|
|
||||||||


* Skirball Institute of Biomedical Research, New York University School of Medicine, New York, NY 10016;
Howard Hughes Medical Institute, Childrens Hospital, Harvard Medical School, Boston, MA 02115; and
Department of Pharmaceutics, College of Pharmacy, Rutgers University, Piscataway, NJ 08854
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
CD4 is enriched in the lipid rafts of the plasma membrane
(9, 10, 11). Lipid rafts are the nonionic detergent-insoluble
lipid microdomains composed primarily of sphingolipids and cholesterol.
Lipid rafts are enriched with GPI-linked proteins, surface receptors
and tyrosine kinases, suggesting that lipid rafts may serve as the
functional modules for signal transduction and membrane trafficking
(12, 13, 14, 15, 16). In the T cell surface membrane, lipid rafts are
enriched with molecules involved in T cell activation, such as CD3
(17), coreceptors CD4 and CD8 (9), Src family
kinase Lck and Fyn (18, 19), transmembrane adaptor linker
for activation of T cells
(LAT)3
(20) and the Src homology 2 domain-containing leukocyte
protein of 76 kDa (21). In contrast, protein
tyrosine phosphatases (PTPs), including CD45 and membrane-associated
fractions of Src homology protein-1 and Src homology protein-2
are basically not present in lipid rafts (22, 23, 24). When T
cells are stimulated through TCR engagement or through CD3/CD28
costimulation, lipid rafts cluster at the site of engagement
(25, 26, 27). Ag-induced translocation of PKC-
to lipid
rafts at the synapse is required for T cell activation
(16). Thus, the aggregation of lipid rafts at the contact
area may lead to the concentration of protein tyrosine kinases in the
contact area while excluding PTPs from the area, a mechanism that may
drive the signaling cascades of tyrosine phosphorylation for T cell
activation. Recently, it has been reported (25) that the
costimulatory role of CD28 is associated with the induction of membrane
capping. Viola et al. (25) showed that lipid rafts form
caps in the contact areas between T cells and the beads coated with CD3
plus CD28, but not the beads coated with CD3 alone. Others have shown
that the costimulatory mechanism of adhesion molecules, including CD2,
CD48, CD44, CD5, and CD9, also involves lipid raft reorganization
(28, 29, 30, 31). It is possible that CD4 also plays its
costimulatory role by inducing the reorganization of lipid rafts.
Previously, it was shown that the membrane-proximal cysteine residues
of CD4 are palmitoylated when expressed in HeLa cells
(32). The palmitoylation of membrane-proximal cysteines is
known to be essential for the lipid raft localization of several
transmembrane proteins, including LAT and CD8
(20, 33).
Src family kinases Lck, Fyn, Hck, and Lyn are palmitoylated at the
amino-terminal cysteines, which are critical for both their membrane
association and lipid raft targeting (34, 35, 36, 37, 38, 39, 40).
Significantly, these palmitoylated cysteines are all present in a
conserved motif consisting of cysteines and hydrophobic residues (CVRC
in LAT, GCVC in Lck and Fyn, and CVRR in CD8
). CD4 also contains a
CVRC motif at the membrane-proximal region that may be critical for CD4
targeting into lipid rafts.
In this report, we demonstrated that the enrichment of CD4 in lipid rafts relies on the palmitoylation at membrane-proximal cysteines and CD4s association with Lck. Our results suggest that CD4-induced aggregation of lipid rafts may play some roles in CD4 coreceptor signaling.
| Materials and Methods |
|---|
|
|
|---|
Jurkat T cell line J77, a variant of clone E6-1 (American Type
Culture Collection, Manassas, VA) was cultured in RPMI 1640 medium,
supplemented with 10% FCS at 37°C in a 5% CO2
humidified atmosphere. JCAM.1.1 T cells were obtained from American
Type Culture Collection. Anti-CD3 mAb (OKT3), anti-CD4 mAb (OKT4),
and anti-CD8 mAb (OKT8) were prepared from the hybridomas obtained
from American Type Culture Collection. Anti-CD4 and anti-CD8
polyclonal Abs and anti-CD3
and anti-CD45 mAbs were
purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-pTyr
(4G10) mAb and anti-Lck and anti-LAT polyclonal Abs were
purchased from Upstate Biotechnology (Lake Placid, NY). PE-conjugated
anti-human CD4 (Leu-3A-PE), CyChrome-conjugated anti-human CD8,
and rhodamine-conjugated anti-mouse Ig were purchased from BD
PharMingen (San Diego, CA). Anti-pTyr (RC20) was purchased from BD
Transduction Laboratories (Lexington, KY). Anti-streptavidin-HRP,
anti-mouse Ig-HRP, and anti-rabbit Ig-HRP were purchased from
Amersham Pharmacia Biotech (Piscataway, NJ). FITC-conjugated cholera
toxin (CTx) and HRP-conjugated CTx were purchased from Sigma-Aldrich
(St. Louis, MO).
Construction and stable expression of plasmids of CD4 mutants in Jurkat T cells
To construct CD4 mutant plasmids, PCR was performed with a human
CD4 template using 5'-end PCR primer
5'-GCTGACGGGCAGTGGCGAGCTGTGGTGGCAGGCGGAGAGGGC for all mutants and
using 3'-end primers
5'-GTCTTCTGAAACCGGTGAGGGGCCTGGGCGGTCTTCTTCTCACTGAGGAG,
5'-CGCTCTGCTTGGCGCCTTCGGTGCCGGGCCCTGACAGCGAAGAAGATGCCTAGCCC,
5'-CGCTCTGCTTGGCGCCTTCGGTGCCGGCACTCGGTACAGAAGAAGATGCCTAGCCC,
and 5'-CGCTCTGCTTGGCGCCTTCGGTGCCGGCACCTGACTCAGAAGAAGATGCC for
the 2C mutant, 2Cm mutant, VR mutant, and tailless CD4 mutant,
respectively. The changed nucleotides are underlined. The PCR
products were digested by BstEII/SfoI or
BstEII/BamHI and used to replace the same
restriction fragment of wild-type (wt) CD4 subcloned in pBluescript.
The 4C CD4 mutant was generated by using the same approach that was
used to generate the 2C CD4 mutant, but with the 2Cm CD4 as the
template. The CD4 tailless mutant was generated by introduction of a
stop codon in place of Cys396. CD4 mutants were
subcloned into the mammalian expression vector pEF1/Myc-His
(Invitrogen, Carlsbad, CA) using the EcoRI and
XbaI sites. The chimeric CD8
CD4 was generated by PCR
using human CD8
and CD4 in pEBB as the templates. The complementary
primer for sense CD8
CD4 chimeric junctions is
5'-GGCTGGACTTCGCCTGTGATATGGCCCTGATTGTGCTGGGGGGCGTCGCCGGCCTCCTGC
(the underlined is from CD4 transmembrane region), which was
used to generate 5' to 3' PCR fragments by using additional primers
internal to pEBB. The fragments were then isolated and mixed and then
PCR extended. The resulting product was digested with BamHI
and subcloned into pcDNA3. Plasmids (5 µg) were transfected into
Jurkat T cells (1 x 107/500 µl) by
electroporation with the settings of 800 µF, low ohm, and 250 V. The
clones with mutant CD4 and CD8
stable expression were selected in
medium containing neomycin (G418) at 2.5 mg/ml.
Metabolic labeling of CD4 and CD8 with [3H]palmitate and biotin
For [3H]palmitate labeling, Jurkat T cells (2 x 107) were cultured with 1 mCi [3H]palmitate (NEN, Boston, MA) for 4 h in 2 ml RPMI 1640 medium containing 5% dialyzed FCS. Cells were then washed three times with RPMI 1640 medium and then lysed for immunoprecipitation. For biotin labeling, cells were washed three times with cold PBS (Ca2+, Mg2+) (20 mM sodium phosphate (pH 7.4), 0.15 M NaCl, 1 mM MgCl2, and 0.1 mM CaCl2), and then incubated with sulfo-LC-NHS-biotin (Pierce, Rockford, IL) at a concentration of 0.5 mg/ml in PBS (Ca2+, Mg2+) at 4°C for 30 min with gentle agitation. The reaction was stopped by cell pelleting and washed two times with 50 mM glycine in PBS (Ca2+, Mg2+) at 4°C for a total of 10 min.
Sucrose density gradient fractionation of crude T cell membrane
Crude T cell membrane was prepared as described previously (24). The crude membrane preparation was lysed at 4°C for 1 h in 1 ml of 1% Triton X-100 buffer (1% Triton X-100, 10 mM Tris (pH 7.5), 150 mM NaCl, and a panel of protease inhibitors (Sigma-Aldrich)). The lysates were adjusted to 1.33 M sucrose by adding 1 ml of 85% sucrose in TNE buffer (10 mM Tris, pH 7.5, 150 mM NaCl, 5 mM EDTA). In a SW40 centrifuge tube, the lysates were overlaid with 7 ml of 30% sucrose and 3.5 ml of 5% sucrose in TNE buffer. The samples were centrifuged for 1617 h at 38,000 rpm at 4°C. After equilibrium centrifugation, the gradients were fractionated from the top at 1.5 ml/fraction.
T cell stimulation, immunoprecipitation, and immunoblotting
For stimulation with Abs in solution, cells were incubated with OKT3 (1 µg/ml) or OKT4 (5 µg/ml) for 10 min on ice, and then cross-linked by rabbit anti-mouse IgG (10 µg/ml) on ice for 5 min at 37°C for an additional 3 min. For stimulation with plate-bound Abs, cells were incubated at 37°C for 15 min in plates precoated with OKT3 or OKT4. To coat the plates, OKT3 (0.1 µg/ml) or OKT4 (5 µg/ml) were incubated in plates at 4°C overnight and rinsed with PBS before use.
Immunoprecipitation was conducted in 1% Nonidet P-40 (NP-40)
lysis buffer with specific Abs and protein A-Sepharose beads as
described (24). For immunoblotting, proteins from
107 cells or 20 µl of sucrose gradient
fractions were analyzed by SDS-PAGE. The proteins were transferred to
polyvinylidene fluoride membrane and probed with specific Abs
(24).
Flow cytometry analysis
After washing with PBS, T cells were stained with PE-conjugated anti-human CD4 (Leu-3A) (BD Biosciences, Mountain View, CA) or CyChrome-conjugated anti-human CD8 (BD PharMingen) in PBS at 4°C for 30 min, and then washed two times with PBS. Cells were analyzed on a FACScan (BD Biosciences).
Patching and immunofluorescence confocal microscopy
For all fluorescence microscopy experiments, cells were washed in serum-free RPMI 1640 medium and attached to coverslips precoated with 5 mg/ml polylysine in PBS overnight. For attachment, 5 x 105 cells/slip were incubated at 4°C for 10 min. Cells were briefly fixed in 3.7% formaldehyde at 4°C for 4 min with subsequent incubation in methanol at -20°C for 5 min as described (41). For immunofluorescence staining, cells fixed on a coverslip were blocked in 2% BSA/RPMI 1640 for 10 min, and then incubated with specific Abs in 2% BSA/RPMI 1640 at 4°C for 30 min.
For membrane patching of CD4, cells were incubated with OKT4 (0.1 µg/ml) in serum-free RPMI 1640 medium on ice for 15 min. After washing, cells were incubated with the rhodamine-conjugated anti-mouse IgG (1:1000) on ice for 10 min and then at 37°C for an additional 5 min. Following membrane patching, cells were incubated with GM1-reactive FITC-CTx-B (1:1000) on ice for 30 min for GM1 staining (31). Cells were washed with 2% BSA/RPMI 1640 before being attached to coverslips for fixing.
Confocal microscopy was performed on a Zeiss confocal microscope with x63 and x100 objective lenses and using laser excitation at 488 and 568 nm. The widths of fluorescence and rhodamine emission channels were set such that bleed-through channels were negligible.
| Results |
|---|
|
|
|---|
To define the amino acid residues responsible for the localization of CD4 in lipid rafts, we generated a panel of mutant CD4 constructs, including 2C CD4, 2Cm CD4, VR CD4, 4C CD4, and tailless CD4 (Fig. 1A). In the 2C CD4 mutant, Cys422 and Cys424, which are essential for Lck binding, were changed to alanines. In the 2Cm CD4 mutant, membrane-proximal Cys396 and Cys399, the potential palmitoylation sites, were changed to alanines. In the 4C CD4 mutant, all four of these cysteines were changed to alanines. In the VR CD4 mutant, valine and arginine in membrane-proximal CVRC motif were changed to threonine and glutamic acid. All of these mutants were stably expressed in Jurkat T cells. The levels of surface expression of the CD4 mutants were shown by FACS analysis (Fig. 1B). The immunoprecipitation with anti-CD4 showed that the wt CD4, 2Cm CD4, and VR CD4 were coimmunoprecipitated with Lck, whereas the CD4 mutants lacking Cys422 and Cys424, including 2C, 4C, and tailless CD4, were not coimmunoprecipitated with Lck (Fig. 1C). The levels of expression of Lck in these CD4-transfected Jurkat T cells are similar to one another, as determined by anti-Lck immunoblotting (data not shown).
|
|
49-kDa CD4 (<10%) can be detected in
JCAM.1, it is poorly associated with CD4 (data not shown). Therefore,
it allowed us to assess the lipid raft localization of CD4 in the
absence of Lck association. As shown in Fig. 2B,
20% of
the wt CD4 was distributed in lipid rafts of JCAM.1 T cells, which is
about half of the wt CD4 distributed in lipid rafts of Jurkat T cells.
With the Cys396 and Cys399
of the CVRC motif changed to alanines, 2Cm CD4 in JCAM.1 T cells was
predominantly outside lipid rafts, although
Cys422 and Cys424 are
intact. The lipid raft distribution of LAT in these JCAM cell lines was
not changed. The results indicate that the membrane-proximal
Cys396 and Cys399 are lipid
raft-targeting signal for CD4 and that Cys422 and
Cys424 function through their association
with Lck.
The percentage of CD4 distributed in lipid rafts was analyzed by
densitometry (Fig. 2C). In Jurkat T cells,
6065% of wt
CD4 and VR CD4 and
20% of 2C CD4 and 2Cm CD4 are distributed in
lipid rafts. Tailless and 4C CD4 are essentially not present in lipid
rafts. In JCAM.1 T cells,
20% of wt CD4 is in lipid rafts, whereas
only 4% of 2Cm CD4 is in lipid rafts. The presence of a small amount
of 2Cm CD4 in lipid rafts may be due to its association with the
truncated Lck.
Palmitoylation of Cys396 and Cys399 in CVRC motif is critical for lipid raft targeting
Previously, Cys396 and Cys399 of CD4 were shown to be palmitoylated in HeLa cells (32). We examined whether Cys396 and Cys399 of CD4 are specifically palmitoylated in T cells. CD4 mutants were metabolically labeled with [3H]palmitate. After immunoprecipitation, the CD4 complex was analyzed on an 8% nonreducing SDS-PAGE, which separated CD4 from Lck. [3H]Palmitate was found by fluorography to be incorporated into the wt CD4, 2C CD4, and VR CD4, but not 2Cm CD4, indicating that Cys396 and Cys399 of CD4 are the specific palmitoylation sites (Fig. 3A). A 56-kDa protein that coimmunoprecipitated with wt CD4, 2Cm CD4, and VR CD4 was also [3H]palmitoylated. This protein was identified to be Lck by specific immunoblotting against Lck. The [3H]palmitoylated Lck was coimmunoprecipitated with wt CD4, 2Cm CD4, and VR CD4, but not 2C CD4. The VR CD4 mutant was [3H]palmitoylated, indicating that a mutation in the valine and the arginine did not affect the palmitoylation of Cys396 and Cys399 in the CVRC motif.
|
and CD45 were
shown to be largely unaffected by 2-bromopalmitate treatment. These
results indicate that the palmitoylation of CD4 at
Cys396 and Cys399 is the
signal for its lipid raft targeting.
Introduction of CD4 tail into CD8
enhances its lipid raft
localization
We have shown that the palmitoylation of cysteines in the CVRC
motif of CD4 and its association with Lck are responsible for targeting
CD4 into lipid rafts. This mechanism was further investigated by
introducing the CD4 tail into the CD8
molecule (Fig. 4). CD8
contains a single
membrane-proximal cysteine but lacks the second cysteine. Previously,
CD8
homodimers have been shown to be predominantly outside lipid
rafts (33). The chimeric CD8
CD4 was constructed by
using the CD8
extracellular domain fused to the transmembrane and
the intracellular domains of CD4 (Fig. 4A). CD8
CD4 mutant
was stably expressed in Jurkat T cells. The cell surface expressions of
CD8
wt and CD8
CD4 were shown by cytometric analysis (Fig. 4B). After surface biotin labeling, the distribution of
CD8
was analyzed by sucrose gradient sedimentation (Fig. 4C). The wt CD8
was shown to be predominantly distributed
outside lipid rafts. The chimeric CD8
CD4, like the wt CD4 molecule,
was greatly enriched in lipid rafts. The results indicated that the CD4
tail contains the signals for lipid raft localization. We also
performed the experiments by immunoblotting with anti-CD8
and
obtained similar results, although the signal is relatively weaker
(data not shown).
|
contains a membrane-proximal cysteine. The distribution of
CD8
outside the lipid rafts suggests that CD8
may not be
palmitoylated. However, by [3H]palmitate
labeling, we found that wt CD8
is palmitoylated (Fig. 4D). The results suggest that palmitoylation at the single
membrane-proximal cysteine may not be sufficient to confer strong lipid
raft localization. The lipid raft localization of CD4 correlates to its ability to enhance tyrosine phosphorylation
To determine whether the distribution of CD4 in lipid rafts is
relevant to its biological function, we examined the receptor tyrosine
phosphorylation by costimulation of CD4 and CD3 in Jurkat T cells (Fig. 5). With the low concentration of
plate-bound OKT3, an anti-CD3
mAb, CD3 stimulation alone induced
a relatively low level of tyrosine phosphorylation, which was enhanced
by plate-bound OKT4 costimulation. The anti-Ptyr
immunoprecipitation and the anti-
immunoprecipitation showed
that the overall tyrosine phosphorylation and the specific CD3
phosphorylation were significantly enhanced by costimulation with wt
CD4, VR CD4, 2Cm CD4, and 2C CD4, but less enhanced by 4C CD4 and
tailless CD4. The anti-Ptyr immunoblots (bottom) were
stripped and then reimmunoblotted with anti-CD3
, which showed
that similar amounts of CD3
were immunoprecipitated in these cell
lines with each stimulation as indicated (data not shown). The tyrosine
phosphorylated 70-kDa, 56-kDa, and 38-kDa proteins in the
immunoprecipitation of anti-Ptyr are most likely
-associated
protein 70, Lck, and LAT, respectively. Of note, 2C CD4 is
capable of enhancing the tyrosine phosphorylation, although it is not
associated with Lck (Fig. 1). The wt CD4 and VR CD4 appear to be more
effective than 2C CD4 and 2Cm CD4 in the enhancement of CD3-induced
tyrosine phosphorylation. These results indicate that the lipid raft
localization of CD4 correlates to its ability to enhance CD3-induced
tyrosine phosphorylation.
|
The correlation between the lipid raft localization of CD4 and its ability to enhance tyrosine phosphorylation suggests that CD4 may function through lipid rafts. Such a mechanism of amplifying receptor signaling has been proposed for the CD28 costimulatory molecule, which is involved in the redistribution of lipid rafts and the enhancement of substrate tyrosine phosphorylation (25). The aggregation of lipid rafts was also proposed for the costimulatory mechanism of adhesion molecules, including CD2, CD48, and, recently, CD44 molecules (28, 29, 30).
The reorganization of lipid rafts upon Ab cross-linking of CD4 was
evidenced by sucrose gradient analysis (Fig. 6). We found that the amount of CD4 in
fraction 3 (lipid rafts) was markedly increased upon cross-linking of
CD4 while decreased in fraction 9 (nonlipid) (Fig. 6A). Such
increase was not observed with cross-linking of CD3 alone.
Co-cross-linking of CD4 with CD3 had an effect similar to that of the
cross-linking of CD4 alone. To understand the mechanism underlying the
CD4 redistribution, we analyzed the distribution of other membrane
proteins after CD4 cross-linking (Fig. 6B). The results
showed that the lipid raft-localized Lck, LAT, and CD3
were
similarly increased in lipid raft fraction as CD4, whereas the
non-lipid raft protein, such as CD45, was not affected. GM1, a marker
of lipid rafts, was also increased upon cross-linking of CD4.
Because no evidence showed a direct association of CD4 with LAT,
CD3
, and GM1, CD4 cross-linking appeared to increase the amount of
lipid rafts in fraction 3. It is known that clusters of lipid rafts are
more resistant to nonionic detergent and therefore can keep more lipid
raft components in Triton X-100-resistant fractions
(44). We hypothesize that the redistribution
induced by cross-linking of CD4 is most likely due to the
aggregation of lipid rafts.
|
Furthermore, CD4-induced aggregation of lipid rafts was examined on plasma membrane by inspection of membrane patching using confocal microscopy (Fig. 7). We focused our studies on 2C CD4 and tailless CD4, because both mutants are not associated with Lck but show the difference in inducing lipid raft aggregation and tyrosine phosphorylation (Figs. 5 and 6). As shown in Fig. 7A, CD4 was evenly stained over the surface membrane before cross-linking (a). After cross-linking, CD4 molecules, including wt CD4, 2C CD4, and tailless CD4, were found clustered in almost all of the cells examined (b, c, and d). In each case, we have examined several separate areas (50100 cells) several times and obtained similar results. The clustering or patching of tailless CD4 was less apparent than that of wt CD4 and 2C CD4 based on the average size of the clusters. To find whether the patching of these CD4 mutants is related to the aggregation of lipid rafts, we stained the glycosphingolipid GM1 with FITC-CTx, a marker for lipid rafts (45). As shown in Fig. 7B, the patching of wt CD4 and 2C CD4 matched well with the GM1 staining, similar to the observation reported recently by Popik et al. (46). In contrast, although tailless CD4 induced some clustering on the T cell membrane, the GM1 largely remained evenly distributed.
|
| Discussion |
|---|
|
|
|---|
homodimer in lipid rafts (
Figs. 24).
The scant presence of CD8
in lipid rafts is likely due to the lack
of a second cysteine. Previously, the molecules LAT and
growth-associated protein of 43 kDa were shown to be no longer enriched
in lipid rafts when any one of the cysteines in the dual cysteine
motif was mutated (20, 47). Therefore, our results support
the notion that the dual cysteine motif near the plasma membrane is the
optimal structure to localize transmembrane proteins into lipid
rafts.
Ab cross-linking of CD4 on the T cell surface induced an extensive
membrane capping, which is shown to be related to the aggregation of
lipid rafts (Figs. 6 and 7). The ability of CD4 to mediate the
aggregation of lipid rafts relies on its allocation in lipid rafts. In
our experiments, cross-linking of CD4 induced more clustering than that
of CD3 (data not shown). This may be attributed to the more enriched or
more stable lipid raft localization of CD4 than that of CD3. Among the
CD3 subunits, only CD3
can be clearly detected in detergent
insoluble lipid rafts (Figs. 3 and 6) (17, 23, 24, 48).
These results suggested that TCR/CD3 stimulation may require the
coordinated action of CD4 to promote the aggregation of lipid rafts,
which may facilitate the formation of the immunological synapse in the
contact area between T cells and the APCs.
The lipid raft aggregation induced by cross-linking of CD4 may explain some observations of CD4 function that could not be adequately explained before. First, chimeric CD4/Lck, composed of the CD4 extracellular and transmembrane domain ligated to the catalytic domain-depleted form of Lck, is capable of enhancing the tyrosine phosphorylation in Jurkat T cells and enhancing IL-2 production in a CD4-dependent T cell hybridoma (49, 50). In our experiment, the cross-linking of 2C CD4 mutant that lacks the binding site for Lck enhanced the receptor tyrosine phosphorylation (Fig. 5). The cross-linking of CD4 alone was capable of stimulating a small increase in phosphatidylinositol and Ca2+ or inhibiting the CD3-induced calcium mobilization (51, 52, 53). Second, for costimulation of CD4, the direct co-cross-linking of CD3 with CD4 appears not to be necessary. It has been well demonstrated, as well as shown in Fig. 5, that anti-CD3 and anti-CD4 Abs immobilized to the same solid support can augment TCR/CD3-induced T cell response (54, 55, 56, 51). CD4 can enhance the T cell response regardless of whether it binds to the same or to different MHC molecules as the TCR (2). The engagement of CD4 with ligand or anti-CD4 in solution can positively or negatively affect the outcome of TCR/CD3 stimulation, which appears to be dependent on the concentration of anti-CD4 Ab and the conditions used for costimulation of CD4 (57, 58, 59, 60, 61, 62). The inhibition of CD3/TCR signaling was also observed by cross-linking of CD4 incapable of Lck binding (equivalent to our 2C CD4) (62). This suggests that the desensitization of TCR/CD3 stimulation upon cross-linking of CD4 may also be related to the aggregation of lipid rafts when imposed nonsynchronously with TCR/CD3 stimulation. It may be hypothesized that the effective TCR/CD3 stimulation should be accompanied by capping. CD4 treatment is not capable of inducing the effective T cell activation but instead results in lipid raft aggregation or capping, which inhibits the following "restimulation" with CD3. It is also possible that the structure and the constituents of a formed cap may be changed gradually, such as by the recruitment of PTPs, which leads to the down-regulation of tyrosine phosphorylation. Third, with the aid of three-dimensional video microscopy, it was recently demonstrated that, after the onset of TCR activation, CD3 was found clustered in the central contact area, whereas CD4 molecules moved to the periphery (27). This apparent disparity between CD3 and CD4 in the locality of the immunological synapse again suggests that CD4 may function without direct association with the TCR/CD3 complex. Indeed, the direct binding between CD4 and CD3 complex has not been demonstrated so far. In contrast, some evidence has already shown that CD4 engagement may affect the structure of the cytoskeleton, a cellular component closely linked to lipid rafts (63). Ab cross-linking of CD4 also induced an actin cytoskeleton polymerization-dependent attenuation of IL-2 receptor signaling (64). These structural reorganizations may involve protein tyrosine phosphorylation, which depends on Lck. This could explain why cross-linking of CD4 in JCAM T cells failed to induce lipid raft aggregation (Fig. 7C).
Our results show that the cross-linking of the non-lipid raft-localized tailless CD4 induced the membrane patching, which probably resulted from the clustering of non-lipid membrane microdomain (44) (Fig. 7B). The patching induced by tailless CD4 failed in enhancing the receptor tyrosine phosphorylation (Fig. 5). These different patterns of membrane patching induced by CD4 may ultimately influence the potency of TCR/CD3 signaling. Thus, while a potent agonist ligand often triggers the formation of large caps on the surface of T cells, weak agonist and antagonist ligands, which do not bind or bind weakly to CD4, can induce only small, unstable patterns of raft clustering (65, 66, 67, 68). We speculate that the quality and extent of CD4-mediated redistribution of lipid rafts may help to discriminate between the quality of ligands and may affect the overall potency of TCR stimulation, as suggested by others (57, 58, 59, 60, 61, 62, 69).
Our finding that CD4 mediates the redistribution and clustering of intracellular kinase-rich raft microdomains furthers our understanding of the coreceptor function of CD4. Such a mechanism of amplifying receptor signaling has been proposed for the CD28 costimulatory molecule, which shares with CD4 the ability to redistribute lipid rafts and enhance substrate tyrosine phosphorylation (25). This mechanism was also proposed for the costimulatory mechanism of adhesion molecules, including CD2, CD48, and, recently, CD44 molecules (28, 29, 30). All of these observations reinforce the notion that coreceptor-induced lipid raft aggregation could be one of the mechanisms that regulate TCR signaling.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Yong-Jiu Jin, Skirball Institute of Biomedical Research, 540 First Avenue, Lab 5-1, New York University School of Medicine, New York, NY 10016. E-mail address: jiny{at}saturn.med.nyu.edu ![]()
3 Abbreviations used in this paper: LAT, linker for activation of T cells; PTP, protein tyrosine phosphatase; CTx, cholera toxin; wt, wild type; NP-40, Nonidet P-40. ![]()
Received for publication April 17, 2002. Accepted for publication November 6, 2002.
| References |
|---|
|
|
|---|
to membrane rafts is required for T cell activation. Nat. Immunol. 2:556.[Medline]
during T cell recognition. Science 289:1349.
chain to glycolipid- enriched membrane domains upon T cell activation. Int. Immunol. 11:1395.
T-cell receptor. Nature 358:328.[Medline]
This article has been cited by other articles:
![]() |
A. Salikhova, L. Wang, A. A. Lanahan, M. Liu, M. Simons, W. P. J. Leenders, D. Mukhopadhyay, and A. Horowitz Vascular Endothelial Growth Factor and Semaphorin Induce Neuropilin-1 Endocytosis via Separate Pathways Circ. Res., September 12, 2008; 103(6): e71 - e79. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Jin, C. Y. Cai, X. Zhang, and S. J. Burakoff Lysine 144, a Ubiquitin Attachment Site in HIV-1 Nef, Is Required for Nef-Mediated CD4 Down-Regulation J. Immunol., June 15, 2008; 180(12): 7878 - 7886. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Wolf, M. G. Jobling, D. E. Saslowsky, E. Kern, K. R. Drake, A. K. Kenworthy, R. K. Holmes, and W. I. Lencer Attenuated Endocytosis and Toxicity of a Mutant Cholera Toxin with Decreased Ability To Cluster Ganglioside GM1 Molecules Infect. Immun., April 1, 2008; 76(4): 1476 - 1484. [Abstract] [Full Text] [PDF] |
||||
![]() |
I-J. Chen, H.-L. Chen, and M. Demetriou Lateral Compartmentalization of T Cell Receptor Versus CD45 by Galectin-N-Glycan Binding and Microfilaments Coordinate Basal and Activation Signaling J. Biol. Chem., November 30, 2007; 282(48): 35361 - 35372. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Van Komen, S. Mishra, J. Byrum, G. R. Chichili, J. C. Yaciuk, A. D. Farris, and W. Rodgers Early and Dynamic Polarization of T Cell Membrane Rafts and Constituents Prior to TCR Stop Signals J. Immunol., November 15, 2007; 179(10): 6845 - 6855. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Adam, N. K. Mukhopadhyay, J. Kim, D. Di Vizio, B. Cinar, K. Boucher, K. R. Solomon, and M. R. Freeman Cholesterol Sensitivity of Endogenous and Myristoylated Akt Cancer Res., July 1, 2007; 67(13): 6238 - 6246. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chentouf, S. Ghannam, C. Bes, S. Troadec, M. Cerutti, and T. Chardes Recombinant Anti-CD4 Antibody 13B8.2 Blocks Membrane-Proximal Events by Excluding the Zap70 Molecule and Downstream Targets SLP-76, PLC{gamma}1, and Vav-1 from the CD4-Segregated Brij 98 Detergent-Resistant Raft Domains J. Immunol., July 1, 2007; 179(1): 409 - 420. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Sim, J. R. Dilks, and R. Flaumenhaft Platelets Possess and Require an Active Protein Palmitoylation Pathway for Agonist-Mediated Activation and In Vivo Thrombus Formation Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1478 - 1485. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Pang, A. C. Hayday, and M.-J. Bijlmakers CD8 Raft Localization Is Induced by Its Assembly into CD8{alpha}beta Heterodimers, Not CD8{alpha}{alpha} Homodimers J. Biol. Chem., May 4, 2007; 282(18): 13884 - 13894. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gaibelet, T. Planchenault, S. Mazeres, F. Dumas, F. Arenzana-Seisdedos, A. Lopez, B. Lagane, and F. Bachelerie CD4 and CCR5 Constitutively Interact at the Plasma Membrane of Living Cells: A CONFOCAL FLUORESCENCE RESONANCE ENERGY TRANSFER-BASED APPROACH J. Biol. Chem., December 8, 2006; 281(49): 37921 - 37929. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Brown Lipid Rafts, Detergent-Resistant Membranes, and Raft Targeting Signals. Physiology, December 1, 2006; 21(6): 430 - 439. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Loomis, R. J. Courtney, and J. W. Wills Packaging Determinants in the UL11 Tegument Protein of Herpes Simplex Virus Type 1 J. Virol., November 1, 2006; 80(21): 10534 - 10541. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Resh Palmitoylation of Ligands, Receptors, and Intracellular Signaling Molecules Sci. Signal., October 31, 2006; 2006(359): re14 - re14. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Kinlough, R. J. McMahan, P. A. Poland, J. B. Bruns, K. L. Harkleroad, R. J. Stremple, O. B. Kashlan, K. M. Weixel, O. A. Weisz, and R. P. Hughey Recycling of MUC1 Is Dependent on Its Palmitoylation J. Biol. Chem., April 28, 2006; 281(17): 12112 - 12122. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. T. van der Veken, R. S. Hagedoorn, M. M. van Loenen, R. Willemze, J.H. F. Falkenburg, and M. H.M. Heemskerk {alpha}{beta} T-Cell Receptor Engineered {gamma}{delta} T Cells Mediate Effective Antileukemic Reactivity. Cancer Res., March 15, 2006; 66(6): 3331 - 3337. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Sepulveda, M. Berrocal-Carrillo, M. Gasset, and A. M. Mata The Plasma Membrane Ca2+-ATPase Isoform 4 Is Localized in Lipid Rafts of Cerebellum Synaptic Plasma Membranes J. Biol. Chem., January 6, 2006; 281(1): 447 - 453. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F Meiri Lipid rafts and regulation of the cytoskeleton during T cell activation Phil Trans R Soc B, September 29, 2005; 360(1461): 1663 - 1672. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Jin, C. Y. Cai, X. Zhang, H.-T. Zhang, J. A. Hirst, and S. J. Burakoff HIV Nef-Mediated CD4 Down-Regulation Is Adaptor Protein Complex 2 Dependent J. Immunol., September 1, 2005; 175(5): 3157 - 3164. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Brown and D. S. Lyles Pseudotypes of Vesicular Stomatitis Virus with CD4 Formed by Clustering of Membrane Microdomains during Budding J. Virol., June 1, 2005; 79(11): 7077 - 7086. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shogomori, A. T. Hammond, A. G. Ostermeyer-Fay, D. J. Barr, G. W. Feigenson, E. London, and D. A. Brown Palmitoylation and Intracellular Domain Interactions Both Contribute to Raft Targeting of Linker for Activation of T Cells J. Biol. Chem., May 13, 2005; 280(19): 18931 - 18942. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Jin, X. Zhang, J. G. Boursiquot, and S. J. Burakoff CD4 Phosphorylation Partially Reverses Nef Down-Regulation of CD4 J. Immunol., November 1, 2004; 173(9): 5495 - 5500. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sadra, T. Cinek, and J. B. Imboden Translocation of CD28 to lipid rafts and costimulation of IL-2 PNAS, August 3, 2004; 101(31): 11422 - 11427. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sol-Foulon, C. Esnault, Y. Percherancier, F. Porrot, P. Metais-Cunha, F. Bachelerie, and O. Schwartz The Effects of HIV-1 Nef on CD4 Surface Expression and Viral Infectivity in Lymphoid Cells Are Independent of Rafts J. Biol. Chem., July 23, 2004; 279(30): 31398 - 31408. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. S. Doan, D. A. Windmiller, and D. W. H. Riches Differential Regulation of TNF-R1 Signaling: Lipid Raft Dependency of p42mapk/erk2 Activation, but Not NF-{kappa}B Activation J. Immunol., June 15, 2004; 172(12): 7654 - 7660. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Balamuth, J. L. Brogdon, and K. Bottomly CD4 Raft Association and Signaling Regulate Molecular Clustering at the Immunological Synapse Site J. Immunol., May 15, 2004; 172(10): 5887 - 5892. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Papoucheva, A. Dumuis, M. Sebben, D. W. Richter, and E. G. Ponimaskin The 5-Hydroxytryptamine(1A) Receptor Is Stably Palmitoylated, and Acylation Is Critical for Communication of Receptor with Gi Protein J. Biol. Chem., January 30, 2004; 279(5): 3280 - 3291. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Popik and T. M. Alce CD4 Receptor Localized to Non-raft Membrane Microdomains Supports HIV-1 Entry: IDENTIFICATION OF A NOVEL RAFT LOCALIZATION MARKER IN CD4 J. Biol. Chem., January 2, 2004; 279(1): 704 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Brdickova, T. Brdicka, P. Angelisova, O. Horvath, J. Spicka, I. Hilgert, J. Paces, L. Simeoni, S. Kliche, C. Merten, et al. LIME: A New Membrane Raft-associated Adaptor Protein Involved in CD4 and CD8 Coreceptor Signaling J. Exp. Med., November 17, 2003; 198(10): 1453 - 1462. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Vereb, J. Szollosi, J. Matko, P. Nagy, T. Farkas, L. Vigh, L. Matyus, T. A. Waldmann, and S. Damjanovich Dynamic, yet structured: The cell membrane three decades after the Singer-Nicolson model PNAS, July 8, 2003; 100(14): 8053 - 8058. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |