-hybrid analysis performed in yeast (43). Thus, binding of AND-34 to this domain could alter homodimerization or heterodimerization with Cas family members or, possibly, with other proteins. The implications of such modulation of HEF1 or p130Cas dimerization remain unclear at present, but it is possible that signaling within the Cas family member complexes is altered by conversion from dimeric to monomeric forms.
Overexpression of p28 HEF1 causes both apoptosis and cellular rounding, although to what extent the low levels of physiologically generated p28 HEF1 peptide regulate apoptotic and adhesion-related events remains to be established (25, 28). We find that AND-34 associates with HEF1 through HEF1s C terminus, as judged by coimmunoprecipitation of AND-34 with either transfected p65 HEF1 or p28HEF1 peptides. Thus, it will be important to determine whether AND-34 plays a role in mediating the biological activities previously observed following overexpression of p28. Deletion of the terminal 28 aa of p28 HEF1 abolishes the ability of this peptide to induce apoptosis. Of note, in prior studies of p130Cas, we found that deletion of as few as 78 aa at the C terminus of p130Cas eliminated association with AND-34. As the C termini of p130Cas and HEF1 target these proteins to the focal adhesion complex, it will also be of interest to determine whether AND-34 regulates the intracellular localization of these docking molecules (28, 29).
As AND-34 contains a C-terminal domain with modest homology to Cdc25 (Ras subfamily GEF) but does not contain a Dbl-like (Rho subfamily GEF) domain, it remains to be determined how AND-34 induces Cdc42 activation. Perhaps the most likely hypothesis is that AND-34 activates a Ras subfamily member, whose resultant signaling ultimately further activates a GEF for Cdc42. To our knowledge, no prior studies have reported activation of Rho subfamily GTPases upon overexpression of a Ras subfamily GEF. However, there is ample precedent for Ras subfamily GTPase-mediated regulation of Rho subfamily GTPase activation, although the precise identification of the components linking these two families often remains elusive (44, 45, 46).
In prior collaborative work, transfection of GST-tagged GTPases into 32P-labeled Cos7 cells, followed by isolation of the GTPase and thin layer chromatography to quantify GTPase-associated GTP and GDP, demonstrated that AND-34 augmented levels of GTP-bound RalA and to a lesser extent, R-Ras and Rap1A (19). Importantly, no AND-34 GEF activity on H-Ras was detected in this study. Using a different technique, the pulldown assay, we see no evidence of AND-34-induced activation of endogenous RalA or Rap1 in lymphoid cell lines. The fact that our current results in B cell lines differ from our prior studies in Cos7 cells could be due to the different lineage of cells studied, decreased sensitivity of the pulldown assay, or the fact that we are examining endogenous GTPase. Nonetheless, our data suggest that if AND-34 activates Cdc42 indirectly by acting as a Ras subfamily GEF, it is likely to do so by acting on a GTPase other than Ral or Rap1. Secondly, AND-34 could activate Cdc42 by acting as an adapter protein rather than a GEF. AND-34 binds to p130Cas by its "GEF" domain, suggesting that it could recruit other proteins to the p130 or HEF1 complex by its SH2 domain. Finally, as the homology of the AND-34 C-terminal domain with the Cdc25 domain is only modest (18% identity, 30% homology), it remains possible that AND-34 could directly catalyze Cdc42 GDP exchange. Our future experiments will focus on an in vitro assessment of AND-34s GEF activity on Ras and Rho subfamily GTPases.
Given that overexpressed AND-34 activates lymphoid Cdc42, what downstream signaling pathways would such an event influence? A wide variety of Cdc42 effectors have been reported, although the number of physiologic Cdc42 effectors is likely to be more restricted (47, 48). Effectors activated by both Rac and Cdc42 include IQGAP1/2 (49), PAK1 (50), PAK5 (50, 51), mixed lineage kinase 2,3 (52), and mitogen-activated protein/extracellular signal-related kinase kinase kinase 1 (53). Effectors selectively activated by Cdc42 include Wiskott-Aldrich syndrome protein (WASP) (54) and N-WASP (55), PAK4 (56), activated Cdc42-associated kinase (57), and myotonic dystrophy kinase-related Cdc42-binding kinase (58). We find AND-34 overexpression results in activation of PAK1, a serine/threonine kinase previously implicated in cell polarization, motility, proliferation, and the formation of lamellipodia (59, 60).
However, the long cellular extensions we observed in a small percentage of AND-34-overexpressing B cells may result from other Cdc42-activated effectors. In fibroblasts and endothelial cells, PAK4 has been implicated in Cdc42-mediated filopodia formation (56). In Cos7 cells, N-WASP, a ubiquitously expressed WASP-related protein, was reported to be required for Cdc42-induced filopodium formation, while WASP itself was not (61). N-WASP binds to phosphatidylinositol (4, 5) bisphosphate and Cdc42 by its pleckstrin homology and Cdc42-Rac interaction and binding domains, respectively, freeing its C terminus to interact with the Arp2/3 complex, a group of seven proteins which can nucleate actin filaments in vitro (62). Despite these results in Cos7 cells, WASP itself clearly plays a role in leukocyte cytoskeletal regulation as WASP-deficient leucocytes, including B cells, have abnormal cytoarchitecture, polarization, and migration despite the presence of N-WASP (63).
Lymphoid cells stimulated to undergo chemotaxis initially undergo cell
polarization, a process in which lamellipodia form at the leading edge
and a uropod forms at the rear of the cell, the latter containing
augmented levels of the adhesion molecules ICAM-1, ICAM-3, CD43, and
CD44 (64, 65). Cdc42 is well known to regulate such
leukocyte polarization and cell motility (1, 66). A
variety of cell stimuli enhance B lymphocyte motility and cell
polarization including the chemokine SDF-1
, a ligand for the CXCR4
receptor (67, 68). Interestingly, while transfection of T
cell lines with constitutively active forms of Cdc42, Rac, RhoA, or the
Rac GEF, Tiam-1, impairs such polarization, only the dominant-negative
form of Cdc42 impaired subsequent SDF-1
-induced T cell chemotaxis
(41). Thus, our observation of inhibition of
SDF-1
-induced B cell polarization by AND-34 overexpression is
consistent with prior studies in which Cdc42 signaling is
constitutively activated in lymphocytes. Development of
dominant-negative forms of AND-34 will be required to characterize
AND-34s specific role in normal lymphoid cell polarization and
motility.
Given that AND-34s GEF domain binds to p130Cas and HEF1, it is plausible that physiologic signaling in B cells activates AND-34 by inducing release of AND-34 from the Cas family member, perhaps by phosphorylation. Of note, adhesion of Cos cells to fibronectin induced phosphorylation of NSP1, a human protein related to AND-34, as well as a transient reduction in its association with p130Cas (22). Our future studies will focus on identifying the B cell signals that regulate AND-34s association with these adapter molecules as well as the mechanism by which AND-34 activates Cdc42.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 D.C. and K.F. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Adam Lerner, Section of Hematology and Oncology, Department of Medicine, Boston Medical Center, Evans Biomedical Research Center 420, 650 Albany Street, Boston, MA 02118. E-mail address: alerner{at}medicine.bu.edu ![]()
4 Abbreviations used in this paper: F-actin, filamentous actin; GEF, GDP exchange factor; BCR, B cell receptor; SDF, stromal cell-derived factor; HEK, human embryonic kidney; MSCV, murine stem cell virus; NP40, Nonidet P-40; s, surface SH, Src homology; WASP, Wiskott-Aldrich syndrome protein. ![]()
5 D. Cai, A. Iyer, R. I. New, K. N. Felekkis, Z. Luo, C. Albanese, R. G. Pestell, and A. Lerner. AND-34/BCAR3, a GDD exchange factor whose overexpression confers anti-estrogen resistance, activates Rac, PAK1, and the cyclin D1 promoter. Submitted for publication. ![]()
Received for publication May 7, 2002. Accepted for publication November 12, 2002.
| References |
|---|
|
|
|---|
one integrin-dependent T cell migration through an HEF1 effector pathway. Eur. J. Immunol. 31:1417.[Medline]
-PAK reveals effects of the kinase on actin and focal complexes. Mol. Cell Biol. 17:1129.[Abstract]
triggers a chemotactic response and induces cell polarization in human B lymphocytes. Eur. J. Immunol. 28:2197.[Medline]
This article has been cited by other articles:
![]() |
G. M. O'Neill, S. Seo, I. G. Serebriiskii, S. R. Lessin, and E. A. Golemis A New Central Scaffold for Metastasis: Parsing HEF1/Cas-L/NEDD9 Cancer Res., October 1, 2007; 67(19): 8975 - 8979. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Rufanova and A. Sorokin CrkII Associates with BCAR3 in Response to Endothelin-1 in Human Glomerular Mesangial Cells. Experimental Biology and Medicine, June 1, 2006; 231(6): 752 - 756. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Felekkis, R. P. Narsimhan, R. Near, A. F. Castro, Y. Zheng, L. A. Quilliam, and A. Lerner AND-34 Activates Phosphatidylinositol 3-Kinase and Induces Anti-Estrogen Resistance in a SH2 and GDP Exchange Factor-Like Domain-Dependent Manner Mol. Cancer Res., January 1, 2005; 3(1): 32 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dail, M. S. Kalo, J. A. Seddon, J.-F. Cote, K. Vuori, and E. B. Pasquale SHEP1 Function in Cell Migration Is Impaired by a Single Amino Acid Mutation That Disrupts Association with the Scaffolding Protein Cas but Not with Ras GTPases J. Biol. Chem., October 1, 2004; 279(40): 41892 - 41902. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |