| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Unité de Signalisation des Cytokines and
Laboratoire de Immunorégulation, Institut Pasteur, Paris, France; and
Centre National de la Recherche Scientifique Unité Mixte de Recherche 5124, Institut de Génétique Moléculaire, Montpellier, France
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/
) in shaping T
cell responses has been demonstrated, but the direct effects of IFN on
T cells are still poorly characterized. Particularly, because IFN exert
an antiproliferative activity, it remains elusive how the clonal
expansion of effector T cells can paradoxically occur in the event of
an infection when large amounts of IFN are produced. To address this
issue, we have studied the effects of type I IFN in an in vitro
differentiation model of human primary CD4+ T cells. We
found that IFN- treatment of resting naive T cells delayed their
entry into the cell cycle after TCR triggering. Conversely, the ongoing
expansion of effector T cells was not inhibited by the presence of IFN.
Moreover, activated T cells showed a significantly reduced induction of
IFN-sensitive genes, as compared with naive precursors, and this
decline occurred independently of subset-specific polarization. The
residual type I IFN response measured in activated T cells was found
sufficient to inhibit replication of the vesicular stomatitis virus.
Our data suggest that the activation of T lymphocytes includes
regulatory processes that restrain the transcriptional response to IFN
and allow the proliferation of effector cells in the presence of this
cytokine. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and 1 IFN- in humans, are powerful
defense factors in the fight of the host against infection by viruses
and other microorganisms. Under normal physiological conditions, these
proteins are secreted at low levels in primary lymphoid organs and may
regulate homeostatic processes (1, 2). Upon viral
infections, type I IFN are rapidly produced and exert their action by
protecting cells from viral replication and by stimulating cytotoxic
activities of NK cells and macrophages (3). Importantly,
IFN exhibit modulatory effects on several elements of the Ag-specific
adaptive immune response. In particular, type I IFN enhance the
maturation and activities of dendritic cells
(DC),3 which
themselves represent a major source of this cytokine. The mechanism and
the extent of IFN production appear to vary considerably according to
the nature, location, and strength of the stimulus and to the
repertoire of cell surface receptors expressed on DC populations
(4). When in contact with viruses or other stimuli, a rare
subset of plasmacytoid-like cells was found to secrete massive amounts
of type I IFN and to mature into DC. These specialized cells are
present in the blood and in the T cell areas of inflamed lymph nodes,
both in humans and in mice (5, 6). In humans, the IFN
secreted by these cells directly contribute to the development of
CD4+ T lymphocytes along the Th1-specific
lineage, via the induction of the 2-chain of the IL-12R
(7, 8, 9).
Given the potent antiproliferative activity of IFN, an open question is
whether T lymphocytes can be activated and expand efficiently in the
presence of large amounts of type I IFN produced during some
infections. In this study, we report that human naive
CD4+ T lymphocytes incubated with IFN- and
thereafter differentiated in vitro were delayed in their entry into
cell division. Conversely, IFN did not inhibit the proliferation of
2-day-activated T cells. The analysis of the transcriptional response
to type I IFN of naive and activated T cells demonstrated a reduced
inducibility of IFN-sensitive genes in activated cells as compared with
their naive precursors. The decline of the transcriptional response was
an early postactivation event; it occurred independently of
subset-specific polarization; and it was not due to impaired activation
of signaling components. Overall, our data show that, in human T cells,
responses to type I IFN are modulated according to the activation state
of the cell.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human neonatal leukocytes were isolated from freshly collected
heparinized neonatal blood by Ficoll-Paque density gradient
centrifugation. CD4+/CD8+ T
cells were purified by negative selection using a pan T isolation kit
(Miltenyi Biotec, Auburn, CA). CD8+ T cells were
then purified by positive selection with anti-CD8 microbeads
(Miltenyi Biotec). The purity of the
CD4+/CD45RA+ and
CD8+/CD45RA+ T cells was
>98%, as determined by flow cytometry. Naive
CD4+ and CD8+ cells were
stimulated with plate-bound anti-CD3 (TR66 (10)) and
anti-CD28 Abs (BD PharMingen, San Diego, CA). When indicated, naive
CD4+ cells were stimulated in the presence of 2.5
ng/ml IL-12 (Hoffmann-LaRoche, Nutley, NJ) and 200 ng/ml neutralizing
anti-IL-4 Abs (BD PharMingen) for Th1 cultures; or 1 ng/ml IL-4 (BD
PharMingen), 2 µg/ml neutralizing anti-IL-12 17F7 and 20C2 Abs (a
gift from U. Gubler, Hoffman-LaRoche, Nutley, NJ), and 200 ng/ml
neutralizing anti-IFN-
(BD PharMingen) for Th2 cultures; or
neutralizing anti-IL-4, anti-IL-12, and anti-IFN- Abs
for Th0 cultures. Cells were washed on day 3 and expanded in RPMI
medium supplemented with 10% FCS and 50 U/ml IL-2 (Chiron, Emeryville,
CA). The specific polarized cytokine production was confirmed by single
cell analysis of intracellular IFN- and IL-4 production. Briefly, T
cells were collected 6 days after priming, washed, and stimulated for
2 h at 37°C with PMA (50 ng/ml; Sigma-Aldrich, St. Louis, MO)
and ionomycin (1 µg/ml; Sigma-Aldrich). The cultures were incubated
for an additional 2 h after adding brefeldin A (10 µg/ml;
Sigma-Aldrich). Cells were then fixed with 4% paraformaldehyde,
permeabilized with saponin, and stained with anti-human IFN-
FITC and anti-human IL-4 PE (BD PharMingen). Cells were analyzed
with a FACScan flow cytometer (BD Biosciences, Le Pont de Claix,
France). A representative cytokine profile is shown in Fig. 3A.
|
Naive CD4+ T cells were incubated in the
presence or absence of 1 nM IFN-2 for 20 h. Cells were then
washed and stained with 2.5 µM CFSE (Molecular Probes, Eudene, OR)
for 10 min at 37°C, before activation with anti-CD3/CD28 under
polarizing or nonpolarizing conditions, as described above. Untreated
cells were activated in the presence or absence of 1 nM IFN-2 (see
scheme in Fig. 1). At times indicated, cells were analyzed for CFSE
intensity as a function of cell division. Cells were analyzed with a
FACScan flow cytometer (BD Biosciences). Dead cells were distinguished
by their characteristics on the forward vs side scatter bit maps from
the cytofluorograph. This method was in agreement with the analysis of
7-aminoactinomycin D staining (11). Anti-p27 Ab was
purchased from Santa Cruz Biotechnology (Santa Cruz, CA). In another
set of experiments, anti-CD3/CD28-activated and polarized cells
were harvested 2 days after stimulation (see scheme in Fig. 2) and
seeded in triplicates in the presence or absence of 1 nM IFN-2 and
in the presence of IL-2 (50 U/ml). Cell proliferation was assessed at
the indicated times, by measuring [3H]thymidine
incorporation. A total of 1 µCi of
[3H]thymidine was added for 16 h to the
cultures.
|
|
Total RNA from cells treated with increasing doses of IFN-2
and IFN- (ranging from 1 pM to 1 nM) for different times was
purified using the High Pure RNA Isolation kit (Roche Diagnostics,
Mannheim, Germany). Reverse transcriptions were primed with
oligo(dT) and performed using the murine leukemia virus reverse
transcriptase from Invitrogen Life Technologies (Cergy Pontoise,
France). Quantitative PCR assays were done at least in
triplicates using the SYBR Green I technology on a LightCycler (Roche
Diagnostics). The primer pairs used were: GAPDH forward,
5'-ACAGTCCATGCCATCACTGCC-3', and reverse,
5'-GCCTGCTTCACCACCTTCTTG-3'; 6-16 forward,
5'-CATGCGGCAGAAGGCGGTAT3', and reverse,
5'-CGACGGCCATGAAGGTCAGG-3'; MxA forward,
5'-ATCCTGGGATTTTGGGGCTT3', and reverse, 5'-CCGCTTGTCGC
TGGTGTCG-3'; IRF7 forward, 5'- GAGCCCTTACCTCCCCTGTTAT3', and
reverse, 5'-CCACTGCAGCCCCTCATAG-3', 2', 5'; oligoadenylate
synthetase (25A69) forward, 5'-AACTGCTTCCGACAATCAAC-3', and reverse,
5'-CCTCCTTCTCCCTCCAAAA-3'. Quantification standard curves were
obtained using PCR products diluted in 10 µg/ml sonicated salmon
sperm DNA. The specificity of PCR products was checked by melting curve
analysis and DNA sequencing. Normalization of the IFN-stimulated gene
(ISG) expression was done against GAPDH. Only ratios with a SE <0.2
log (95% confidence limits) were considered for the determination of
induction levels.
Antiviral assay
Th1 and Th2 cells were treated or not with 1 nM IFN-2 for
24 h. Cells were then infected with vesicular stomatitis virus
(VSV) at a multiplicity of infection >1 for 1 h, then extensively
washed and incubated for 8 h, a time corresponding to one virus
replication cycle. Cells were lysed by three cycles of
freezing/thawing, and the VSV-containing medium was titered on murine L
cells for cytopathic effect by a limiting dilution assay.
FACS analysis and Abs
Surface type I IFN receptor 1 (IFNAR1) expression was monitored
with 10 µg/ml of AA3 mAb (a gift of L. Runkel, Biogen, Cambridge,
MA (12)). IFNAR2 was monitored with the MMHAR-2 mAb
(PBL; Biochemical Laboratories, New Brunswick, NJ), followed by
incubation with 10 µg/ml of biotinylated anti-mouse IgG Ab and
streptavidin-PE (Jackson ImmunoResearch Laboratories, West Grove, PA).
Surface IL-12R1 expression was monitored with 5 µg/ml of the rat
anti-human IL-12R1 2B10 mAb (a gift of U. Gubler)
(13), followed by incubation with biotinylated polyclonal
anti-rat IgG Abs and with streptavidin-PE. Anti-CD69 PE and
anti-CD25 FITC Abs were purchased from BD PharMingen.
Anti-phospho-STAT1 were purchased from New England Biolabs (Beverly,
MA), and anti-STAT2 from Upstate Biotechnology (Lake Placid, NY).
Anti-phospho-STAT2 was a gift from D. E. Levy (New York University
School of Medicine, New York, NY), and anti-STAT1 was a gift from
C. W. Schindler (Columbia University, New York, NY).
Electrophoretic mobility shift assay
Gel shift assays were performed, as described previously
(14). Briefly, naive and Th1/Th2 cells (2 x
107 cells) were incubated or not with 1 nM
IFN-2 for 1 h, and nuclear extracts were prepared, as described
previously (15). A total of 15 µg of nuclear extracts
were incubated with a 32P-labeled DNA probe
corresponding to the ISG15 gene IFN-stimulated response
element (5'-GATCCTCGGGAAAGGGAAACCGAAACTGAAGCC-3'),
fractionated on a nondenaturing polyacrylamide gel, and
autoradiographed.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
delays cell cycle entry of naive T cells
To evaluate the effect of IFN- on T cell activation, we first
studied whether IFN- affected the entry of naive cells into the cell
cycle. Human naive CD4+ cells were purified from
neonatal leukocytes and incubated or not with 1 nM IFN-2 for 20
h. Cells were then labeled with CFSE and activated using plate-bound
anti-CD3 and anti-CD28 mAbs, under conditions allowing the
establishment of Th1 cell lines (9). Cells that had not
been pretreated with IFN were divided into two pools, one of which was
activated in the presence of IFN (scheme in Fig. 1A). At 48 h
postactivation, the analysis of CFSE fluorescence dilution showed that
cells pretreated with IFN had not entered into the cell cycle, while
24% of untreated cells were dividing (Fig. 1A,
top and middle panels). Conversely, the IFN
treatment of cells at the time of activation did not affect their
proliferation, and CFSE profiles were comparable to those obtained for
untreated cells (Fig. 1A, middle and bottom
panels). Similar results were obtained with cells polarized under
Th2 or nonpolarizing Th0 conditions (data not shown), suggesting that
IFN acts independently of the presence of polarizing cytokines. The
effect of IFN was reproducible, and the analysis of three independent
donors showed inhibition of proliferation after IFN pretreatment,
ranging from 50 to 100%. When CFSE fluorescence was analyzed at
60 h postactivation, the difference in the percentages of dividing
cells between treated and untreated samples was reduced (Fig. 1A, right panels), demonstrating that IFN does
not block, but rather delays cell cycle entry.
The cyclin-dependent kinase inhibitor p27Kip1 is a negative regulator of the cell cycle and, in particular, a candidate target of cytokine-mediated T cell growth regulation (16, 17). Therefore, we monitored the level of p27 within the same cell samples used for CFSE analysis. At 48 h postactivation, the p27 level was considerably reduced in both untreated cells and in cells treated with IFN at the time of activation, in comparison with resting naive cells (Fig. 1B, compare lanes 4 and 5 with lane 1). Conversely, cells that had been treated with IFN before activation showed a consistent 2-fold increased level of p27 in comparison with untreated cells (Fig. 1B, lane 3). At 60 h postactivation, the p27 level in treated and untreated cells was comparable (Fig. 1B, lanes 6–8). Thus, the p27 content appears to correlate with the CFSE profiles observed in the different cell samples. We also compared p27 levels in nonactivated naive cells incubated or not with IFN for 20 h. No detectable increase was observed upon IFN treatment (Fig. 1B, lanes 1 and 2).
Next, we investigated the effect of IFN-2 on the ongoing
proliferation of 2-day-activated CD4+ T cells.
Naive precursors were activated with CD3/CD28 mAbs under Th2 or Th0
conditions. Two days postactivation, cells were replated in the
presence or absence of IFN-2, and proliferation was measured by
[3H]thymidine incorporation. In contrast to the
results obtained in naive cells, the proliferation of activated cells
was not affected by IFN (Fig. 2). Similar
experiments performed with Th1, Th2, and Th0 cells from three
independent donors yielded comparable results (data not shown).
Overall, these results demonstrated a different susceptibility of naive
and effector T cells to the antiproliferative activity of IFN-.
IFN-/ responsiveness is down-modulated upon T cell
activation
Type I IFN induce the expression of a large set of ISGs, whose
promotors are activated by the trimeric ISG factor 3 (ISGF3) complex,
composed by STAT1, STAT2, and IRF-9 (18). To evaluate the
IFN responsiveness of T lymphocytes upon differentiation, we measured
the transcriptional response of naive and effector T cells, by
quantifying the level of expression of some ISGs. In pilot experiments,
the accumulation of ISG mRNA in IFN--treated naive cells was found
to peak at 4–6 h (data not shown). Naive cells were activated for 6
days under Th1-polarizing and Th0-nonpolarizing conditions (see the
cytokine production profiles in Fig. 3A). Naive and activated cells
were incubated for 4 h with increasing doses of IFN-2 or
IFN-, and total RNA was extracted. The levels of the ISG mRNA were
quantified by real-time PCR. The GAPDH gene was chosen as the internal
endogenous reference, because its expression was not affected by IFN
treatment (data not shown). After normalizing ISG mRNA levels to the
GAPDH level in each sample, the fold of induction of each gene was
expressed as the ratio between treated and untreated samples in each
cell subset. In Fig. 3B, the fold of induction of the 6-16
gene was plotted as a function of IFN concentration. In naive cells,
the 6-16 gene was induced 90-fold in response to as little as 1 pM of
IFN-2. Conversely, in both activated T cell populations, this gene
was induced 10-fold. Importantly, this difference could not be
overcome by higher doses of IFN. The quantification of the 6-16 mRNA
induced by IFN-2 and IFN- in cells derived from independent
donors showed similar results, confirming that the 6-16 gene was at
least 10-fold less induced in activated cells than in naive precursors.
The induction profile of three other ISGs (MxA, the 69-kDa 2'-5'
oligoadenylate synthetase, and IRF7) was studied and, depending on the
gene, a 15- to 50-fold lower induction was observed in activated cells
(Fig. 3C). The phenomenon described above was not restricted
to the CD4+ subset, because an average 10-fold
reduced induction of the 6-16 mRNA by IFN-2 was also observed in
activated CD8+ cells, as compared with their
naive precursors (Fig. 3D).
The transcriptional response to type I IFN was also measured at earlier
stages of Th cell differentiation. Purified naive
CD4+ cells from three independent donors were
activated under Th1, Th2, or Th0 conditions. The 6-16 mRNA induction by
IFN-2 was measured in naive cells and in cells harvested at 24, 48,
and 72 h after activation. Independently of the commitment to a
specific Th subset, the reduction of the IFN response was observed at
24 h after activation and was maximal at 72 h, when most of
the cells had started to proliferate (Fig. 4A). Overall, these results
suggested that the decreased transcriptional response to IFN of
differentiated Th subsets was related to the activation/proliferation
of the cells, rather than to a subset-specific polarization event.
These results also raised the question as to whether the altered
IFN- response of effector cells was linked to the activation process
itself, or whether it was associated to proliferation. To this end, we
performed an experiment in which cells were monitored in parallel for
surface expression of activation markers (CD69 and CD25), for CFSE
fluorescence dilution, and for IFN responsiveness. These analyses were
conducted on naive cells and on cells activated for 14 and 64 h
under Th1-polarizing conditions. At 14 h postactivation, cells had
not yet entered proliferation, while over 60% of them expressed CD69
and CD25 markers (Fig. 4B). Importantly, these cells
displayed a 12-fold reduced 6-16 mRNA accumulation as compared with
naive cells. At 64 h postactivation, all cells were proliferating,
and a further 2-fold reduction in the transcriptional response to
IFN- was measured. These results demonstrated that the decline in
the IFN response occurred early upon T cell activation, before entry
into proliferation.
|
Because type I IFN play a determinant role in protecting cells
from viruses, we asked whether, despite the lower magnitude of ISG
induction, activated T cells were protected by IFN from viral
infection. To answer this question, we tested whether IFN-2 induced
an antiviral state against VSV in Th1 and Th2 effector cells. The two
populations were treated with IFN-2 and exposed to VSV, and, after a
single round of virus replication, the virus yield was measured. An
IFN-2-mediated reduction in the VSV yield was observed in both Th1
and Th2 cells (Fig. 5), suggesting that
the residual IFN response measured in these cells is sufficient to
induce a complete antiviral response.
|
To investigate the mechanism underlying the decline in the
transcriptional response to type I IFN observed in activated
lymphocytes, we monitored the cell surface level of the IFN receptor
chains, IFNAR1 and IFNAR2, and, in parallel, the level of the
IL-12R1 chain, in naive and in polarized cells at different times
after activation. The level of IFNAR2 remained constant in the three
cell subsets (data not shown), while the level of IFNAR1 declined after
activation, so that 6-day-activated cells expressed nearly half the
level present on precursor cells (Fig. 6A). A rapid increase in the
IL-12R1 level was observed in both Th populations (Fig. 6A, right panel). To evaluate the consequence of
the IFNAR1 reduction, we measured the extent of activation of STAT1 and
STAT2, in naive and in differentiated cells. The two forms of STAT1
(p91 and p84) were tyrosine phosphorylated by IFN-2 in the three
cell subsets (Fig. 6B). The magnitude of phosphorylation was
difficult to compare due to the increase of both STAT1 isoforms in Th1
cells (19). However, taking into account the relative
amount of proteins, the percentage of phosphorylated p91 and p84 did
not remarkably change in activated cells in comparison with naive
precursors. Conversely, the STAT2 content remained constant and was
therefore regarded as more indicative (Fig. 6B). STAT2 was
tyrosine phosphorylated by IFN-2 to comparable levels, in a
dose-dependent fashion and with similar kinetics, in the three cell
subsets (Fig. 6, B and C). No difference in the
induced phosphorylation level of STAT3 could be observed (data not
shown). Next, we measured, by EMSA, the activation of the
transcriptional ISGF3 complex in nuclear extracts obtained from naive
and differentiated cells that were treated for 1 h with IFN-2.
As shown in Fig. 6D, a comparable level of activated ISGF3
was detected in the three cell subsets. Overall, these results
demonstrate that the decline in the transcriptional response of Th1/Th2
to type I IFN is not due to a reduced sensitivity of these cells to the
ligand, nor to impairment of receptor-generated signaling events, but
rather may result from global changes occurring upon activation.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our results point to the ability of IFN to impinge on regulatory
mechanisms that maintain T cell quiescence. A possible role of IFN-
in the regulation of p27Kip1 was suggested by the
finding of a faster p27 decline upon activation of murine
STAT1-deficient T lymphocytes in comparison with wild-type lymphocytes
(21). In our experimental setting, we could observe that
2-day-activated cells that had been pretreated with IFN contained 50%
more p27 than untreated cells. A similar finding was reported in
PHA-activated peripheral T lymphocytes (22). Thus, IFN may
counteract the p27 degradation induced by the TCR engagement (23, 24).
When added at the time of, or after, activation, IFN- was
ineffective in perturbing cell proliferation. This result is consistent
with previous observations obtained in PHA-activated peripheral
lymphocytes (25). Conversely, a related study showed that
addition of IFN- impaired T cell entry in S phase (22).
We believe that the discrepancy between this and our result is due to
the different activation protocol used, because, in this latter study,
only 2% of cells were cycling at the time of IFN addition. Our
findings suggest that signals induced by TCR triggering override the
IFN effect on the control of cell proliferation. Thus, the IFN
antiproliferative action may overcome mitogenic stimuli, depending on
the activation state of T cells at the time of exposure to the
cytokine.
A second phenomenon that is coupled to the activation/expansion of T
lymphocytes is the reduction of the magnitude of gene induction by type
I IFN. We could demonstrate that the 10-fold reduced inducibility of
ISGs was an early postactivation event, being detectable as soon as
14 h after T cell activation. Upon engagement of the TCR, the
IL-12R1 chain is induced and thereafter maintained on both Th
subsets. We have recently shown that the IL-12R1 chain, when
ectopically expressed in human fibroblasts, down-modulates IFN-
signaling (26). Seemingly, the up-regulation of the
IL-12R1 in activated cells could account for their decreased IFN
response. Although we indeed observed a decreased surface IFNAR1 level
in activated CD4+ cells, a number of observations
argue for the involvement of other mechanisms. The reduced IFN response
of fibroblasts expressing the 1-chain correlated with impaired
activation of the components of the Janus kinase/STAT pathway, and it
could be overcome by higher IFN doses (26). On the
contrary, the reduced IFN response of activated T cells could not be
attributed to decreased STAT activation, nor to impaired ISGF3
formation, and it could not be overcome by higher IFN doses. These
findings suggest that the ability of activated T cells to maximally
induce ISG expression is affected, rather than their overall
sensitivity to the cytokine. The lack of impairment of STAT activation
argues against a possible implication of members of the suppressors of
cytokine signaling family, known to dampen STAT phosphorylation
(27). A recent study showed that, upon a prolonged
exposure to low doses of IFN-, T cells became refractory to further
IFN- treatment. Interestingly, this reduced IFN response appeared to
correlate with high levels of STAT1 (28). This does not
seem to be the case in our model because, despite a remarkable
difference in the STAT1 content between Th1 and Th2 cells, the response
to IFN was comparably reduced in the two cell subsets.
Altogether, our data point to a layer of regulation of ISGs by type I
IFN that would be superimposed on the known framework and would depend
on the state of activation of the cells. Although we could demonstrate
the formation of the ISGF3 complex in activated T cells, we cannot
exclude that further modifications of components of this complex are
required for its maximal activity (29). Transcriptional
initiation relies on recruitment of coactivators that, by acetylating
or deacetylating nucleosomal histones, modulate transcription.
Interestingly, some of these cofactors have been shown to directly
interact with STAT proteins (30, 31). In this regard, Levy
and coworkers (32) recently demonstrated that the level of
acetylation of the histone H3 associated to ISG promoters is enhanced
in response to IFN-/ and that the coactivator GCN5 is recruited
to the transactivation domain of STAT2. Thus, the differential
expression, activity, or availability of coactivators could account for
the reduced transcriptional response to IFN observed in activated T
cells. We cannot, however, rule out an activation-dependent mechanism
of ISG regulation that occurs at the posttranscriptional level and
affects messenger stability.
It has been recently reported that activated T cells lose their ability to respond to IL-6-induced survival signals, but still respond to IL-6-induced differentiation-promoting signals (33). Thus, the complex global changes taking place in T lymphocytes upon engagement of the TCR appear to modify the cellular responses to cytokines. In our model, we propose that the activation of naive T cells is associated with a developmental rewiring that restrains the transcriptional response to IFN. One possibility is that this decline accounts for the resistance of activated cells to the antiproliferative effect of IFN. Cytokine signaling may be regulated according to the activation state of the cell to adapt their responses to the various environmental stimuli. An attractive possibility awaiting further investigation would be that a maximal response to type I IFN is restored in memory T cells, allowing them to react to the low constitutively secreted IFN and to survive during the phase of immune quiescence (34).
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Sandra Pellegrini, Unité de Signalisation des Cytokines, Institut Pasteur, 25, rue du Dr. Roux, 75724 Paris cedex 15 France. E-mail address: pellegri{at}pasteur.fr
3 Abbreviations used in this paper: DC, dendritic cell; IFNAR, type I IFN receptor; ISG, IFN-stimulated gene; ISGF3, ISG factor 3; VSV, vesicular stomatitis virus.
Received for publication July 26, 2002. Accepted for publication November 12, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/-producing cells link innate and adaptive immunity. J. Exp. Med. 192:219. chain. Eur. J. Immunol. 26:345.[Medline]
responsiveness by the duration of Janus kinase activity. J. Biol. Chem. 272:21872.. J. Immunol. 164:1286. inhibits proliferation in human T lymphocytes by abrogation of interleukin 2-induced changes in cell cycle-regulatory proteins. Cell Growth Differ. 10:575. activates multiple STAT proteins and up-regulates proliferation-associated IL-2R, c-myc and pim-1 genes in human T cells. Blood 93:1980.1a. J. Interferon Cytokine Res. 22:491.[Medline]
/-induced transcription. Cell 104:731.[Medline]
. Nature 383:344.[Medline]
and IFN-: a link between immune memory and chronic inflammation. Immunol. Today 21:337.[Medline]Related articles in The JI:
This article has been cited by other articles:
|
|
 |
|
  K. M. E. Gallagher, S. Lauder, I. W. Rees, A. M. Gallimore, and A. J. Godkin Type I Interferon (IFN{alpha}) Acts Directly on Human Memory CD4+ T Cells Altering Their Response to Antigen J. Immunol., September 1, 2009; 183(5): 2915 - 2920. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Pilz, W. Kratky, S. Stockinger, O. Simma, U. Kalinke, K. Lingnau, A. von Gabain, D. Stoiber, V. Sexl, T. Kolbe, et al. Dendritic Cells Require STAT-1 Phosphorylated at Its Transactivating Domain for the Induction of Peptide-Specific CTL J. Immunol., August 15, 2009; 183(4): 2286 - 2293. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Dunn, M. Brunetto, G. Reynolds, T. Christophides, P. T. Kennedy, P. Lampertico, A. Das, A. R. Lopes, P. Borrow, K. Williams, et al. Cytokines induced during chronic hepatitis B virus infection promote a pathway for NK cell-mediated liver damage J. Exp. Med., March 19, 2007; 204(3): 667 - 680. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. S. Berenson, M. Gavrieli, J. D. Farrar, T. L. Murphy, and K. M. Murphy Distinct Characteristics of Murine STAT4 Activation in Response to IL-12 and IFN-{alpha} J. Immunol., October 15, 2006; 177(8): 5195 - 5203. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Severa, M. E. Remoli, E. Giacomini, J. Ragimbeau, R. Lande, G. Uze, S. Pellegrini, and E. M. Coccia Differential responsiveness to IFN-{alpha} and IFN-{beta} of human mature DC through modulation of IFNAR expression J. Leukoc. Biol., June 1, 2006; 79(6): 1286 - 1294. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Aichele, H. Unsoeld, M. Koschella, O. Schweier, U. Kalinke, and S. Vucikuja Cutting edge: CD8 T cells specific for lymphocytic choriomeningitis virus require type I IFN receptor for clonal expansion. J. Immunol., April 15, 2006; 176(8): 4525 - 4529. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Le Bon, V. Durand, E. Kamphuis, C. Thompson, S. Bulfone-Paus, C. Rossmann, U. Kalinke, and D. F. Tough Direct Stimulation of T Cells by Type I IFN Enhances the CD8+ T Cell Response during Cross-Priming. J. Immunol., April 15, 2006; 176(8): 4682 - 4689. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Havenar-Daughton, G. A. Kolumam, and K. Murali-Krishna Cutting Edge: The Direct Action of Type I IFN on CD4 T Cells Is Critical for Sustaining Clonal Expansion in Response to a Viral but Not a Bacterial Infection J. Immunol., March 15, 2006; 176(6): 3315 - 3319. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Gil, R. Salomon, J. Louten, and C. A. Biron Modulation of STAT1 protein levels: a mechanism shaping CD8 T-cell responses in vivo Blood, February 1, 2006; 107(3): 987 - 993. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kawamura, N. Kadowaki, T. Kitawaki, and T. Uchiyama Virus-stimulated plasmacytoid dendritic cells induce CD4+ cytotoxic regulatory T cells Blood, February 1, 2006; 107(3): 1031 - 1038. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. A. Kolumam, S. Thomas, L. J. Thompson, J. Sprent, and K. Murali-Krishna Type I interferons act directly on CD8 T cells to allow clonal expansion and memory formation in response to viral infection J. Exp. Med., September 6, 2005; 202(5): 637 - 650. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. F. L. Coelho, G. M. de Freitas Almeida, F. J. D. Mennechet, A. Blangy, and G. Uze Interferon-{alpha} and -{beta} differentially regulate osteoclastogenesis: Role of differential induction of chemokine CXCL11 expression PNAS, August 16, 2005; 102(33): 11917 - 11922. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Dikopoulos, A. Bertoletti, A. Kroger, H. Hauser, R. Schirmbeck, and J. Reimann Type I IFN Negatively Regulates CD8+ T Cell Responses through IL-10-Producing CD4+ T Regulatory 1 Cells J. Immunol., January 1, 2005; 174(1): 99 - 109. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Dondi, G. Roue, V. J. Yuste, S. A. Susin, and S. Pellegrini A Dual Role of IFN-{alpha} in the Balance between Proliferation and Death of Human CD4+ T Lymphocytes during Primary Response J. Immunol., September 15, 2004; 173(6): 3740 - 3747. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Carbonneil, H. Saidi, V. Donkova-Petrini, and L. Weiss Dendritic cells generated in the presence of interferon-{alpha} stimulate allogeneic CD4+ T-cell proliferation: modulation by autocrine IL-10, enhanced T-cell apoptosis and T regulatory type 1 cells Int. Immunol., July 1, 2004; 16(7): 1037 - 1052. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nagai, O. Devergne, T. F. Mueller, D. L. Perkins, J. M. van Seventer, and G. A. van Seventer Timing of IFN-{beta} Exposure during Human Dendritic Cell Maturation and Naive Th Cell Stimulation Has Contrasting Effects on Th1 Subset Generation: A Role for IFN-{beta}-Mediated Regulation of IL-12 Family Cytokines and IL-18 in Naive Th Cell Differentiation J. Immunol., November 15, 2003; 171(10): 5233 - 5243. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
