|
|
||||||||
8.2 TCR Is Disrupted by Coadministration with Vectors Expressing Either IL-4 or -101





* Division of Immune Regulation, La Jolla Institute for Allergy and Immunology, San Diego, CA 92121;
Department of Microbiology and Cancer Immunobiology Center, University of Texas Southwestern Medical Center, Dallas, TX 75235;
Department of Microbiology and Molecular Genetics, University of California, Los Angeles, CA 90024; and
Department of Pathology, McMaster University, Hamilton, Ontario, Canada
| Abstract |
|---|
|
|
|---|
-chain. Immunization of B10.PL mice with a recombinant adenovirus
expressing the TCR V
8.2 chain (Ad5E1 mV
8.2), resulted in
induction of regulatory type 1 CD4 T cells, directed against the
framework region 3 determinant within the B5 peptide (aa 76101) of
the V
8.2 chain. This determinant is readily processed and displayed
in an I-Au context, on ambient APC. Transient genetic
delivery of the TCR V
8.2 chain protected mice from Ag-induced
experimental autoimmune encephalomyelitis. However, when the
Ad5E1 mV
8.2 vector was coadministered with either an IL-4- or
IL-10-expressing vector, regulation was disrupted and disease was
exacerbated. These results highlight the importance of the Th1-like
cytokine requirement necessary for the generation and activity of
effective regulatory T cells in this model of experimental autoimmune
encephalomyelitis. | Introduction |
|---|
|
|
|---|
In this model, we have previously shown that both CD4 and CD8
regulatory T (Treg) cells play essential roles in the control of myelin
basic protein (MBP)-specific CD4 effector T cells which mediate
demyelination. In the initial phases of this experimental disease, most
MBP-specific T cells in B10.PL mice react to the N-terminal
determinant, MBPAc19, and predominantly use the V
8.2 TCR
(15, 16). We have shown that Treg cells specific for two
different determinants within the V
8.2 TCR chain appear during the
recovery phase of the disease (17, 18, 19, 20). One determinant is
within the framework 3 (Fr3) region and is recognized by CD4
Treg cells, while another determinant is from the CDR1/2 region and is
recognized by CD8 Treg cells. Induction of both of these regulatory
cells is required for controlling disease (21, 22).
This oligoclonal use of TCR V genes in EAE provides an opportunity to
test immunospecific intervention strategies. Early evidence for the
efficacy of immunospecific therapy was provided when it was shown that
in vivo administration of mAbs against the V
8.2 chain could prevent
EAE in B10.PL mice as well as in other rodent models (15, 16). This Ab targeting of the TCR in the treatment of autoimmune
disease was preceded by the experimental introduction of T cell clones
as a vaccine. In this study, attenuated MBP-reactive
CD4+ T cells were used as a vaccine to protect
rats from EAE (23). The protection afforded by such T cell
vaccination was postulated to be dependent on the generation of Treg
cells reactive to determinants on the TCR displayed by the
encephalitogenic T cells (24). Our laboratory subsequently
provided conclusive evidence that a regulatory
CD4+ T cell was involved in response to a Fr3
region determinant on the encephalitogenic V
8.2 TCR
(18).
More recently, we have demonstrated that an additional requirement in
the induction of Treg cells in this model system is that a Th1 cytokine
milieu, predominantly rich in IFN-
must be intact to generate
effective regulation (25, 26). The priming of Treg cells
in a Th2-directed manner resulted in exacerbation of EAE and in-creased
the frequency of Th1 MBP-specific encephalitogenic T cells. Although in
general, MBP-restricted T cells producing a Th2 pattern of cytokines
have been considered nonencephalitogenic and the presence of endogenous
levels of IL-4 or IL-10 have correlated with recovery from EAE, the
effect of cytokine on regulatory cells and the disease state has not
fully been addressed.
In the studies presented here, we report that V
8.2 TCR expressed by
a recombinant adenovirus vector can protect B10.PL mice against EAE by
inducing potent type 1 regulatory CD4+ T cells
targeted to a Fr3 region determinant on the V
8.2 chain. We also show
that this regulation can be disrupted by the simultaneous delivery of
adenoviral vectors expressing cytokines IL-4 and IL-10. These data
clearly establish an obligatory cytokine dependence for the generation
of Treg cells. The development of TCR V
-expressing vectors along
with the use of appropriate cytokine adenoviral vectors should prove
useful for intervention in T cell-mediated pathologic conditions.
| Materials and Methods |
|---|
|
|
|---|
8.2 chain of the TCR
(Ad5E1 mV
8.2)
A schematic diagram for the construction of the Ad5E1
mV
8.2 vector is shown in Fig. 1. To
rescue V
8.2 TCR sequences into a translatable minigene cassette, an
oligonucleotide was designed containing 5' flanking restriction enzyme
sites for BamHI and HindIII, followed
subsequently by a sequence coding for the consensus optimal ribosomal
translation initiation site (Kozak sequence) (27), and
bases incorporating the first 33 nucleotides of the coding sequence for
the V
8.2 TCR. The sequence of the 5'oligonucleotide is
GCGGATCCAAGCTTGCCGCCGCCATGGAGGCTGCAGTCACCCAAAGCCCAAGAAAC. An
additional oligonucleotide containing bases complementary to the 3' end
of the V
8.2 TCR, flanked by residues containing stop codons to
provide a translational termination signal and a restriction site,
XhoI, was created. The sequence of the 3' oligonucleotide is
ACATCAGTGTACTTCTGTGCCAGCGGTGATGCAGGGTGATAGCTCCAGCGG. PCR using the
5'- and 3'-designed oligonucleotides with plasmid DNA encoding the
single chain V
8.2 TCR (28) allowed rescue of a
constructed mini-gene fragment of 342 bp containing the V
8.2 TCR. A
BamHI/XhoI fragment containing the mini-gene
encoding the murine V
8.2 TCR was cloned into the polylinker site of
pDK6, to generate pDK6.m
V8.2. This construct places the transgene
under the control of the murine CMV (mCMV) promoter and provides a
polyadenylation signal from SV40. To obtain the resultant adenovirus
vector expressing the V
8.2 TCR, pDK6 mV
8.2, DNA was cotransfected
with pBHG10 into 293 cells using standard adenovirus rescue protocols
and produced the recombinant Ad5E1 mV
8.2 vector (29, 30).
|
8.2 chain of the TCR after Ad5E1 mV
8.2 vector treatment
Transgenic expression of the V
8.2 transcripts was detected
both in vitro and in vivo following Ad5E1 mV
8.2 vector treatment. To
verify expression of the TCR V
8.2 transcripts, 293 cells were
infected at a multiplicity of infection of 10 with the Ad5E1 mV
8.2
vector, or B10.PL mice were injected with a 2 x
109 PFU dose of Ad5E1 mV
8.2 vector in a
50-µl volume of PBS into the femoris muscle of the left hind leg.
Twenty-four hours later, 20 µg of total cellular RNA was prepared and
analyzed by Northern blot analysis as previously described
(31). Strong mRNA expression of mV
8.2 was detected in
cells and muscle tissue infected with Ad5E1 mV
8.2, but not DL70-3,
vector-infected control cells (data not shown). This signal
corresponded to an approximate size mRNA of 550 bp and is consistent
with an expected length of 342 bp for the mV
8.2 minigene cassette
with an
200-bp polyadenylated tail.
Animals and immunization
B10.PL mice were purchased from The Jackson Laboratory (Bar
Harbor, ME) and bred under specific pathogen-free conditions in the La
Jolla Institute for Allergy and Immunology animal facility (San Diego,
CA). Female mice were used at 814 wk of age. Mice were immunized
i.p. with 2 x 109 PFU of the Ad5E1
mV
8.2 vector in 200 µl of PBS. For i.m. immunization, 2 x
109 PFU of Ad5E1 mV
8.2 vector were injected in
50 µl of PBS into the left hind leg. Disease induction was followed
10 days later using 100 µg of peptide Ac19 or whole MBP. All
recombinant viruses were propagated and purified as described for the
Ad5E1 mV
8.2 vector. For cytokine coexpression experiments, cytokine
vectors were injected at 5 x 108 PFU dose
admixed with 2 x 109 PFU of Ad5E1 mV
8.2
vector in 50 µl of PBS injected i.m. The adenoviruses expressing
IL-4, IL-10, and IL-12 were all previously used to express biologically
active cytokine upon in vivo administration in other model systems
(2, 4, 32, 33). Control vector DL70-3 is an Ad5 variant
deleted in the E1 region while the Ad5LacZ vector expresses a
nonrelevant Ag,
-galactosidase (29). All work was
performed in accordance with La Jolla Institute for Allergy and
Immunology guidelines for animal use and care.
Polymerase chain reaction
V
8.2 TCR mini-gene cDNA synthesis was performed with Vent DNA
polymerase (New England Biolabs, Beverly, MA) using the
Superscript preamplification system according to the manufacturers
instructions (Life Technologies, Grand Island, NY). PCR were performed
on a Gene Amp PCR System 9700 (Applied Biosystems, Foster City, CA)
using denaturation for 2 min at 94°C, and then 30 cycles of 94°C
for 1 min, 55°C for 2 min, and 72°C for 2 min followed by a 10-min
extension at 72°C.
TCR peptides
TCR peptides were synthesized by S. Horvath (California
Institute of Technology, Pasadena, CA) using a solid phase
technique on a peptide synthesizer (430A; Applied Biosystems) and were
purified on a reverse phase column by HPLC, as described earlier
(34). TCR V
8.2 chain peptides correspond to the
sequences predominantly used in the MBP-specific response in B10.PL
mice (16) and are as follows (single-letter amino acid
code): B1, aa 130 (L): EAAVTQSPRNKVAVTGGKVTLSCNQTNNHNL; B5, aa
76101: LILELATPSQTSVYFCASGDAGGGYE; p4150, aa 4150: HGLRLIHYSY;
p7280, aa 7280: ENFSLILEL.
Splenic proliferation assay
Spleens of mice were removed 10 days after immunization with the
Ad5E1 mV
8.2 vector to test initial responses to TCR determinants, or
10 days after disease induction with 100 µg of MBP to test the
outcome of response after vector vaccination to MBP determinants.
Splenocytes (8 x 105 cells per well) were
cultured in 96-well microtiter plates in 200 µl of serum-free medium
(HL-1; Ventrex, Portland, ME) supplemented to 2 mM glutamine; peptides
were added at concentrations ranging from 0.17 µM final
concentration. Proliferation was assayed by the addition of 1 µCi
[3H]thymidine (International Chemical and
Nuclear, Irvine, CA) for the last 18 h of a 5-day culture, and
incorporation of the label was measured by liquid scintillation
counting.
Induction of EAE
MBP was isolated from the brains of B10.PL mice as described (35). For induction of EAE, mice were immunized s.c. with either 100 µg of MBP or MBP peptide Ac19 in CFA, and 0.1 µg of pertussis toxin (PTX; List Biological Laboratories, Campbell, CA) was injected i.p. in 500 µl of saline, 24 and 72 h later. Mice were observed daily for signs of EAE and until >60 days after MBP immunization. The average disease score for each group was calculated by averaging the maximum severity at each time point of all of the affected animals in each group. Disease severity was scored on a five-point scale (36): 1, flaccid tail; 2, hind limb weakness; 3, hind limb paralysis; 4, whole body paralysis/moribund; 5, death. Onset of disease is defined as the first signs of loss of tail tone or hind limb weakness.
ELISA
IFN-
and IL-4 levels were measured by a sandwich ELISA, using
supernatants obtained from peptide-pulsed lymphocytes isolated from
adenovirus vector- and control-immunized B10.PL mice. Briefly,
splenocytes (8 x 106 cells/ml) were
cultured for 48 h in 24-well plates either with medium alone or
together with the B1, B5, p4150, or p7280 TCR peptides. Nunc Immuno
Plates MaxiSorp F96 (Roskilde, Denmark) were coated with
anti-IFN-
or anti-IL-4 Abs. After blocking with PBS
containing 10% FBS, supernatants were added overnight at 4°C.
Plates were extensively washed with PBS-Tween and incubated with
biotin-conjugated anti-IFN-
or anti-IL-4 Ab. Finally, plates
were washed and developed using avidin-peroxidase and
22'-azino-bis(3-ethyl-benzthiazoline-6-sulfonic acid) substrate
(Sigma-Aldrich, St. Louis, MO). OD405 was
measured, and the values were determined against a recombinant protein
standard. All cytokine capture and Ab detecting pairs were obtained
from BD PharMingen (San Diego, CA).
Cellular ELISA-spot
IFN-
- and IL-4-producing cells were enumerated from
peptide-pulsed lymphocytes isolated from adenovirus vector and control
immunized B10.PL mice by the cellular ELISA-spot assay as described
(37). Briefly, splenocytes (8 x
106 cells/ml) were cultured for 48 h in
24-well plates either with medium alone or the B1, B5, p4150,
p7280, or Ac120 peptides. Millititer HA nitrocellulose plates
(Millipore, Bedford, MA) were coated overnight at 4°C with
anti-IFN-
(purified from R46A2 supernatants) or anti-IL-4
Ab. Plates were blocked as above, and Ag-stimulated cells were added at
different concentrations for 24 h at 37°C. The wells were then
incubated with biotin-conjugated anti-IFN-
(purified from XMG1.2
supernatants) or anti-IL-4 Ab followed by incubation with
avidin-peroxidase (Vector Laboratories, Burlingame, CA). Spots were
developed by the addition of 400 µg/ml 3-amino-9-ethylcarbazole
substrate (Sigma-Aldrich) and enumerated by a computerized image
analysis system (Lightools Research, Encinitas, CA) using the image
analyzer program NIH Image 1.61 (National Institutes of Health,
Bethesda, MD).
Statistical analysis
Data are expressed as the mean ± SEM for each group.
Statistical analysis were performed using Statview 4.5 programs from
Abacus Concepts (Berkeley, CA). A Wilcoxon test was used for the final
determination of significance testing the effects of the Ad5E1 mV
8.2
vector vs controls.
| Results |
|---|
|
|
|---|
8.2 vector immunization leads to priming/expansion of T
cells reactive to the Fr3 region peptide (B5) of the V
8.2 chain of
the TCR
We have previously proposed a Treg cell circuit involving both
TCR-peptide-reactive CD4+ and
CD8+ cells which bring about the physiological
regulation of EAE in B10.PL mice. Because the CD8 Treg population does
not proliferate well in in vitro peptide recall assays, we tested
whether CD4 Treg were primed following adenoviral V
8.2 vector
administration. We examined the in vitro recall proliferative responses
to the CD4 determinant B5 (aa 76101) from the spleens of B10.PL mice
that were injected i.p., 10 days earlier, either with a 2 x
109 PFU dose of Ad5E1 mV
8.2 or with vector
controls.
As shown in Fig. 2A, T cells
reactive to the TCR peptide B5 were primed after vaccination with the
Ad5E1 mV
8.2 vector. This experiment was repeated six times and
cumulative data are shown. Stimulation indices (SI) averaging 9.35 were
achieved to the B5 peptide whereas responses to another control
peptide, B1, averaged below 2 in V
8.2 vector-treated mice. In
contrast, in all experiments performed, no significant responses to any
other region of the TCR were detectable in the DL70-3 vector or
PBS-treated controls. Our results show that recall responses to the TCR
peptide B5 seen after vector treatment are similar to those that we
have previously reported during spontaneous recovery from EAE
(18) or induced by other TCR-based interventions in B10.PL
mice (21).
|
8.2 vector immunization of B10.PL mice results in the
expansion of Treg cells with a Th1 phenotype
We have previously shown that the profile of cytokines produced by
the regulatory CD4+ T cells specific for the Fr3
region (B5) determinant of the V
8.2 TCR profoundly influences the
resultant responses to the target autoantigen MBP and disease outcome
(25). Protection was afforded only when the TCR peptide
B5-reactive regulatory CD4+ cells produce a Th1
cytokine profile. To determine whether a B5-specific Th1 response was
obtained after adenovirus vector vaccination, the cytokine phenotype of
the B5-reactive cells generated after Ad5E1V
8.2 immunization was
investigated. Lymphocytes isolated from the vaccinated animals were
tested for the secretion of IFN-
or IL-4 cytokine. IFN-
production against the B5 determinant was
2- to 3-fold higher in
Ad5E1V
8.2 vector-immunized mice vs the DL70-3 vector and PBS-treated
controls (Fig. 2B). IFN-
concentrations averaged 1592
pg/ml in Ad5E1V
8.2 vector-treated mice compared with 720 and 505
pg/ml for DL70-3 and PBS controls, respectively. Although low but
detectable levels of IL-4 were found in all treatment groups, no
significant differences above baseline levels were detected for
Ad5E1V
8.2 vector-immunized animals vs controls (data not shown).
The B5 proliferative response seen after Ad5E1V
8.2 vector
immunization was further characterized by ELISA-spot analysis performed
on isolated splenocytes (Fig. 2C). The ratio of IFN-
-IL-4
spots (1.54) detected after immunization indicated that responses to B5
had a Th1 bias. Thus, Ad5E1V
8.2 vector vaccination enhanced the
production of IFN-
-secreting Th1 regulatory cells, specific to the
Fr3 region determinant of the V
8.2 TCR.
Intraperitoneal or intramuscular immunization with the Ad5E1
mV
8.2 vector protects B10.PL mice against EAE induced with MBPAc19
To determine whether Ad5E1 mV
8.2 vector immunization could
influence the course of EAE, B10.PL mice were inoculated i.p. with PBS
or a 2 x 109 PFU dose of the V
8.2 or
DL70-3 vectors. The 2 x 109 dose was chosen
because this dose was shown to be the most effective for inducing
response to self Ags in tumor models (38, 39). Ten days
later, induction of EAE was attempted by s.c. administration of MBP
Ac19 peptide as detailed in Materials and Methods. Mice
were monitored daily for disease until day 30, and in one experiment up
to day 60, to look for disease relapse. As shown in Fig. 3A, mice receiving i.p.
immunization with the Ad5E1 mV
8.2 vector were significantly
protected against induction of EAE. Table I shows the clear difference in EAE
incidence following Ad5E1 mV
8.2 i.p. vector treatment. In this
treatment group, a greater percentage of animals remained disease-free
with no animal getting disease with severity greater than a score of 2,
whereas mice in DL70-3- or PBS-immunized groups contracted a more
severe EAE and had a higher incidence of disease. In addition, no
disease relapse was evident in any Ad5E1 mV
8.2 vector-treated group
when the animals were monitored until day 60 while some mild relapses
were detected in the controls (data not shown).
|
|
8.2 vector
was chosen as an alternative route of administration to reduce concerns
of immunotoxicity that have been reported with the i.v. and airway
administration of adenovirus vectors (40, 41, 42). Injection
of adenovirus into the muscle should offer no more, or similar, risk to
that associated with standard vaccination procedures with adjuvant.
To test the efficacy of i.m. vaccination, B10.PL mice were immunized
i.m. with a 2 x 109 PFU dose of the Ad5E1
mV
8.2 or vector controls and EAE was induced in these groups of mice
as before. As seen in Fig. 3A and summarized in Table I,
i.m. immunization with the Ad5E1 mV
8.2 vector provided B10.PL mice
protection against EAE nearly equivalent to that seen for
i.p. treatment. This approach of using i.m. injection with
the Ad5E1 mV
8.2 vector to induce a regulatory response may be the
most suitable use of adenovirus vectors in transient gene
expression therapies (such as TCR-directed therapy) that have
immunomodulation as a primary target. We have previously shown that
i.m. vaccination generally leads to more localized transgene expression
(32).
Intraperitoneal immunization with the Ad5E1 mV
8.2 vector
protects B10.PL mice from EAE induced with whole MBP
Because T cells not displaying the V
8.2 TCR may arise with
encephalitogenic capacity, owing to intramolecular or intermolecular
spread of neuroantigen determinants, we tested the efficacy of Ad5E1
mV
8.2 vector vaccination against EAE induced with whole mouse MBP
(Fig. 3B). EAE induced with whole MBP and additional
adjuvant is more chronic than Ac19 monophasic disease. Treatment with
the 2 x 109 PFU dose of Ad5E1 mV
8.2
vector provided protection against disease. In addition, mice in the
PBS control group showed signs of mild relapses whereas no such
relapses were seen in the V
8.2 vector-treated group. Thus,
Ad5E1V
8.2 immunization was able to produce a degree of protection in
B10.PL mice against MBP-induced disease despite the presence of
potential additional T cell determinants capable of inducing
EAE.
Protective response generated by Ad5E1 mV
8.2 vector immunization
is dose-dependent
We have found that self-Ags, when compared with foreign Ags
expressed from recombinant adenovirus vectors, generally require higher
dosages to induce effective Ag-reactive immune response
(109 vs 107 PFU dosages).
Because response to the conserved Fr3 region of the V
8.2 TCR appears
to be hardwired into immunological memory, we wanted to determine how
this response would be affected by vector-mediated expression of the
V
8.2 transgene. Vector dose response analysis revealed that a
relatively low immunizing dose of 5 x 108
PFU is capable of inducing a protective response while the greatest
efficacy was seen at the highest dose tested of 4 x
109 PFU (Fig. 4).
|
8.2 vector immunization attenuates proliferative and Th1
responses to the dominant determinant of MBP in B10.PL mice
We asked whether Ad5E1V
8.2 vector immunization could modulate
the dominant encephalitogenic T cell response to MBP. Ad5E1V
8.2 or
control vector-vaccinated mice were challenged with murine MBPAc120
containing the dominant N-terminal determinant Ac19 and proliferative
responses were determined 10 days later in isolated splenocytes (Fig. 5A). There were significant
differences in the proliferative responses of Ad5E1V
8.2
vector-immunized mice compared with vector controls. SIs to Ac120
were
3-fold lower in Ad5E1V
8.2-treated mice compared with DL70-3
and PBS controls, respectively. The decrease in responsiveness to
murine MBP Ac120 following Ad5E1V
8.2 vector was specific because
responses to purified protein derivative of the mycobacterium (a
component in the CFA) were similar to those found after treatment with
the vector controls. Proliferative responses to purified protein
derivative ranged between 69,000 and 82,000 cpm in all groups.
|
production by Ac120-specific T cells was reduced >2-fold in
Ad5E1V
8.2 vector-treated mice compared with the PBS-treated control
(Fig. 5B). There was some background effect of the
adenovirus vector alone on IFN-
production as Ac120-specific
lymphocytes isolated from DL70-3 controls showed a 27% reduction in
IFN-
levels compared with the PBS treatment group. The most
significant difference was evident between the treatment groups when
the frequency of IFN-
-secreting cells in response to MBP Ac120 was
examined by cellular ELISA-spot analysis (Fig. 5C).
Approximately 22-fold fewer Ac120-specific IFN-
-producing
cells/106 were detected after Ad5E1V
8.2 vector
immunization compared with PBS control animals (20 vs 439 IFN-
spots) while the response was 6.6-fold less than the number detected
following DL70-3 treatment (20 vs 133 IFN-
spots). No significant
differences in the frequency of IL-4-secreting cells were detected.
Nevertheless, the resultant effect of Ad5E1V
8.2 vector immunization
was to reduce the IFN-
-IL-4 ratio of T cells (Th1/Th2) in the MBP
Ac120-reactive population.
Intramuscular coimmunization with adenoviruses expressing either
IL-4 or IL-10 cytokine disrupts the protective response generated by
the Ad5E1 mV
8.2 vector alone
We have previously reported that the generation of effective
regulatory CD4 T cells was cytokine-dependent (25). To
generate effective regulatory CD4 T cells, we had shown that a Th1
cytokine milieu during their priming was required. To test the
stringency of this requirement, we coadministered with the Ad5E1V
8.2
vector, the recombinant adenovirus vectors expressing either IL-4 or
IL-10 by i.m. injection. Each of these vectors had been previously
demonstrated in other mouse model systems to alter immune responses.
The IL-4 vector was used to skew immune responses in a Th2 direction in
B10.D2 mice to render them susceptible to leishmaniasis
(32). The IL-10 vector has been previously used to induce
a transient immunosuppression that controlled inflammation induced by
bacteria (33). We reasoned that each vector could disrupt
the generation of regulatory cells by altering the cytokine
microenvironment. As shown in Fig. 6, coadministration of either an IL-4 or IL-10 cytokine vector with the
Ad5E1V
8.2 vector resulted in exacerbation of EAE, while
administration of the Ad5E1 mV
8.2 vector alone or together with the
control vector DL70-3 significantly protects mice from EAE.
|
8.2 vector changes both the
proliferative and cytokine response generated by CD4 Treg cells
reactive to B5
As shown in Fig. 7, the
proliferative response to the B5 determinant of the V
8.2 TCR was
significantly reduced when the Ad5E1 mV
8.2 vector was coadministered
with either the IL-4 or IL-10 vector. Proliferative responses to B5 in
both spleen and draining lymph nodes were present (SI
3) when the
Ad5E1 mV
8.2 vector was administered with the control vector DL70-3.
No significant proliferative response was detected to B1, the control
peptide representing the region aa 130 of the V
8.2 TCR, in any
treatment group.
|
8.2 vector response were detected
in animals after the IL-4 or IL-10 cytokine treatments. As shown in
Table II, ELISA-spot analysis
revealed a Th1 bias in response to B5 peptide in both spleen and
draining lymph node cells isolated 10 days after i.m. immunization with
the Ad5E1 mV
8.2/DL70-3 mixture. The IFN-
-IL-4 ratio was 1.42 vs
2.08 in spleen and lymph node in Ad5E1 mV
8.2/DL703 treated mice,
respectively. This was in contrast to the ratios found in treatment
groups that received IL-4 or IL-10 vector in addition to the Ad5E1
mV
8.2 vector. In splenocytes recovered from the IL-4- and
IL-10-treated mice, a Th2 bias was evident and IFN-
-IL-4 ratios were
0.27 and 0.44, respectively. The Th2 bias was also noticed in draining
lymph node cells after IL-4 treatment; however, in IL-10-treated mice
very few spots were detected. This possibly could reflect the
immunosuppressive effect of IL-10 on the local tissue response.
|
| Discussion |
|---|
|
|
|---|
8.2) expressing the murine TCR V
8.2 chain to prevent EAE
in B10.PL mice induced either with whole murine MBP or its dominant
N-terminal encephalitogenic determinant. We have previously shown that
T cell clones raised against the dominant MBP determinant in B10.PL
mice were highly restricted in their V
gene usage with
80% of
the T cells displaying the V
8.2 TCR (16). Thus, in the
B10.PL model of EAE, encephalitogenic T cells with such limited V gene
usage provide an excellent model target for intervention. We and others
have previously used adenovirus vectors expressing transgenes as
powerful immunogens to generate protective immunity to infectious
diseases and in cancer therapy (2, 4, 5, 6, 7, 9, 10, 13, 14, 43). Adenovirus vectors provide the ability to induce strong
immune responses owing to their transient high expression relative to
retrovirus vectors or naked DNA. It was predictable that an adenovirus
vector directly expressing the TCR from encephalitogenic T cells would
induce prolific cognate T cell responses with regulatory function.
In an attempt to gain some insight into the mechanism of V
8.2
vector-induced protection, we have examined the induction of a CD4 Treg
population that has been extensively characterized in our laboratory.
We were able to demonstrate a significant recall response to the B5
peptide that contains the Fr3 region of the V
8.2 TCR. This region is
recognized by naturally primed Treg cells generated during the recovery
phase of MBP-induced EAE in B10.PL mice (18).
Adenovirus vector expression of the V
8.2 TCR induced CD4 regulatory
responses to the same region of the TCR as that previously witnessed
after natural recovery from EAE or that seen after immunization with
peptide, recombinant TCR, and DNA vaccination (18, 21, 44, 53). It will be important to directly compare the efficacy and
efficiency of the adenovirus vector approach to that of other reported
TCR-based modalities. It appears that the adenoviral vector-mediated
delivery of TCR is quite efficient in the control of EAE. For example,
a single i.m. immunization with V
8.2 DNA does not significantly
protect mice from EAE (three weekly injections are required) (45, 53). However in this regard, the protection against EAE induced
with whole MBP afforded by 2 x 109 PFU of
the Ad5E1 mV
8.2 vector demonstrated that protection was significant
especially at the later time points with all mice remaining
disease-free. No relapses were evident in Ad5E1 mV
8.2 vector-treated
mice while some animals in the control group relapsed. This effective
protection may provide an overriding advantage in the use of adenovirus
vector for treatment of autoimmune conditions in that establishment of
a potentially lifelong Treg cell memory response may be generated which
can be evoked by any later activation of encephalitogenic T cells.
We have previously reported that another critical feature of
TCR-centered regulation of EAE in B10.PL mice is the requirement that
TCR peptide-reactive regulatory CD4 T cells secrete a Th1 cytokine
profile (25). Ad5E1 mV
8.2 vector administration resulted in priming
of B5-reactive Treg cells predominantly secreting IFN-
, which is
consistent with the findings from our previous report (25)
as well as one describing vaccination with a vaccinia virus vector
expressing the V
8.2 TCR (46). The resultant response to
the dominant determinant of murine MBP, Ac120, following treatment
with the V
8.2 TCR adenovirus vector revealed a skewing toward Th2
with a dramatically reduced level of IFN-
production. We are also in
the process of using IFN-
knockout mice to fully investigate the
requirement for this cytokine in generation of a regulatory
response.
The results we have generated using adenovirus vectors expressing IL-4
or IL-10 to disrupt the protective response generated by Ad5E1 mV
8.2
vector immunization alone add further support for the Th1 requirement
in regulatory cell induction. ELISA-spot analysis suggested two
possible different mechanisms for interference with the protective
response generated by Ad5E1 mV
8.2 vector in response to cytokine.
IL-4 vector resulted in skewing of the B5 response in the draining node
toward a Th2 profile. This could effectively prevent the development of
Th1 regulatory cells and loss of normal physiologic regulation leading
to exacerbation of disease. In IL-10 vector-treated mice, few spots of
either IFN-
or IL-4 were detected suggesting a direct
immunosuppression of B5-reactive Treg cells. However, it is possible
that lymphocytes isolated from this site could produce a unique
phenotype (expressing TGF-
for example), although we have not yet
fully explored this possibility. The mechanism of action of IL-10 and
its impact on EAE is still unclear, but it has been shown to exert
either no effect or efficacy in the prevention of disease (47, 48). In this study, we propose that the tissue-localized
expression of IL-10 in the context of the microenvironment prevents the
development of a Th1-directed B5 response.
The importance of the Th1 requirement may be reflected in the following
considerations: we have proposed that IFN-
production by CD4 Treg
may be required to up-regulate costimulatory molecules on APC for the
appropriate induction of a CD8 Treg population. These CD8 T cells then
become able to induce apoptosis of V
8.2+ Th1
pathogenic cells,4
leaving behind Th2 cells which are less susceptible to apoptosis. This
results in deviation of the global response to MBP in a Th2 direction.
IL-4 production by MBP-specific T cells was also a characteristic of
the protection reported following vaccination with DNA encoding V
8.2
TCR (22, 45, 53). Given the importance of inducing Treg
for disease recovery, the ability to modify effector phenotypes of Treg
cells by cytokine modulation may be decisive in optimizing regulatory
control. We plan to include different cytokines in future studies as
adjuvants to enhance protection induced by the Ad5E1V
8.2 vector, as
well as to enhance response using other methods such as multimerization
(49).
In this study, we have not yet documented directly whether protection
is dependent upon a CD8 regulatory population. In our earlier work
using mutants of recombinant single chain TCR (21) or DNA
constructs (53), we were able to demonstrate that the region from
4150 of the V
8.2 TCR is essential in the induction of the
protective regulatory CD8 response. In addition, we have been able to
generate short-term CD8 Treg cell lines reactive to this region which
are able to adoptively transfer protection from EAE (N. Purohit
and V. Kumar, unpublished observations). However in this study, we were
unable to detect strong proliferative responses to this CDR1/CDR2
region of the TCR after Ad5E1 mV
8.2 vector immunization. This
finding is consistent with our previous experience and the inability of
CD8 cells to readily proliferate in vitro in B10.PL mice. In an attempt
to further address this issue, we are currently exploring CD8 function
with suitable CTL target cell lines and CD8 knockout
mice.
Because EAE serves as a prototype for T cell-mediated autoimmune
diseases, the understanding obtained in animal models of this disease
may provide some insights for the development of preventive/therapeutic
approaches for autoimmune conditions in humans. In this study, we have
reported the successful use of a recombinant adenovirus vector
expressing the murine V
8.2 TCR to induce an efficient regulatory
response and protection from EAE. The potential advantages of this
vector lie in the creation of generic therapies for autoimmune
conditions by targeting the TCR V regions of pathogenic T cells. The
ability of the Ad5 vectors to deliver whole TCR genes in a highly
efficient manner allows processing of determinants into both class I
and II pathways using the hosts endogenous proteolytic processing
enzymes. Furthermore, additional processing motifs could be inserted at
crucial sites to improve accessibility for known MHC binding domains
(50). Providing the whole TCR gene in the adenovirus
eliminates the necessity of matching MHC binding domains to each of the
different TCR V regions.
If a given pathogenic condition involves induction of more than a
single TCR-specific repertoire via inter or intramolecular spread, it
may be necessary for an additional regulatory repertoire to expand. In
a recent report, DNA vaccination using two diverse V
TCR chains of
cardiac myosin-restricted T cells regulated autoimmune myocarditis,
demonstrating that T cell-centered regulation can be achieved when more
than a single V
repertoire is involved in pathogenesis
(51). Furthermore, it may not be necessary to induce
regulation to all potential T cells reactive to an autoantigen(s), but
targeting of an appropriate dominant clone or "driver" clone
(52), accompanied by bystander suppression of other
aggressive clones, could be successful in the induction of regulation
and protection.
The experiments reported here provide a first step proof-of-principle for the development of a transiently expressed vector approach for a regulatory intervention in autoimmune conditions. The rationale for its further development as a practical therapeutic device depends on the generation of vectors with reduced immunotoxicity and the proven capacity to maintain a memory population of Treg cells.
| Acknowledgments |
|---|
8.2 recombinant adenovirus vector. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Todd A. Braciak, Torrey Pines Institute for Molecular Studies, 3550 General Atomics Court, San Diego, CA 92121-1122. E-mail address: tbraciak{at}tpims.org ![]()
3 Abbreviations used in this paper: EAE, experimental autoimmune encephalomyelitis; Treg, regulatory T; MBP, myelin basic protein; Fr3, framework 3 region; SI, stimulation index; mCMV, murine CMV; PTX, pertussis toxin. ![]()
4 L. T. Madakamutil, I. Maricic, E. Sercarz, and V. Kumar. Regulatory T cells control autoimmunity in vivo by inducing apoptotic depletion of activated pathogenic lymphocytes. Submitted for publication. ![]()
Received for publication August 23, 2002. Accepted for publication November 13, 2002.
| References |
|---|
|
|
|---|
by T cells. Proc. Natl. Acad. Sci. USA 92:9510.
8.2 T cell receptor in protection against experimental autoimmune encephalomyelitis using a live vaccinia virus vector. J. Immunol. 156:4940.[Abstract]
8.2 DNA vaccination results in immune deviation and protection from experimental autoimmune encephalomyelitis. Int. Immunol. 13:835.This article has been cited by other articles:
![]() |
T. R. F. Smith, X. Tang, I. Maricic, Z. Garcia, S. Fanchiang, and V. Kumar Dendritic Cells Use Endocytic Pathway for Cross-Priming Class Ib MHC-Restricted CD8{alpha}{alpha}+TCR{alpha}{beta}+ T Cells with Regulatory Properties J. Immunol., June 1, 2009; 182(11): 6959 - 6968. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. T. Madakamutil, I. Maricic, E. E. Sercarz, and V. Kumar Immunodominance in the TCR Repertoire of {alpha}TCR Peptide-Specific CD4+ Treg Population That Controls Experimental Autoimmune Encephalomyelitis J. Immunol., April 1, 2008; 180(7): 4577 - 4585. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gonthier, R. Llobera, J. Arnaud, and B. Rubin Self-Reactive T Cell Receptor-Reactive CD8+ T Cells Inhibit T Cell Lymphoma Growth In Vivo J. Immunol., December 1, 2004; 173(11): 7062 - 7069. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |