The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dondi, E.
Right arrow Articles by Pellegrini, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dondi, E.
Right arrow Articles by Pellegrini, S.
The Journal of Immunology, 2003, 170: 749-756.
Copyright © 2003 by The American Association of Immunologists

Down-Modulation of Responses to Type I IFN Upon T Cell Activation1

Elisabetta Dondi*, Lars Rogge{dagger}, Georges Lutfalla{ddagger}, Gilles Uzé{ddagger} and Sandra Pellegrini2,*

* Unité de Signalisation des Cytokines and {dagger} Laboratoire de Immunorégulation, Institut Pasteur, Paris, France; and {ddagger} Centre National de la Recherche Scientifique Unité Mixte de Recherche 5124, Institut de Génétique Moléculaire, Montpellier, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The immunomodulatory role of type I IFNs (IFN-{alpha}/{beta}) in shaping T cell responses has been demonstrated, but the direct effects of IFN on T cells are still poorly characterized. Particularly, because IFN exert an antiproliferative activity, it remains elusive how the clonal expansion of effector T cells can paradoxically occur in the event of an infection when large amounts of IFN are produced. To address this issue, we have studied the effects of type I IFN in an in vitro differentiation model of human primary CD4+ T cells. We found that IFN-{alpha} treatment of resting naive T cells delayed their entry into the cell cycle after TCR triggering. Conversely, the ongoing expansion of effector T cells was not inhibited by the presence of IFN. Moreover, activated T cells showed a significantly reduced induction of IFN-sensitive genes, as compared with naive precursors, and this decline occurred independently of subset-specific polarization. The residual type I IFN response measured in activated T cells was found sufficient to inhibit replication of the vesicular stomatitis virus. Our data suggest that the activation of T lymphocytes includes regulatory processes that restrain the transcriptional response to IFN and allow the proliferation of effector cells in the presence of this cytokine.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Type I IFN, comprising 13 IFN-{alpha} and 1 IFN-{beta} in humans, are powerful defense factors in the fight of the host against infection by viruses and other microorganisms. Under normal physiological conditions, these proteins are secreted at low levels in primary lymphoid organs and may regulate homeostatic processes (1, 2). Upon viral infections, type I IFN are rapidly produced and exert their action by protecting cells from viral replication and by stimulating cytotoxic activities of NK cells and macrophages (3). Importantly, IFN exhibit modulatory effects on several elements of the Ag-specific adaptive immune response. In particular, type I IFN enhance the maturation and activities of dendritic cells (DC),3 which themselves represent a major source of this cytokine. The mechanism and the extent of IFN production appear to vary considerably according to the nature, location, and strength of the stimulus and to the repertoire of cell surface receptors expressed on DC populations (4). When in contact with viruses or other stimuli, a rare subset of plasmacytoid-like cells was found to secrete massive amounts of type I IFN and to mature into DC. These specialized cells are present in the blood and in the T cell areas of inflamed lymph nodes, both in humans and in mice (5, 6). In humans, the IFN secreted by these cells directly contribute to the development of CD4+ T lymphocytes along the Th1-specific lineage, via the induction of the {beta}2-chain of the IL-12R (7, 8, 9).

Given the potent antiproliferative activity of IFN, an open question is whether T lymphocytes can be activated and expand efficiently in the presence of large amounts of type I IFN produced during some infections. In this study, we report that human naive CD4+ T lymphocytes incubated with IFN-{alpha} and thereafter differentiated in vitro were delayed in their entry into cell division. Conversely, IFN did not inhibit the proliferation of 2-day-activated T cells. The analysis of the transcriptional response to type I IFN of naive and activated T cells demonstrated a reduced inducibility of IFN-sensitive genes in activated cells as compared with their naive precursors. The decline of the transcriptional response was an early postactivation event; it occurred independently of subset-specific polarization; and it was not due to impaired activation of signaling components. Overall, our data show that, in human T cells, responses to type I IFN are modulated according to the activation state of the cell.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Purification and stimulation of naive CD4+ and CD8+ T cells

Human neonatal leukocytes were isolated from freshly collected heparinized neonatal blood by Ficoll-Paque density gradient centrifugation. CD4+/CD8+ T cells were purified by negative selection using a pan T isolation kit (Miltenyi Biotec, Auburn, CA). CD8+ T cells were then purified by positive selection with anti-CD8 microbeads (Miltenyi Biotec). The purity of the CD4+/CD45RA+ and CD8+/CD45RA+ T cells was >98%, as determined by flow cytometry. Naive CD4+ and CD8+ cells were stimulated with plate-bound anti-CD3 (TR66 (10)) and anti-CD28 Abs (BD PharMingen, San Diego, CA). When indicated, naive CD4+ cells were stimulated in the presence of 2.5 ng/ml IL-12 (Hoffmann-LaRoche, Nutley, NJ) and 200 ng/ml neutralizing anti-IL-4 Abs (BD PharMingen) for Th1 cultures; or 1 ng/ml IL-4 (BD PharMingen), 2 µg/ml neutralizing anti-IL-12 17F7 and 20C2 Abs (a gift from U. Gubler, Hoffman-LaRoche, Nutley, NJ), and 200 ng/ml neutralizing anti-IFN-{gamma} (BD PharMingen) for Th2 cultures; or neutralizing anti-IL-4, anti-IL-12, and anti-IFN-{gamma} Abs for Th0 cultures. Cells were washed on day 3 and expanded in RPMI medium supplemented with 10% FCS and 50 U/ml IL-2 (Chiron, Emeryville, CA). The specific polarized cytokine production was confirmed by single cell analysis of intracellular IFN-{gamma} and IL-4 production. Briefly, T cells were collected 6 days after priming, washed, and stimulated for 2 h at 37°C with PMA (50 ng/ml; Sigma-Aldrich, St. Louis, MO) and ionomycin (1 µg/ml; Sigma-Aldrich). The cultures were incubated for an additional 2 h after adding brefeldin A (10 µg/ml; Sigma-Aldrich). Cells were then fixed with 4% paraformaldehyde, permeabilized with saponin, and stained with anti-human IFN-{gamma} FITC and anti-human IL-4 PE (BD PharMingen). Cells were analyzed with a FACScan flow cytometer (BD Biosciences, Le Pont de Claix, France). A representative cytokine profile is shown in Fig. 3A.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 3. IFN-induced gene expression in naive and in activated T cells. A, Cytokine profiles of 6-day-activated Th1 (upper panel) and Th0 (lower panel) cells. Purified naive cells were activated with mAbs to CD3/CD28 under Th1-polarizing or Th0-nonpolarizing conditions. At day 6 after priming, cells were harvested, washed, and restimulated. The intracellular production of IFN-{gamma} and IL-4 was analyzed by flow cytometry. B, Induction of the 6-16 mRNA by IFN-{alpha}2. Naive and 6-day-polarized Th1 cells were treated with increasing doses of IFN-{alpha}2 for 4 h, total RNA was extracted, and the 6-16 mRNA levels were measured by real-time PCR. The 6-16 transcripts were normalized to simultaneous quantification of GAPDH transcripts. The ratios between treated and untreated samples in each cell subset are shown, taking as 1 the ratio in untreated samples. C, Induction of the 6-16, MxA, 69-kDa 2'-5' oligoadenylate synthetase (25A69), and IRF7 mRNAs by IFN-{alpha}2 and IFN-{beta}. Naive and 6-day-polarized Th1 cells were treated with 1 nM IFN-{alpha}2 or 1 nM IFN-{beta} for 4 h. The mRNA induction, calculated as in B, is presented here in log scale, due to the very low level in the activated subsets. D, 6-16 mRNA induction in naive and activated CD8+ cells. Purified naive CD8+ cells were activated with mAbs to CD3/CD28 for 6 days. Naive and activated cells were treated with increasing doses of IFN-{alpha}2 for 4 h. The induction of 6-16 mRNA was assessed as in A.

 
T cell proliferation assays

Naive CD4+ T cells were incubated in the presence or absence of 1 nM IFN-{alpha}2 for 20 h. Cells were then washed and stained with 2.5 µM CFSE (Molecular Probes, Eudene, OR) for 10 min at 37°C, before activation with anti-CD3/CD28 under polarizing or nonpolarizing conditions, as described above. Untreated cells were activated in the presence or absence of 1 nM IFN-{alpha}2 (see scheme in Fig. 1). At times indicated, cells were analyzed for CFSE intensity as a function of cell division. Cells were analyzed with a FACScan flow cytometer (BD Biosciences). Dead cells were distinguished by their characteristics on the forward vs side scatter bit maps from the cytofluorograph. This method was in agreement with the analysis of 7-aminoactinomycin D staining (11). Anti-p27 Ab was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). In another set of experiments, anti-CD3/CD28-activated and polarized cells were harvested 2 days after stimulation (see scheme in Fig. 2) and seeded in triplicates in the presence or absence of 1 nM IFN-{alpha}2 and in the presence of IL-2 (50 U/ml). Cell proliferation was assessed at the indicated times, by measuring [3H]thymidine incorporation. A total of 1 µCi of [3H]thymidine was added for 16 h to the cultures.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1. Effect of IFN-{alpha}2 on cell cycle entry of human naive T cells. A, Purified naive CD4+ T cells were preincubated (dashed line) or not (solid line) for 20 h with 1 nM IFN-{alpha}2, then labeled with CFSE and activated with mAbs to CD3/CD28, under Th1-polarizing conditions. IFN-{alpha}2 was constantly maintained in the medium of preincubated cells. Untreated cells were activated in the presence (dashed line) or absence (solid line) of IFN-{alpha}2. At 48 h (left panels) and 60 h (right panels) after activation, cells were harvested and analyzed for dilution of CFSE intensity by FACS. Numbers indicate the percentages of cells that entered each discrete cell division. Data represent one of three comparable experiments performed with cells from different donors. B, p27 levels in nonactivated and activated cells, treated or not with IFN-{alpha}2. Total lysates (10 µg) prepared from nonactivated naive cells incubated or not with IFN-{alpha}2 for 20 h (lanes 1 and 2) and from activated cells treated as described in A and harvested at 48 h (lanes 3, 4, and 5) and 60 h (lanes 6, 7, and 8) after activation were resolved by 7% SDS/PAGE. p27 levels were detected by immunoblotting with anti-p27. Equal protein loading was revealed by Red Ponceau staining.

 


View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 2. Effect of IFN-{alpha}2 on the proliferation of activated T cells. Naive CD4+ cells were activated with mAbs to CD3/CD28 under Th2-polarizing (left panel) or Th0-nonpolarizing (right panel) conditions. After 2 days, cells were harvested and replated in the presence (dashed line) or absence (solid line) of 1 nM IFN-{alpha}2. Cell proliferation was assessed for the following 4 days, by measuring [3H]thymidine incorporated during a 16-h pulse. The data show the means and the SEs of triplicate cultures. For some of the data points, SEs were too small to be illustrated. Similar results were obtained with cells derived from two other donors and by directly counting viable cells, using trypan blue exclusion (data not shown).

 
Quantitative RT-PCR

Total RNA from cells treated with increasing doses of IFN-{alpha}2 and IFN-{beta} (ranging from 1 pM to 1 nM) for different times was purified using the High Pure RNA Isolation kit (Roche Diagnostics, Mannheim, Germany). Reverse transcriptions were primed with oligo(dT) and performed using the murine leukemia virus reverse transcriptase from Invitrogen Life Technologies (Cergy Pontoise, France). Quantitative PCR assays were done at least in triplicates using the SYBR Green I technology on a LightCycler (Roche Diagnostics). The primer pairs used were: GAPDH forward, 5'-ACAGTCCATGCCATCACTGCC-3', and reverse, 5'-GCCTGCTTCACCACCTTCTTG-3'; 6-16 forward, 5'-CATGCGGCAGAAGGCGGTAT3', and reverse, 5'-CGACGGCCATGAAGGTCAGG-3'; MxA forward, 5'-ATCCTGGGATTTTGGGGCTT3', and reverse, 5'-CCGCTTGTCGC TGGTGTCG-3'; IRF7 forward, 5'- GAGCCCTTACCTCCCCTGTTAT3', and reverse, 5'-CCACTGCAGCCCCTCATAG-3', 2', 5'; oligoadenylate synthetase (25A69) forward, 5'-AACTGCTTCCGACAATCAAC-3', and reverse, 5'-CCTCCTTCTCCCTCCAAAA-3'. Quantification standard curves were obtained using PCR products diluted in 10 µg/ml sonicated salmon sperm DNA. The specificity of PCR products was checked by melting curve analysis and DNA sequencing. Normalization of the IFN-stimulated gene (ISG) expression was done against GAPDH. Only ratios with a SE <0.2 log (95% confidence limits) were considered for the determination of induction levels.

Antiviral assay

Th1 and Th2 cells were treated or not with 1 nM IFN-{alpha}2 for 24 h. Cells were then infected with vesicular stomatitis virus (VSV) at a multiplicity of infection >1 for 1 h, then extensively washed and incubated for 8 h, a time corresponding to one virus replication cycle. Cells were lysed by three cycles of freezing/thawing, and the VSV-containing medium was titered on murine L cells for cytopathic effect by a limiting dilution assay.

FACS analysis and Abs

Surface type I IFN receptor 1 (IFNAR1) expression was monitored with 10 µg/ml of AA3 mAb (a gift of L. Runkel, Biogen, Cambridge, MA (12)). IFNAR2 was monitored with the MMHAR-2 mAb (PBL; Biochemical Laboratories, New Brunswick, NJ), followed by incubation with 10 µg/ml of biotinylated anti-mouse IgG Ab and streptavidin-PE (Jackson ImmunoResearch Laboratories, West Grove, PA). Surface IL-12R{beta}1 expression was monitored with 5 µg/ml of the rat anti-human IL-12R{beta}1 2B10 mAb (a gift of U. Gubler) (13), followed by incubation with biotinylated polyclonal anti-rat IgG Abs and with streptavidin-PE. Anti-CD69 PE and anti-CD25 FITC Abs were purchased from BD PharMingen. Anti-phospho-STAT1 were purchased from New England Biolabs (Beverly, MA), and anti-STAT2 from Upstate Biotechnology (Lake Placid, NY). Anti-phospho-STAT2 was a gift from D. E. Levy (New York University School of Medicine, New York, NY), and anti-STAT1 was a gift from C. W. Schindler (Columbia University, New York, NY).

Electrophoretic mobility shift assay

Gel shift assays were performed, as described previously (14). Briefly, naive and Th1/Th2 cells (2 x 107 cells) were incubated or not with 1 nM IFN-{alpha}2 for 1 h, and nuclear extracts were prepared, as described previously (15). A total of 15 µg of nuclear extracts were incubated with a 32P-labeled DNA probe corresponding to the ISG15 gene IFN-stimulated response element (5'-GATCCTCGGGAAAGGGAAACCGAAACTGAAGCC-3'), fractionated on a nondenaturing polyacrylamide gel, and autoradiographed.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IFN-{alpha} delays cell cycle entry of naive T cells

To evaluate the effect of IFN-{alpha} on T cell activation, we first studied whether IFN-{alpha} affected the entry of naive cells into the cell cycle. Human naive CD4+ cells were purified from neonatal leukocytes and incubated or not with 1 nM IFN-{alpha}2 for 20 h. Cells were then labeled with CFSE and activated using plate-bound anti-CD3 and anti-CD28 mAbs, under conditions allowing the establishment of Th1 cell lines (9). Cells that had not been pretreated with IFN were divided into two pools, one of which was activated in the presence of IFN (scheme in Fig. 1A). At 48 h postactivation, the analysis of CFSE fluorescence dilution showed that cells pretreated with IFN had not entered into the cell cycle, while ~24% of untreated cells were dividing (Fig. 1A, top and middle panels). Conversely, the IFN treatment of cells at the time of activation did not affect their proliferation, and CFSE profiles were comparable to those obtained for untreated cells (Fig. 1A, middle and bottom panels). Similar results were obtained with cells polarized under Th2 or nonpolarizing Th0 conditions (data not shown), suggesting that IFN acts independently of the presence of polarizing cytokines. The effect of IFN was reproducible, and the analysis of three independent donors showed inhibition of proliferation after IFN pretreatment, ranging from 50 to 100%. When CFSE fluorescence was analyzed at 60 h postactivation, the difference in the percentages of dividing cells between treated and untreated samples was reduced (Fig. 1A, right panels), demonstrating that IFN does not block, but rather delays cell cycle entry.

The cyclin-dependent kinase inhibitor p27Kip1 is a negative regulator of the cell cycle and, in particular, a candidate target of cytokine-mediated T cell growth regulation (16, 17). Therefore, we monitored the level of p27 within the same cell samples used for CFSE analysis. At 48 h postactivation, the p27 level was considerably reduced in both untreated cells and in cells treated with IFN at the time of activation, in comparison with resting naive cells (Fig. 1B, compare lanes 4 and 5 with lane 1). Conversely, cells that had been treated with IFN before activation showed a consistent 2-fold increased level of p27 in comparison with untreated cells (Fig. 1B, lane 3). At 60 h postactivation, the p27 level in treated and untreated cells was comparable (Fig. 1B, lanes 6–8). Thus, the p27 content appears to correlate with the CFSE profiles observed in the different cell samples. We also compared p27 levels in nonactivated naive cells incubated or not with IFN for 20 h. No detectable increase was observed upon IFN treatment (Fig. 1B, lanes 1 and 2).

Next, we investigated the effect of IFN-{alpha}2 on the ongoing proliferation of 2-day-activated CD4+ T cells. Naive precursors were activated with CD3/CD28 mAbs under Th2 or Th0 conditions. Two days postactivation, cells were replated in the presence or absence of IFN-{alpha}2, and proliferation was measured by [3H]thymidine incorporation. In contrast to the results obtained in naive cells, the proliferation of activated cells was not affected by IFN (Fig. 2). Similar experiments performed with Th1, Th2, and Th0 cells from three independent donors yielded comparable results (data not shown).

Overall, these results demonstrated a different susceptibility of naive and effector T cells to the antiproliferative activity of IFN-{alpha}.

IFN-{alpha}/{beta} responsiveness is down-modulated upon T cell activation

Type I IFN induce the expression of a large set of ISGs, whose promotors are activated by the trimeric ISG factor 3 (ISGF3) complex, composed by STAT1, STAT2, and IRF-9 (18). To evaluate the IFN responsiveness of T lymphocytes upon differentiation, we measured the transcriptional response of naive and effector T cells, by quantifying the level of expression of some ISGs. In pilot experiments, the accumulation of ISG mRNA in IFN-{alpha}-treated naive cells was found to peak at 4–6 h (data not shown). Naive cells were activated for 6 days under Th1-polarizing and Th0-nonpolarizing conditions (see the cytokine production profiles in Fig. 3A). Naive and activated cells were incubated for 4 h with increasing doses of IFN-{alpha}2 or IFN-{beta}, and total RNA was extracted. The levels of the ISG mRNA were quantified by real-time PCR. The GAPDH gene was chosen as the internal endogenous reference, because its expression was not affected by IFN treatment (data not shown). After normalizing ISG mRNA levels to the GAPDH level in each sample, the fold of induction of each gene was expressed as the ratio between treated and untreated samples in each cell subset. In Fig. 3B, the fold of induction of the 6-16 gene was plotted as a function of IFN concentration. In naive cells, the 6-16 gene was induced 90-fold in response to as little as 1 pM of IFN-{alpha}2. Conversely, in both activated T cell populations, this gene was induced ~10-fold. Importantly, this difference could not be overcome by higher doses of IFN. The quantification of the 6-16 mRNA induced by IFN-{alpha}2 and IFN-{beta} in cells derived from independent donors showed similar results, confirming that the 6-16 gene was at least 10-fold less induced in activated cells than in naive precursors. The induction profile of three other ISGs (MxA, the 69-kDa 2'-5' oligoadenylate synthetase, and IRF7) was studied and, depending on the gene, a 15- to 50-fold lower induction was observed in activated cells (Fig. 3C). The phenomenon described above was not restricted to the CD4+ subset, because an average 10-fold reduced induction of the 6-16 mRNA by IFN-{alpha}2 was also observed in activated CD8+ cells, as compared with their naive precursors (Fig. 3D).

The transcriptional response to type I IFN was also measured at earlier stages of Th cell differentiation. Purified naive CD4+ cells from three independent donors were activated under Th1, Th2, or Th0 conditions. The 6-16 mRNA induction by IFN-{alpha}2 was measured in naive cells and in cells harvested at 24, 48, and 72 h after activation. Independently of the commitment to a specific Th subset, the reduction of the IFN response was observed at 24 h after activation and was maximal at 72 h, when most of the cells had started to proliferate (Fig. 4A). Overall, these results suggested that the decreased transcriptional response to IFN of differentiated Th subsets was related to the activation/proliferation of the cells, rather than to a subset-specific polarization event. These results also raised the question as to whether the altered IFN-{alpha} response of effector cells was linked to the activation process itself, or whether it was associated to proliferation. To this end, we performed an experiment in which cells were monitored in parallel for surface expression of activation markers (CD69 and CD25), for CFSE fluorescence dilution, and for IFN responsiveness. These analyses were conducted on naive cells and on cells activated for 14 and 64 h under Th1-polarizing conditions. At 14 h postactivation, cells had not yet entered proliferation, while over 60% of them expressed CD69 and CD25 markers (Fig. 4B). Importantly, these cells displayed a 12-fold reduced 6-16 mRNA accumulation as compared with naive cells. At 64 h postactivation, all cells were proliferating, and a further 2-fold reduction in the transcriptional response to IFN-{alpha} was measured. These results demonstrated that the decline in the IFN response occurred early upon T cell activation, before entry into proliferation.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 4. Induction of 6-16 mRNA by IFN-{alpha}2 at early times after activation. A, Neonatal naive CD4+ cells were purified from three independent donors and activated under Th1, Th2, or Th0 conditions. Nonactivated (time 0, naive cells) and activated cells were harvested after 24, 48, and 72 h; incubated for 4 h in the presence or absence of 1 nM IFN-{alpha}2; and analyzed for 6-16 and GAPDH transcripts. The ratio 6-16/GAPDH in the treated sample was normalized to the same ratio in the untreated sample and shown as the mRNA induction. B, Neonatal naive cells, purified from an independent donor, were activated under Th1 conditions. Cells were harvested after 14 and 64 h and incubated for 4 h in the presence or absence of 1 nM IFN-{alpha}2. The induction of 6-16 mRNA was assessed as in A. The expression of the activation markers CD69 and CD25 (right, upper, and middle panels) was monitored on nonactivated and 14-h-activated cells by staining with anti-CD69 PE and anti-CD25 FITC Abs. The rate of proliferation of nonactivated and 14 h- and 64 h-activated cells was measured by dilution of CFSE fluorescence (right, lower panel).

 
Activated T cells are sensitive to the antiviral effect of IFN-{alpha}

Because type I IFN play a determinant role in protecting cells from viruses, we asked whether, despite the lower magnitude of ISG induction, activated T cells were protected by IFN from viral infection. To answer this question, we tested whether IFN-{alpha}2 induced an antiviral state against VSV in Th1 and Th2 effector cells. The two populations were treated with IFN-{alpha}2 and exposed to VSV, and, after a single round of virus replication, the virus yield was measured. An IFN-{alpha}2-mediated reduction in the VSV yield was observed in both Th1 and Th2 cells (Fig. 5), suggesting that the residual IFN response measured in these cells is sufficient to induce a complete antiviral response.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 5. IFN-{alpha} protects activated cells from VSV infection. Th1 and Th2 cells polarized for 6 days were left untreated or were treated with 1 nM IFN-{alpha}2, then infected with VSV (multiplicity of infection >1). The virus yield was assayed on L murine cells. Striped columns represent the residual virus after the infection step, open columns represent virus produced by untreated cells, and filled columns represent virus produced by IFN-treated cells.

 
The IFN-induced Janus kinase/STAT pathway is not impaired in polarized Th subsets

To investigate the mechanism underlying the decline in the transcriptional response to type I IFN observed in activated lymphocytes, we monitored the cell surface level of the IFN receptor chains, IFNAR1 and IFNAR2, and, in parallel, the level of the IL-12R{beta}1 chain, in naive and in polarized cells at different times after activation. The level of IFNAR2 remained constant in the three cell subsets (data not shown), while the level of IFNAR1 declined after activation, so that 6-day-activated cells expressed nearly half the level present on precursor cells (Fig. 6A). A rapid increase in the IL-12R{beta}1 level was observed in both Th populations (Fig. 6A, right panel). To evaluate the consequence of the IFNAR1 reduction, we measured the extent of activation of STAT1 and STAT2, in naive and in differentiated cells. The two forms of STAT1 (p91 and p84) were tyrosine phosphorylated by IFN-{alpha}2 in the three cell subsets (Fig. 6B). The magnitude of phosphorylation was difficult to compare due to the increase of both STAT1 isoforms in Th1 cells (19). However, taking into account the relative amount of proteins, the percentage of phosphorylated p91 and p84 did not remarkably change in activated cells in comparison with naive precursors. Conversely, the STAT2 content remained constant and was therefore regarded as more indicative (Fig. 6B). STAT2 was tyrosine phosphorylated by IFN-{alpha}2 to comparable levels, in a dose-dependent fashion and with similar kinetics, in the three cell subsets (Fig. 6, B and C). No difference in the induced phosphorylation level of STAT3 could be observed (data not shown). Next, we measured, by EMSA, the activation of the transcriptional ISGF3 complex in nuclear extracts obtained from naive and differentiated cells that were treated for 1 h with IFN-{alpha}2. As shown in Fig. 6D, a comparable level of activated ISGF3 was detected in the three cell subsets. Overall, these results demonstrate that the decline in the transcriptional response of Th1/Th2 to type I IFN is not due to a reduced sensitivity of these cells to the ligand, nor to impairment of receptor-generated signaling events, but rather may result from global changes occurring upon activation.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 6. IFN-{alpha}2 signaling pathway in naive and activated Th cells. A, Surface level of IFNAR1 and IL-12R{beta}1 during Th cell differentiation. The surface levels of IFNAR1 (left panel) and IL-12R{beta}1 (right panel) were monitored by flow cytometry, at the indicated days after T cell activation (time 0). Shown is the median fluorescence intensity obtained in one of three independent experiments. B, Tyrosine phosphorylation level of STAT1 and STAT2 in naive, Th1, and Th2 cells. Naive precursors and 6-day-polarized Th1 and Th2 cells were treated for 30 min with the indicated doses of IFN-{alpha}2. Total cell lysates (40 µg for naive cells and 20 µg for Th1/Th2 cells) were resolved by 7% SDS-PAGE. Tyrosine-phosphorylated STAT1 and STAT2 were detected by immunoblotting with specific anti-phospho-Abs. Membranes were stripped and probed with the specific STAT Abs. The anti-STAT1 antiserum detects both p91 and p84 isoforms. C, Kinetics of STAT2 activation in naive and Th1 cells. Naive and 6-day-differentiated Th1 cells were treated for the indicated times with 50 pM IFN-{alpha}2. Lysates were analyzed as in B. D, Induction of the ISGF3 complex by IFN-{alpha}2. Naive, Th1, and Th2 cells were treated for 1 h with 1 nM IFN-{alpha}2. Nuclear extracts (15 µg) were subjected to EMSA, using a 32P dsDNA-labeled probe corresponding to the IFN-stimulated response element of the ISG15 gene. When indicated, 10x cold probe was added as a competitor.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The effects of type I IFN on T lymphocytes have been mainly investigated in in vivo murine systems, in which direct activities of IFN may be difficult to dissociate from those induced via other cell types. In this study, we investigated the direct effects of IFN added to cultures of human naive T cells and of effector cells. We demonstrated that cell cycle entry was consistently delayed upon IFN treatment of naive cells before their activation. Interestingly, an increased percentage of apoptotic cells was observed at 48 h postactivation in control cultures, as compared with cultures that were preincubated with IFN. These apoptotic cells had undergone at least one cell division (data not shown). Thus, IFN, by restricting rapid proliferation, may indirectly prevent apoptosis. We cannot, however, rule out a direct effect of IFN in keeping activated cells alive, because a decreased apoptosis was observed in cells that were treated with IFN at the moment of activation, as compared with untreated cells. This finding is reminiscent of the one described by Marrack et al. (20), showing that type I prevents the death in culture of in vivo activated T cells, without inducing their proliferation.

Our results point to the ability of IFN to impinge on regulatory mechanisms that maintain T cell quiescence. A possible role of IFN-{alpha} in the regulation of p27Kip1 was suggested by the finding of a faster p27 decline upon activation of murine STAT1-deficient T lymphocytes in comparison with wild-type lymphocytes (21). In our experimental setting, we could observe that 2-day-activated cells that had been pretreated with IFN contained 50% more p27 than untreated cells. A similar finding was reported in PHA-activated peripheral T lymphocytes (22). Thus, IFN may counteract the p27 degradation induced by the TCR engagement (23, 24).

When added at the time of, or after, activation, IFN-{alpha} was ineffective in perturbing cell proliferation. This result is consistent with previous observations obtained in PHA-activated peripheral lymphocytes (25). Conversely, a related study showed that addition of IFN-{alpha} impaired T cell entry in S phase (22). We believe that the discrepancy between this and our result is due to the different activation protocol used, because, in this latter study, only 2% of cells were cycling at the time of IFN addition. Our findings suggest that signals induced by TCR triggering override the IFN effect on the control of cell proliferation. Thus, the IFN antiproliferative action may overcome mitogenic stimuli, depending on the activation state of T cells at the time of exposure to the cytokine.

A second phenomenon that is coupled to the activation/expansion of T lymphocytes is the reduction of the magnitude of gene induction by type I IFN. We could demonstrate that the 10-fold reduced inducibility of ISGs was an early postactivation event, being detectable as soon as 14 h after T cell activation. Upon engagement of the TCR, the IL-12R{beta}1 chain is induced and thereafter maintained on both Th subsets. We have recently shown that the IL-12R{beta}1 chain, when ectopically expressed in human fibroblasts, down-modulates IFN-{alpha} signaling (26). Seemingly, the up-regulation of the IL-12R{beta}1 in activated cells could account for their decreased IFN response. Although we indeed observed a decreased surface IFNAR1 level in activated CD4+ cells, a number of observations argue for the involvement of other mechanisms. The reduced IFN response of fibroblasts expressing the {beta}1-chain correlated with impaired activation of the components of the Janus kinase/STAT pathway, and it could be overcome by higher IFN doses (26). On the contrary, the reduced IFN response of activated T cells could not be attributed to decreased STAT activation, nor to impaired ISGF3 formation, and it could not be overcome by higher IFN doses. These findings suggest that the ability of activated T cells to maximally induce ISG expression is affected, rather than their overall sensitivity to the cytokine. The lack of impairment of STAT activation argues against a possible implication of members of the suppressors of cytokine signaling family, known to dampen STAT phosphorylation (27). A recent study showed that, upon a prolonged exposure to low doses of IFN-{beta}, T cells became refractory to further IFN-{beta} treatment. Interestingly, this reduced IFN response appeared to correlate with high levels of STAT1 (28). This does not seem to be the case in our model because, despite a remarkable difference in the STAT1 content between Th1 and Th2 cells, the response to IFN was comparably reduced in the two cell subsets.

Altogether, our data point to a layer of regulation of ISGs by type I IFN that would be superimposed on the known framework and would depend on the state of activation of the cells. Although we could demonstrate the formation of the ISGF3 complex in activated T cells, we cannot exclude that further modifications of components of this complex are required for its maximal activity (29). Transcriptional initiation relies on recruitment of coactivators that, by acetylating or deacetylating nucleosomal histones, modulate transcription. Interestingly, some of these cofactors have been shown to directly interact with STAT proteins (30, 31). In this regard, Levy and coworkers (32) recently demonstrated that the level of acetylation of the histone H3 associated to ISG promoters is enhanced in response to IFN-{alpha}/{beta} and that the coactivator GCN5 is recruited to the transactivation domain of STAT2. Thus, the differential expression, activity, or availability of coactivators could account for the reduced transcriptional response to IFN observed in activated T cells. We cannot, however, rule out an activation-dependent mechanism of ISG regulation that occurs at the posttranscriptional level and affects messenger stability.

It has been recently reported that activated T cells lose their ability to respond to IL-6-induced survival signals, but still respond to IL-6-induced differentiation-promoting signals (33). Thus, the complex global changes taking place in T lymphocytes upon engagement of the TCR appear to modify the cellular responses to cytokines. In our model, we propose that the activation of naive T cells is associated with a developmental rewiring that restrains the transcriptional response to IFN. One possibility is that this decline accounts for the resistance of activated cells to the antiproliferative effect of IFN. Cytokine signaling may be regulated according to the activation state of the cell to adapt their responses to the various environmental stimuli. An attractive possibility awaiting further investigation would be that a maximal response to type I IFN is restored in memory T cells, allowing them to react to the low constitutively secreted IFN and to survive during the phase of immune quiescence (34).


    Acknowledgments
 
We thank S. Garcia, O. Acuto, and F. Colucci for discussion and critical reading of the manuscript; J. Ragimbeau, and M. Biffi for technical assistance; and D. E. Levy, U. Gubler, J. Thèze, L. Runkel, and C. W. Schindler for reagents.


    Footnotes
 
1 This work was supported by grants from the Association pour la Recherche sur le Cancer (to S.P.) and the Human Frontier Science Program (to G.U.). E.D. was supported by the Fondation pour la Recherche Médicale and the Association pour la Recherche sur la Sclérose en Plaques. Back

2 Address correspondence and reprint requests to Dr. Sandra Pellegrini, Unité de Signalisation des Cytokines, Institut Pasteur, 25, rue du Dr. Roux, 75724 Paris cedex 15 France. E-mail address: pellegri{at}pasteur.fr Back

3 Abbreviations used in this paper: DC, dendritic cell; IFNAR, type I IFN receptor; ISG, IFN-stimulated gene; ISGF3, ISG factor 3; VSV, vesicular stomatitis virus. Back

Received for publication July 26, 2002. Accepted for publication November 12, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lin, Q., C. Dong, M. D. Cooper. 1998. Impairment of T and B cell development by treatment with a type I interferon. J. Exp. Med. 187:79.[Abstract/Free Full Text]
  2. Park, C., S. Li, E. Cha, C. Schindler. 2000. Immune response in Stat2 knockout mice. Immunity 13:795.[Medline]
  3. Levy, D. E., A. Garcia-Sastre. 2001. The virus battles: IFN induction of the antiviral state and mechanisms of viral evasion. Cytokine Growth Factor Rev. 12:143.[Medline]
  4. Colonna, M., A. Krug, M. Cella. 2002. Interferon-producing cells: on the front line in immune responses against pathogens. Curr. Opin. Immunol. 14:373.[Medline]
  5. Cella, M., D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakjima, A. Lanzavecchia, M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat. Med. 5:919.[Medline]
  6. Asselin-Paturel, C., A. Boonstra, M. Dalod, I. Durand, N. Yessaad, C. Dezutter-Dambuyant, A. Vicari, A. O’Garra, C. Biron, F. Briere, G. Trinchieri. 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat. Immun. 2:1144.
  7. Cella, M., F. Facchetti, A. Lanzavecchia, M. Colonna. 2000. Plasmacytoid dendritic cells activated by influenza virus and CD40L drive a potent Th1 polarization. Nat. Immun. 1:305.
  8. Kadowaki, N., S. Antonenko, J. Y. Lau, Y. J. Liu. 2000. Natural interferon {alpha}/{beta}-producing cells link innate and adaptive immunity. J. Exp. Med. 192:219.[Abstract/Free Full Text]
  9. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
  10. Lanzavecchia, A., D. Scheidegger. 1987. The use of hybrid hybridomas to target human cytotoxic T lymphocytes. Eur. J. Immunol. 17:105.[Medline]
  11. Lecoeur, H., E. Ledru, M. C. Prevost, M. L. Gougeon. 1997. Strategies for phenotyping apoptotic peripheral human lymphocytes comparing ISNT, annexin-V and 7-AAD cytofluorometric staining methods. J. Immunol. Methods 209:111.[Medline]
  12. Goldman, L. A., M. Zafari, E. C. Cutrone, A. Dang, M. Brickelmeier, L. Runkel, C. D. Benjamin, L. E. Ling, J. A. Langer. 1999. Characterization of antihuman IFNAR-1 monoclonal antibodies: epitope localization and functional analysis. J. Interferon Cytokine Res. 19:15.[Medline]
  13. Wu, C. Y., R. R. Warrier, D. M. Carvajal, A. O. Chua, L. J. Minetti, R. Chizzonite, P. K. Mongini, A. S. Stern, U. Gubler, D. H. Presky, M. K. Gately. 1996. Biological function and distribution of human interleukin-12 receptor {beta} chain. Eur. J. Immunol. 26:345.[Medline]
  14. Lee, C. K., H. A. Bluyssen, D. E. Levy. 1997. Regulation of interferon-{alpha} responsiveness by the duration of Janus kinase activity. J. Biol. Chem. 272:21872.[Abstract/Free Full Text]
  15. Dignam, J. D., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
  16. Kaplan, M. H., C. Daniel, U. Schindler, M. J. Grusby. 1998. Stat proteins control lymphocyte proliferation by regulating p27Kip1 expression. Mol. Cell. Biol. 18:1996.[Abstract/Free Full Text]
  17. Dijkers, P. F., R. H. Medema, C. Pals, L. Banerji, N. S. Thomas, E. W. Lam, B. M. Burgering, J. A. Raaijmakers, J. W. Lammers, L. Koenderman, P. J. Coffer. 2000. Forkhead transcription factor FKHR-L1 modulates cytokine-dependent transcriptional regulation of p27(KIP1). Mol. Cell. Biol. 20:9138.[Abstract/Free Full Text]
  18. Stark, G. R., I. M. Kerr, B. R. Williams, R. H. Silverman, R. D. Schreiber. 1998. How cells respond to interferons. Annu. Rev. Biochem. 67:227.[Medline]
  19. Rogge, L., E. Bianchi, M. Biffi, E. Bono, S. Y. Chang, H. Alexander, C. Santini, G. Ferrari, L. Sinigaglia, M. Seiler, et al 2000. Transcript imaging of the development of human T helper cells using oligonucleotide arrays. Nat. Genet. 25:96.[Medline]
  20. Marrack, P., J. Kappler, T. Mitchell. 1999. Type I interferons keep activated T cells alive. J. Exp. Med. 189:521.[Abstract/Free Full Text]
  21. Lee, C. K., E. Smith, R. Gimeno, R. Gertner, D. E. Levy. 2000. STAT1 affects lymphocyte survival and proliferation partially independent of its role downstream of IFN-{gamma}. J. Immunol. 164:1286.[Abstract/Free Full Text]
  22. Erickson, S., O. Sangfelt, J. Castro, M. Heyman, S. Einhorn, D. Grandér. 1999. Interferon-{alpha} inhibits proliferation in human T lymphocytes by abrogation of interleukin 2-induced changes in cell cycle-regulatory proteins. Cell Growth Differ. 10:575.[Abstract/Free Full Text]
  23. Firpo, E. J., A. Koff, M. J. Solomon, J. M. Roberts. 1994. Inactivation of a Cdk2 inhibitor during interleukin 2-induced proliferation of human T lymphocytes. Mol. Cell. Biol. 14:4889.[Abstract/Free Full Text]
  24. Nourse, J., E. Firpo, W. M. Flanagan, S. Coats, K. Polyak, M. H. Lee, J. Massague, G. R. Crabtree, J. M. Roberts. 1994. Interleukin-2-mediated elimination of the p27Kip1 cyclin-dependent kinase inhibitor prevented by rapamycin. Nature 372:570.[Medline]
  25. Matikainen, S., T. Sarenava, T. Ronni, A. Lehtonen, P. J. Koskinen, I. Julkunen. 1999. Interferon-{alpha} activates multiple STAT proteins and up-regulates proliferation-associated IL-2R{alpha}, c-myc and pim-1 genes in human T cells. Blood 93:1980.[Abstract/Free Full Text]
  26. Dondi, E., E. Pattyn, G. Lutfalla, X. Van Ostade, G. Uzé, S. Pellegrini, J. Tavernier. 2001. Down-modulation of type I interferon responses by receptor cross-interference for a shared Jak kinase. J. Biol. Chem. 276:47004.[Abstract/Free Full Text]
  27. Alexander, W. S.. 2002. Suppressors of cytokine signalling (SOCS) in the immune system. Nat. Rev. Immunol. 2:410.[Medline]
  28. DuPont, S. A., S. Goelz, J. Goyal, M. Green. 2002. Mechanisms for regulation of cellular responsiveness to human IFN-{beta}1a. J. Interferon Cytokine Res. 22:491.[Medline]
  29. Mowen, K. A., J. Tang, W. Zhu, B. T. Schurter, K. Shuai, H. R. Herschman, M. David. 2001. Arginine methylation of STAT1 modulates IFN{alpha}/{beta}-induced transcription. Cell 104:731.[Medline]
  30. Bhattacharya, S., R. Eckner, S. Grossman, E. Oldread, Z. Arany, A. D’Andrea, D. M. Livingston. 1996. Cooperation of Stat2 and p300/CBP in signalling induced by interferon-{alpha}. Nature 383:344.[Medline]
  31. Look, D. C., W. T. Roswit, A. G. Frick, Y. Gris-Alevy, D. M. Dickhaus, M. J. Walter, M. J. Holtzman. 1998. Direct suppression of Stat1 function during adenoviral infection. Immunity 9:871.[Medline]
  32. Paulson, M., C. Press, E. Smith, N. Tanese, D. E. Levy. 2002. IFN-stimulated transcription through a TBP-free acetyltransferase complex escapes viral shutoff. Nat. Cell Biol. 4:140.[Medline]
  33. Teague, T. K., B. C. Schaefer, D. Hildeman, J. Bender, T. Mitchell, J. W. Kappler, P. Marrack. 2000. Activation-induced inhibition of interleukin 6-mediated T cell survival and signal transducer and activator of transcription 1 signaling. J. Exp. Med. 191:915.[Abstract/Free Full Text]
  34. Akbar, A. N., J. M. Lord, M. Salmon. 2000. IFN-{alpha} and IFN-{beta}: a link between immune memory and chronic inflammation. Immunol. Today 21:337.[Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2003 170: 665-666. [Full Text]  



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. M. E. Gallagher, S. Lauder, I. W. Rees, A. M. Gallimore, and A. J. Godkin
Type I Interferon (IFN{alpha}) Acts Directly on Human Memory CD4+ T Cells Altering Their Response to Antigen
J. Immunol., September 1, 2009; 183(5): 2915 - 2920.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Pilz, W. Kratky, S. Stockinger, O. Simma, U. Kalinke, K. Lingnau, A. von Gabain, D. Stoiber, V. Sexl, T. Kolbe, et al.
Dendritic Cells Require STAT-1 Phosphorylated at Its Transactivating Domain for the Induction of Peptide-Specific CTL
J. Immunol., August 15, 2009; 183(4): 2286 - 2293.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Dunn, M. Brunetto, G. Reynolds, T. Christophides, P. T. Kennedy, P. Lampertico, A. Das, A. R. Lopes, P. Borrow, K. Williams, et al.
Cytokines induced during chronic hepatitis B virus infection promote a pathway for NK cell-mediated liver damage
J. Exp. Med., March 19, 2007; 204(3): 667 - 680.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. S. Berenson, M. Gavrieli, J. D. Farrar, T. L. Murphy, and K. M. Murphy
Distinct Characteristics of Murine STAT4 Activation in Response to IL-12 and IFN-{alpha}
J. Immunol., October 15, 2006; 177(8): 5195 - 5203.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Severa, M. E. Remoli, E. Giacomini, J. Ragimbeau, R. Lande, G. Uze, S. Pellegrini, and E. M. Coccia
Differential responsiveness to IFN-{alpha} and IFN-{beta} of human mature DC through modulation of IFNAR expression
J. Leukoc. Biol., June 1, 2006; 79(6): 1286 - 1294.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Aichele, H. Unsoeld, M. Koschella, O. Schweier, U. Kalinke, and S. Vucikuja
Cutting edge: CD8 T cells specific for lymphocytic choriomeningitis virus require type I IFN receptor for clonal expansion.
J. Immunol., April 15, 2006; 176(8): 4525 - 4529.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Le Bon, V. Durand, E. Kamphuis, C. Thompson, S. Bulfone-Paus, C. Rossmann, U. Kalinke, and D. F. Tough
Direct Stimulation of T Cells by Type I IFN Enhances the CD8+ T Cell Response during Cross-Priming.
J. Immunol., April 15, 2006; 176(8): 4682 - 4689.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Havenar-Daughton, G. A. Kolumam, and K. Murali-Krishna
Cutting Edge: The Direct Action of Type I IFN on CD4 T Cells Is Critical for Sustaining Clonal Expansion in Response to a Viral but Not a Bacterial Infection
J. Immunol., March 15, 2006; 176(6): 3315 - 3319.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. P. Gil, R. Salomon, J. Louten, and C. A. Biron
Modulation of STAT1 protein levels: a mechanism shaping CD8 T-cell responses in vivo
Blood, February 1, 2006; 107(3): 987 - 993.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Kawamura, N. Kadowaki, T. Kitawaki, and T. Uchiyama
Virus-stimulated plasmacytoid dendritic cells induce CD4+ cytotoxic regulatory T cells
Blood, February 1, 2006; 107(3): 1031 - 1038.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
G. A. Kolumam, S. Thomas, L. J. Thompson, J. Sprent, and K. Murali-Krishna
Type I interferons act directly on CD8 T cells to allow clonal expansion and memory formation in response to viral infection
J. Exp. Med., September 6, 2005; 202(5): 637 - 650.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. F. L. Coelho, G. M. de Freitas Almeida, F. J. D. Mennechet, A. Blangy, and G. Uze
Interferon-{alpha} and -{beta} differentially regulate osteoclastogenesis: Role of differential induction of chemokine CXCL11 expression
PNAS, August 16, 2005; 102(33): 11917 - 11922.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Dikopoulos, A. Bertoletti, A. Kroger, H. Hauser, R. Schirmbeck, and J. Reimann
Type I IFN Negatively Regulates CD8+ T Cell Responses through IL-10-Producing CD4+ T Regulatory 1 Cells
J. Immunol., January 1, 2005; 174(1): 99 - 109.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Dondi, G. Roue, V. J. Yuste, S. A. Susin, and S. Pellegrini
A Dual Role of IFN-{alpha} in the Balance between Proliferation and Death of Human CD4+ T Lymphocytes during Primary Response
J. Immunol., September 15, 2004; 173(6): 3740 - 3747.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
C. Carbonneil, H. Saidi, V. Donkova-Petrini, and L. Weiss
Dendritic cells generated in the presence of interferon-{alpha} stimulate allogeneic CD4+ T-cell proliferation: modulation by autocrine IL-10, enhanced T-cell apoptosis and T regulatory type 1 cells
Int. Immunol., July 1, 2004; 16(7): 1037 - 1052.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Nagai, O. Devergne, T. F. Mueller, D. L. Perkins, J. M. van Seventer, and G. A. van Seventer
Timing of IFN-{beta} Exposure during Human Dendritic Cell Maturation and Naive Th Cell Stimulation Has Contrasting Effects on Th1 Subset Generation: A Role for IFN-{beta}-Mediated Regulation of IL-12 Family Cytokines and IL-18 in Naive Th Cell Differentiation
J. Immunol., November 15, 2003; 171(10): 5233 - 5243.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dondi, E.
Right arrow Articles by Pellegrini, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dondi, E.
Right arrow Articles by Pellegrini, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS