|
|
||||||||









* Cambridge Antibody Technology, Abington, United Kingdom;
Wyeth Research, Cambridge, MA 02140
| Abstract |
|---|
|
|
|---|
expression, these results suggest that
IL-7 and IL-15 restore proliferation under conditions of PD-1
engagement by enhancing high-affinity IL-2R expression and hence, IL-2
responsiveness. | Introduction |
|---|
|
|
|---|
Program death 1 (PD-1) is an activation-induced inhibitory receptor
expressed on T cells, B cells, and monocytes (4, 5). PD-1
ligand (PD-L)1 (B7H1) and PD-L2 (B7-DC) are the ligands for PD-1
(6, 7); these ligands share 38% amino acid identity
(7, 8) and 2027% amino acid identity with other B7
family members, B7-1, B7-2, and ICOS-L (6, 9, 10, 11). PD-L1
and PD-L2 expression is induced on monocytes and dendritic cells upon
treatment with IFN-
or IFN-
/LPS (6), and transcripts
for both ligands are detectable on lymphoid and nonlymphoid tissue.
PD-1-deficient mice display disregulated Ig production with late onset
chronic progressive glomerulonephritis and arthritis in C57BL/6 mice
and self-reactive Ig-mediated dilated cardiomyopathy in BALB/c mice
(12, 13). These data suggest PD-1 receptor engagement
leads to down-regulation of immune responses and its deficiency results
in loss of peripheral tolerance. Thus, the PD-1/PD-L pathway has been
proposed to attenuate central and peripheral immune responses.
We have previously demonstrated that anti-CD3/PD-L1.Fc activation
of wild-type but not PD-1-deficient murine T cells, as well as human T
cells, results in decreased proliferation relative to cells activated
with anti-CD3 alone (6). Additionally, CD28
costimulation can overcome PD-1-mediated inhibition by augmenting IL-2
production (14). In this study, we examine the effect of
ICOS costimulation and
common receptor cytokine family members on
PD-1 inhibition. We determine that IL-2 levels induced by ICOS
costimulation are insufficient to fully restore proliferation upon PD-1
engagement. Thus, IL-2 levels induced by CD28 or ICOS costimulation are
critical in determining the outcome of the PD-1 engagement. The effect
of IL-2, -4, -7, -15, and -21 on TCR/PD-1 activation was examined. We
find that among these cytokines, only those that activate STAT5 can
rescue PD-1 inhibition.
| Materials and Methods |
|---|
|
|
|---|
Abs to CD3 (clone UCHT-1), CD28 (clone CD28.2), and IL-2 (clone MAB202) were purchased from BD PharMingen (San Diego, CA) or R&D Systems (Minneapolis, MN). Construction of PD-L1.Fc (human (hu)PD-L1-murine (mu)IgG2a), ICOS-L.Fc (GL50-muIgG2a), and B7.2.Fc (huB7.2-huIgG1) has been described previously (6, 10). Murine Abs (J110) to human PD-1 were obtained from e-Biosciences (San Diego, CA). Neutralizing Abs specific for human PD-1 or human PD-L1 were isolated by selection from large (total size greater than 1011), human scFv phage display libraries (15). Human PD-1 or PD-L1 fusion proteins were diluted to 10 µg/ml (PD-L1) or 20 µg/ml (PD-1) in PBS and coated onto wells of Nunc Maxisorp 96-well microtiter plates (Nunc, Naperville, IL) overnight at 4°C. Two rounds of panning selection were performed using deselection with unrelated fusion protein partners. Ag-specific phage clones were identified by phage binding to Ag in an ELISA, but not to other fusion proteins or unrelated proteins. Unique scFv were identified by DNA sequence analysis of the scFv insert using appropriate vector primers. Purified scFv from PD-1 or PD-L1 binding clones was prepared by nickel chelate chromatography from 500 ml induced Escherichia coli cultures using Pharmacia Ni-NTA agarose resin (Amersham Pharmacia Biotech, Piscataway, NJ). ScFv was assayed for the ability to inhibit the binding of 100 ng/ml biotinylated hPD-L1 fusion protein to 1.5 µg/ml huPD-1 fusion protein immobilized on plastic. Bound PD-L1 was detected with streptavidin-AmDEX-alkaline phosphatase (Amdex, Jyllinge, Denmark). Neutralizing scFv were converted to human IgG1 by subcloning of H chain VHDHJH and L chain VLJL domains into vectors containing the human IgG1 H chain constant domain or appropriate human L chain constant domain. Subcloning was verified by sequence analysis of the constructs, which were cotransfected into eukaryotic cells for IgG expression. IgG was purified from culture supernatants by protein A-Sepharose (Amersham Pharmacia Biotech) affinity chromatography according to manufacturers directions. Human anti-human Abs PD-117 and PD-135 were characterized for their ability to inhibit PD-1/PD-L interaction using ELISA and FACS assays. ELISAs were performed as described for scFv. FACS assays were performed using a human PD-1 expressing Jurkat cell line; cells were incubated with increasing concentrations of Ab (0100 µg/test) followed by incubation with human PD-L.Fc (2 µg/test). Cells were washed and incubated with PE-conjugated goat anti-mouse IgG2a to detect PD-L.Fc binding. A stable Chinese hamster ovary cell line has been established for PD-117 Ab production and Ab produced and purified. Requests for this Ab should be addressed to the attention of Dr. B. Carreno (Wyeth Research, Cambridge, MA).
T cell assays
Human CD4+ T cells were purified by
negative selection from peripheral blood lymphocytes as described
previously (16). Tosyl-activated magnetic microspheres
(Dynal Biotech, Great Neck, NY) were coated with anti-CD3 Ab
(0.253 µg/107 microspheres), and PD-L1.Fc,
ICOS-L.Fc, or B7.2.Fc (0.54 µg/107
microspheres) as described (17). Murine IgG or an
irrelevant fusion protein was used to saturate the binding capacity of
the microspheres (total protein = 5 µg/107
microspheres). Protein-coated microspheres were added to purified
CD4+ T cells (105
cells/well) in flat-bottom 96-well microtiter plates at a ratio of 1:1;
72 h after culture initiation, plates were pulsed with 1
µCi tritiated thymidine/well and incubated for a 6- to 16-h
period. For assessing effect of soluble anti-PD-1 Ab on
proliferation, CD4+ T cells were preactivated for
48 h with anti-CD3/anti-CD28-coated microspheres,
harvested, and restimulated with the indicated concentration of PHA
plus 10 ng/ml IL-2 in the presence of the indicated Abs. Proliferation
was measured at 72 h. For neutralization of IL-2, 20 µg/ml of
either anti-huIL-2 Ab or muIgG1 (R&D Systems) was added at
initiation of culture. To assess effect of exogenous cytokines on
PD-1-mediated inhibition, cells were activated with anti-CD3 or
anti-CD3/PD-L1.Fc-coated microspheres; human cytokines (R&D
Systems) were added at the indicated concentrations at the initiation
of culture and proliferation was measured at 72 h as described
above. Unpaired Students t test statistical analysis was
performed on data on Fig. 4. Values of p
0.05 were
considered significant.
|
Purified human CD4+ T cells (106 cells/ml) were activated with anti-CD3/anti-CD28-coated microspheres as described above, samples were collected at the indicated times and incubated with FITC-conjugated anti-CD25 Ab (clone M-A251; BD PharMingen), or anti-CD69 Ab (clone FN50; BD PharMingen) for 30 min at 4°C. For PD-1 and PD-L1 expression, cells were stained with anti-huPD-1 Ab-biotin conjugate (clone J110) or anti-huPD-L1 Ab-biotin conjugate (clone PD-L112) followed by streptavidin-PE (Southern Biotechnology Associates, Birmingham, AL). Flow cytometry was performed using a FACScan flow cytometer (BD Biosciences, Mountain View, CA) and analyzed using CellQuest software (BD Biosciences). For PCR analysis, the following primers were used: hPD-L1 5' primer, CTGTTGAAGGACCAGCTCTCC; hPD-L1 3' primer, TTTGGAGGATGTGCCAGAGG; hPD-L1 detection primer, TTTGGAGGATGTGCCAGAGG; hPD-L2 5' primer, GAAAGAGCCACTTTGCTGGAGGAGC; hPD-L2 3' primer, TGTTGTGGTGACAGGTCTTT; hPD-L2 detection primer, AACGCTGACGTTTGGCCAGG; and reverse transcription extension primer, CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTT.
CD4+ T cells were activated with anti-CD3- or anti-CD3/PD-L1.Fc-coated microspheres, harvested at 24 h, and RNA extracted using Qiagen RNeasy kit (Qiagen, Valencia, CA). RT-PCR was performed using the extension primer and superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) in 20 µl reactions at 42°C, according to manufacturers protocols. Subsequent PCR was performed using Advantage Polymerase (Clontech Laboratories, Palo Alto, CA) in 30 µl reactions in a Robocycler Gradient 96 (Strategene, La Jolla, CA) set for 5165°C annealing gradient. Reaction conditions were: denaturation 95°C, 2 min; cycling 95°C, 1 min; annealing gradient 72°C, 1 min (35 cycles); and extension 72°C, 10 min. Five microliters of optimally amplified products were fractionated by electrophoresis on 1% TBE agarose gels followed by alkaline capillary transfer onto zeta-probe GT membranes (Bio-Rad, Hercules, CA). 32P-Radiolabeled probes were generated by 5' phosphorylation of detection oligonucleotides using T4 polynucleotide kinase (NEB, Beverly, MA) and subsequently purified on Sephadex G-25 spin columns (Amersham Pharmacia Biotech). Blots were hybridized with detection oligonucleotides in 0.4x White Rain Shampoo for 1 h at 42°C followed by washing in 1x SSC, 1% SDS until adequate background noise levels were achieved (18). Blots were imaged on a BAS2000 phosphoimager (Fuji Medical Systems, Stamford, CT).
Quantitative PCR assessment of IL-2 transcripts
CD4+ T cells were activated with microspheres coated with anti-CD3/control Ig (1 µg/4 µg/107 microspheres), anti-CD3/PD-L1.Fc/control Ig, anti-CD3/ICOS-L.Fc/control Ig or anti-CD3/B7-2.Fc/control Ig, anti-CD3/PD-L1.Fc/ICOS-L.Fc or anti-CD3/PD-L1.Fc/B7-2.Fc (1 µg/2 µg/2 µg/107 microspheres), and harvested 24 h after activation. RNA was prepared as described above. Quantitative PCR was conducted using 50 ng RNA in an ABI Prism 7700 Sequence Detector (Applied Biosystems, Foster City, CA). Data were normalized by GAPDH expression. Oligonucleotide PCR primer pairs and fluorogenic probes for each gene were designed from the published sequences using Primer Express software (Applied Biosystems): IL-2 5' primer, ACCAGGATGCTCACATTTAAGTTTT; IL-2 3' primer, GAGGTTTGAGTTCTTCTTCTAGACACTGA; probe, 6FAM-CATGCCCAAGAAGGCCACAGAACTG. The primers were labeled with FAM at the 5' end and TAMRA at the 3' end (Applied Biosystems). PCR was conducted in duplicate using a PCR reagent kit (TaqMan PCR Core Reagents kit with AmpliTaq Gold; Applied Biosystems) according to the manufacturers protocol. In brief, a master mixture including all reagents required for PCR was prepared to give final concentrations of 1x TaqMan buffer A, 5.5 µM deoxynucleotide triphosphates, 5.5 mM manganese acetate, 0.01 U/µl AmpErase UNG, and 0.025 U/µl of Taq Gold DNA polymerase. Hybridization probe and primers were added to give a final concentration of 100-nM probe and 200-nM primers, and the total reaction volume was increased to 50 µl. PCR was performed for 40 cycles.
Immunoblot assays
CD4+ T cells were activated with anti-CD3-coated microspheres for 5 or 24 h, followed by addition of 100 ng/ml purified IL-2 or IL-21 for 15 min (R&D Systems). Cells were harvested and lysates prepared as described (19). A total of 106 cell equivalent/lane were loaded on 420% SDS-PAGE gel, run to resolution, and protein immunoblotted as described (19). Total and phosphorylated STAT-1, STAT-3, and STAT-5 were probed using rabbit anti-human Abs (Cell Signaling Technologies, Beverly, MA and Santa Cruz Biotechnology, Santa Cruz, CA). All blots were developed using goat anti-rabbit HRP (Jackson ImmunoResearch Laboratories, West Grove, PA) and detected with Super Signal West Dura (Pierce, Rockford, IL).
| Results |
|---|
|
|
|---|
Previous studies examined the expression of PD-1 on murine T and B cell populations and demonstrated that expression of this receptor is tightly regulated and induced upon TCR/B cell receptor (BCR) signals (5, 14). We have examined PD-1 and PD-L expression on anti-CD3/anti-CD28-activated human T cells. Cells were harvested at the indicated times, stained using anti-hu PD-1 and anti-hu PD-L1 Abs, and analyzed by flow cytometry. Minimal PD-1 and PD-L1 expression is observed in resting T cells (0 h time point). Over 50% of T cells are positive for PD-1 and PD-L1 expression 48 h after activation (Fig. 1A). Similar results are obtained upon anti-CD3 activation, although kinetics are slightly delayed (data not shown). Up-regulation of PD-1 and PD-L1 expression correlates with expression of other activation markers such as CD25 and CD69 (Fig. 1A). PD-L2 was analyzed by PCR using RNA prepared from activated T cells. TCR activation results in expression of transcripts for PD-L1 and PD-L2 (Fig. 1B), as well as PD-1 (data not shown). Altogether, these findings indicate that T cell activation results in expression of PD-1 receptor and its ligands and, importantly, suggest that T cells can receive signals through PD-1 as well as deliver signals to other cells through their expression of PD-L.
|
PD-1 engagement by its ligand PD-L1 (PD-L1.Fc) results in inhibition of T cell proliferation and cytokine production (6). In this study, we evaluate anti-PD-1 Abs as agonists and antagonists of the PD-1/PD-L pathway. Abs PD-117 and PD-135 were characterized for their ability to recognize human PD-1 and selected, using both FACS- and ELISA-based assays, for their ability to neutralize the binding of PD-1 to its ligands PD-L1 and PD-L2 (data not shown). PD-117 and PD-135 were found to neutralize PD-1/PD-L interaction with KDs of 5.8 x 10-9 and 6.4 x 10-10 M, respectively (data not shown).
To determine whether anti-PD-1 Abs can signal through PD-1, Ab-coated microspheres were prepared using titrated concentrations of anti-PD-1 Abs and a fixed suboptimal concentration of anti-CD3 Ab. Human CD4+ T cells were stimulated with Ab-coated microspheres and proliferation was determined at 72 h. As shown in Fig. 2A, PD-1 engagement by PD-L1.Fc or PD117 Ab causes decreased T cell proliferation in a dose-dependent manner. As previously reported using immobilized PD-L1.Fc (6), CD28 costimulation can also modulate the ability of immobilized anti-PD-1 Abs to inhibit T cell proliferation; anti-PD-1 Abs inhibitory effect is observed at suboptimal but not optimal conditions of CD28 costimulation (Fig. 2B). These results indicate that neutralizing anti-PD-1 Abs may act as PD-1 agonists when cross-linked and trigger PD-1-mediated inhibition. To further characterize the PD-1 signaling pathway, experiments were performed to determine whether PD-1 down-regulation of T cell responses requires coordinate TCR/PD-1 engagement on a single (CIS) or a separate (TRANS) microsphere surface. CIS microspheres contained anti-CD3 Ab and PD-L1.Fc; TRANS microspheres contained either anti-CD3 or PD-L1.Fc. As shown in Fig. 2C, inhibition of proliferation was only observed when cells were activated with CIS microspheres. To rule out steric hindrance in the TRANS experiments, similar assays were set up using anti-CD3 Ab and B7.2.Fc; B7 costimulation of T cell responses was observed with both CIS and TRANS microspheres (data not shown). Altogether, these findings suggest PD-1 proximity to TCR is required for PD-1 modulatory function on T cell activation. Moreover, these data suggest that for the PD-1 pathway to modulate a T cell response, both activating and inhibitory signals must emanate from the same cell.
|
levels were also measured in these cultures (data not shown).
Increased proliferative responses are dependent on the ability of
anti-PD-1 Ab to block receptor/ligand interaction, as addition of a
nonneutralizing anti-PD-1 Ab has no effect on proliferation or
IFN-
production (data not shown). Thus, PD-1/PD-L interactions may
play a role in regulation of T-T cell interaction and anti-PD-1 Abs
can act as antagonists to modulate this interaction.
|
We have previously reported that optimal CD28 costimulation can override PD-1-mediated inhibition (6). In this study, we examine the effect of optimal ICOS costimulation on TCR/PD-1 signaling. Microspheres were prepared using suboptimal anti-CD3 Ab and optimal PD-L1.Fc, ICOS-L.Fc, and B7-2.Fc concentrations and used to stimulate purified CD4+ T cells. Summarized results obtained with nine donors are shown in Fig. 4A. Costimulation through ICOS (anti-CD3/ICOS-L.Fc microspheres) or CD28 (anti-CD3/B7.2.Fc microspheres) engagement resulted in enhanced T cell proliferation compared with stimulation by anti-CD3 alone (Fig. 4A). Interestingly, engagement of PD-1 in the presence of optimal CD28 costimulation (anti-CD3/B7.2.Fc/PD-L1.Fc) has minimal effect on proliferation (Fig. 4A). In contrast, the ICOS costimulatory effect is negligible in the presence of PD-1 engagement; proliferative responses upon PD-1/ICOS-L activation are similar to those obtained with anti-CD3 alone. Thus, costimulatory signals mediated by ICOS are more susceptible to PD-1-mediated negative regulation than those provided by CD28 costimulation.
ICOS costimulation has been reported to induce low to marginal levels of IL-2 production (20), and exogenous IL-2 rescues PD-1 inhibition (14). Therefore, we reasoned that IL-2 levels induced upon ICOS engagement may be insufficient to override PD-1 inhibition. A summary of IL-2 production levels obtained with five donors under the various stimulatory conditions is shown in Fig. 4B. At 48 and 72 h after activation, IL-2 protein could only be measured in cultures activated in the presence of CD28 costimulation (Fig. 4B, and data not shown). Under conditions of PD-1 engagement, T cell proliferative responses are rescued by CD28 costimulation despite a dramatic reduction in IL-2 levels (Fig. 4, A and B); IL-2 levels equal or above 700 pg/ml are sufficient to account for full restoration of proliferation (Fig. 4, A and B). No IL-2 protein is detected in ICOS-stimulated cultures (Fig. 4B). However, IL-2 transcripts are detected in ICOS-stimulated cultures suggesting that IL-2 produced under these conditions is below assay detection limits (Fig. 4B, inset). Altogether, these findings are consistent with the notion that ICOS costimulation results in IL-2 levels that are sufficient to drive proliferation upon TCR activation but are insufficient to overcome PD-1-mediated inhibition.
Does IL-2 produced during ICOS activation account for the partial rescue of PD-1 inhibition? To address this question, the effect of neutralizing anti-IL-2 Ab on ICOS/PD-1 activation was examined. Anti-hu IL-2 Ab was added at the initiation of cultures at concentrations sufficient to neutralize 20 ng/ml of exogenous IL-2 (data not shown). Anti-IL-2 abrogates the ability of ICOS costimulation to modulate PD-1 inhibition (Fig. 4C). Thus, PD-1 engagement can prevent ICOS but not CD28 costimulation. The inability of ICOS costimulation to override PD-1 inhibition is directly related to the low IL-2 levels it induces upon its engagement.
Modulation of the PD-1/PD-L pathway by IL-2 and other members of
the
common receptor cytokine family
The effect of CD28 and ICOS costimulation on PD-1 inhibition
suggests that IL-2 plays a crucial role in modulation of the PD-1/PD-L
pathway. Indeed, as shown in Fig. 5A, exogenous IL-2
rescues human T cells from PD-1-mediated inhibition, a
finding consistent with our report on murine T cells (14).
As IL-2 shares structural homology with IL-4, IL-7, IL-15, and IL-21
and these cytokines mediate their effect through receptors that
associate with the
common cytokine receptor chain
(21), we examined whether any of these cytokines could
rescue PD-1-mediated inhibition. T cell cultures were activated with
anti-CD3- or anti-CD3/PD-L1.Fc-coated microspheres in the
presence of various concentrations of IL-4, IL-7, IL-15, and IL-21 and
proliferation was measured at 72 h. As shown in Fig. 5, BE, all cytokines enhanced T cell proliferation upon
anti-CD3 Ab activation. However, upon anti-CD3/PD-L1.Fc
activation, only IL-2, IL-7, and IL-15 restored T cell proliferation to
levels equal to those obtained with anti-CD3 alone (Fig. 5, B and C). Neither IL-4 nor IL-21 can fully
restore proliferative responses upon PD-1 engagement (Fig. 5, D and E). These results suggest that differences
in signaling by these cytokines may account for their ability or
inability to rescue PD-1 inhibition.
|
common receptor
cytokine family only those that activate STAT5 phosphorylation can
modulate the PD-1/PD-L pathway.
|
expression
(22). Next, we investigated the effect of the various
cytokines on IL-2R
(CD25) expression. As shown in Table I, anti-CD3 and anti-CD3/PD-L1.Fc
activation of CD4+ T cells by IL-2, IL-7, and
IL-15 results in CD25 up-regulation. In contrast, neither IL-4 nor
IL-21 have any effect on CD25 expression. Taken together these results
support a link between STAT5 activation, up-regulation of CD25
expression, and the ability of a cytokine to rescue PD-1
inhibition.
|
| Discussion |
|---|
|
|
|---|
PD-1 is expressed on T and B cells (5). The phenotype of PD-1-/- mice suggests that the PD-1/PD-L pathway plays a critical role in T and B cell homeostasis and its deficiency leads to deregulation of T and B cell functions (12, 13, 24). The mechanism by which the PD-1/PD-L pathway regulates homeostasis remains unclear; however, a crucial role has been assigned to the interaction of PD-1 on T or B cells with PD-L on APCs and nonlymphoid tissues. We show in this study that human T cells express both PD-1 receptor and PD-L1 and PD-L2 ligands and demonstrate that T-T responses can be modulated upon PD-1/PD-L engagement. Blockade of PD-1/PD-L interaction with antagonistic anti-PD-1 Abs leads to enhance T cell proliferative responses, a finding consistent with a down-regulatory role for the PD-1 pathway in T-T interactions. This finding is significant in light of human T cells expressing MHC class II upon activation and their reported capacity to present Ag to other T cells. Additionally, one could postulate that T-B cell responses could be regulated bidirectionally by the PD-1 pathway and may serve to limit BCR as well as TCR signaling. Studies using purified PD-1-/- murine T and B cells populations should help clarify which interactions are relevant in vivo for limiting immune responses and maintaining peripheral tolerance.
Engagement of PD-1 by either its ligand or anti-PD-1 Abs leads to inhibition of T cell responses. Only those anti-hu PD-1 Abs able to bind PD-1 at its ligand-binding site could function as agonists. Furthermore, agonistic Ab/ligand function requires both TCR and PD-1 signals to be delivered on the same surface. These results are similar to those reported for CTLA-4 function, as CTLA-4-mediated down-regulation also requires coengagement of TCR and CTLA-4 on the same surface (25). On B cells, Okazaki et al. (26) has shown that BCR down-regulation by PD-1 requires coligation of receptors and results in Src homology 2 protein tyrosine phosphatase-2 recruitment and deactivation of downstream signaling molecules such as phosphatidylinositol 3-kinase and extracellular signal-regulated kinase. Altogether, these results support a "modified proximal signal" model (25) in which PD-1 engagement results in activation of the phosphatase Src homology 2 protein tyrosine phosphatase-2 (7) and modification of early TCR phosphorylation events. Our results suggest that in the case of T cells, physical proximity between positive (TCR) and negative (PD-1) signals is required for PD-1-mediated inhibition, suggesting that PD-1 modulation of Ag responses in vivo requires a strict copresentation of Ag and PD-L by the APC. Altogether, our studies with immobilized and soluble anti-PD-1 Abs strongly suggest PD-1 functions as negative regulator of T cell responses. However, these findings do not rule out the possible existence of a second receptor for PD-L ligands and its potential role in costimulation of T cell responses as shown by Dong et al. (23, 27)and Tseng et al. (8).
Induction of IL-2 upon CD28 engagement has been well documented (28) and CD28-/- T cells have diminished IL-2 production (29). Furthermore, IL-2 production in responses to CD28 engagement is central to CD28 ability to rescue PD-1 inhibition (14). In contrast, ICOS costimulation results in IL-2 levels sufficient for initial proliferation but insufficient for sustained growth (20), and we report in this study that costimulation provided by ICOS signaling is susceptible to PD-1 inhibitory effect. By several criteria, our data suggest that low levels of IL-2 produced upon ICOS costimulation account for the susceptibility of this pathway to PD-1 inhibition: ICOS signals induce negligible levels of IL-2 protein, and the modest modulatory effect of ICOS engagement on PD-1-mediated inhibition is abrogated in the presence of neutralizing anti-IL-2 Ab. Additionally, exogenous IL-2 (as low as 10 pg/ml) can rescue PD-1 inhibition. Similarly, a study by Riley and coworkers (20) demonstrates that ICOS engagement cannot prevent inhibition by CTLA-4, and they have proposed that one of ICOS main functions is to initiate T cell responses from nonprofessional APCs in the periphery. As PD-1 ligands PD-L1 and PD-L2 are expressed at sites of inflammation by nonprofessional APCs (6, 7), our findings suggest that PD-1 may be the main attenuator of T cell activation at these sites. Furthermore, our in vitro results suggest that PD-1 signals will override ICOS costimulation and consequently down-regulate T cell responses in vivo at peripheral sites.
We have shown that exogenous IL-2 rescues PD-1-mediated inhibition in
murine CD4+ and CD8+ T
cells (14); in this study, we extend these observations to
human T cells. Furthermore, by examining other cytokines that use the
common chain as part of their receptor, we find that IL-2, IL-7,
and IL-15 can restore proliferative responses upon PD-1 engagement,
whereas IL-4 or IL-21 cannot. Binding of IL-2 and IL-15 to their
receptors results in Janus kinase-mediated phosphorylation of
IL-2R
docking sites, recruitment of STAT5, and its subsequent
phosphorylation (21). IL-4, in contrast, activates STAT6
phosphorylation (21). We find that IL-21, a novel cytokine
whose receptor shares the common
chain, activates STAT1 and STAT3
but not STAT5 on primary T cells. Thus, our results in T cells indicate
that among IL-2 cytokine family members only those that signal through
STAT5 (IL-2, IL-7, and IL-15) can restore proliferative responses upon
PD-1 engagement. Furthermore, treatment of cells with IL-2, IL-7, and
IL-15 results in up-regulation of IL-2R
chain expression. As
IL-2R
up-regulation has been reported to be dependent on STAT5
transcriptional regulation (22, 30), our findings suggest
that selected members of the
common receptor cytokines may be able
to modulate the PD-1 pathway by maintaining high-affinity IL-2R
expression, thus enhancing IL-2-dependent cell growth.
IL-21, a novel cytokine whose receptor shares the common
chain, has
been reported to activate STAT5 on a pro-B cell line, Ba/F3, expressing
a chimeric EPO/IL-21R and primary murine splenic B cells
(31, 32, 33). In contrast, Asao et al. (34)
reports that in an immortalized T cell line, IL-21 treatment activates
STAT1 and 3 but not STAT5. In agreement with this latter report, we
find that in primary human CD4+ T cells, IL-21
activates STAT1 and STAT3 but not STAT5. Thus, our results and those
previously reported (31, 32, 33, 34) strongly support the notion
that IL-21 activates different STATs in T and B cells, with STAT5
activation only occurring in B cells. Therefore, the effects of IL-21
on the PD-1 pathway may differ between B and T cells; IL-21 may rescue
PD-1 inhibition on B, but not T, cells via activation of STAT5.
In summary, our data suggest that the modulation of immune responses by PD-1 will depend upon the type of costimulatory signal delivered, the cytokine milieu, and the signaling pathways activated in the responding cell. PD-1 cannot attenuate immune responses when costimulatory signals induce high IL-2 levels. By contrast, under costimulatory conditions where IL-2 production is limited, i.e., ICOS-ICOS-L, attenuation of immune responses by PD-1 predominates. Interestingly, the cytokine environment may also play a critical role, as cytokines such as IL-15 and IL-7 also rescue PD-1-mediated inhibition. These findings suggest that at peripheral sites of inflammation, PD-1 inhibition can be overcome by expression of non-T cell-derived cytokines, such as IL-15. Finally, the observation that only cytokines that induce STAT5 activation can reverse PD-1-mediated inhibition proposes a connection between inhibitory receptors and cytokine signaling.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: ICOS-L, inducible costimulatory molecule ligand; ICOS, inducible costimulatory molecule; PD-1, program death-1; PD-L, PD-1 ligand; BCR, B cell receptor; hu, human; mu, murine. ![]()
Received for publication August 7, 2002. Accepted for publication November 8, 2002.
| References |
|---|
|
|
|---|
chain induction. Immunity 7:691.[Medline]
chain. Proc. Natl. Acad. Sci. USA 97:11439.
chain (
c) is a required signaling component of the IL-21 receptor and supports IL-21-induced cell proliferation via JAK3. Biochemistry 41:8725.[Medline]
-chain is an indispensable subunit of the IL-21 receptor complex. J. Immunol. 167:1.This article has been cited by other articles:
![]() |
M. Shi, T. H. Lin, K. C. Appell, and L. J. Berg Cell Cycle Progression following Naive T Cell Activation Is Independent of Jak3/Common {gamma}-Chain Cytokine Signals J. Immunol., October 1, 2009; 183(7): 4493 - 4501. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mumprecht, C. Schurch, J. Schwaller, M. Solenthaler, and A. F. Ochsenbein Programmed death 1 signaling on chronic myeloid leukemia-specific T cells results in T-cell exhaustion and disease progression Blood, August 20, 2009; 114(8): 1528 - 1536. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Kinter, E. J. Godbout, J. P. McNally, I. Sereti, G. A. Roby, M. A. O'Shea, and A. S. Fauci The Common {gamma}-Chain Cytokines IL-2, IL-7, IL-15, and IL-21 Induce the Expression of Programmed Death-1 and Its Ligands J. Immunol., November 15, 2008; 181(10): 6738 - 6746. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. O. Jurado, I. B. Alvarez, V. Pasquinelli, G. J. Martinez, M. F. Quiroga, E. Abbate, R. M. Musella, H. E. Chuluyan, and V. E. Garcia Programmed Death (PD)-1:PD-Ligand 1/PD-Ligand 2 Pathway Inhibits T Cell Effector Functions during Human Tuberculosis J. Immunol., July 1, 2008; 181(1): 116 - 125. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-J. Wang, F.-C. Chou, C.-H. Chu, J.-C. Wu, S.-H. Lin, D.-M. Chang, and H.-K. Sytwu Protective Role of Programmed Death 1 Ligand 1 (PD-L1)in Nonobese Diabetic Mice: The Paradox in Transgenic Models Diabetes, July 1, 2008; 57(7): 1861 - 1869. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Lebbink, M. C. W. van den Berg, T. de Ruiter, N. Raynal, J. A. G. van Roon, P. J. Lenting, B. Jin, and L. Meyaard The Soluble Leukocyte-Associated Ig-Like Receptor (LAIR)-2 Antagonizes the Collagen/LAIR-1 Inhibitory Immune Interaction J. Immunol., February 1, 2008; 180(3): 1662 - 1669. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Chemnitz, D. Eggle, J. Driesen, S. Classen, J. L. Riley, S. Debey-Pascher, M. Beyer, A. Popov, T. Zander, and J. L. Schultze RNA fingerprints provide direct evidence for the inhibitory role of TGF{beta} and PD-1 on CD4+ T cells in Hodgkin lymphoma Blood, November 1, 2007; 110(9): 3226 - 3233. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D'Souza, A. P. Fontenot, D. G. Mack, C. Lozupone, S. Dillon, A. Meditz, C. C. Wilson, E. Connick, and B. E. Palmer Programmed Death 1 Expression on HIV-Specific CD4+ T Cells Is Driven by Viral Replication and Associated with T Cell Dysfunction J. Immunol., August 1, 2007; 179(3): 1979 - 1987. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Beier, T. Kallinich, and E. Hamelmann Master switches of T-cell activation and differentiation Eur. Respir. J., April 1, 2007; 29(4): 804 - 812. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Petrovas, J. P. Casazza, J. M. Brenchley, D. A. Price, E. Gostick, W. C. Adams, M. L. Precopio, T. Schacker, M. Roederer, D. C. Douek, et al. PD-1 is a regulator of virus-specific CD8+ T cell survival in HIV infection J. Exp. Med., October 2, 2006; 203(10): 2281 - 2292. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Raimondi, W. J. Shufesky, D. Tokita, A. E. Morelli, and A. W. Thomson Regulated Compartmentalization of Programmed Cell Death-1 Discriminates CD4+CD25+ Resting Regulatory T Cells from Activated T Cells. J. Immunol., March 1, 2006; 176(5): 2808 - 2816. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. V. Parry, J. M. Chemnitz, K. A. Frauwirth, A. R. Lanfranco, I. Braunstein, S. V. Kobayashi, P. S. Linsley, C. B. Thompson, and J. L. Riley CTLA-4 and PD-1 Receptors Inhibit T-Cell Activation by Distinct Mechanisms Mol. Cell. Biol., November 1, 2005; 25(21): 9543 - 9553. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Gilbertson, S. Germano, P. Steele, S. Turner, B. F. de St. Groth, and C. Cheers Bystander Activation of CD8+ T Lymphocytes during Experimental Mycobacterial Infection Infect. Immun., December 1, 2004; 72(12): 6884 - 6891. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Chemnitz, R. V. Parry, K. E. Nichols, C. H. June, and J. L. Riley SHP-1 and SHP-2 Associate with Immunoreceptor Tyrosine-Based Switch Motif of Programmed Death 1 upon Primary Human T Cell Stimulation, but Only Receptor Ligation Prevents T Cell Activation J. Immunol., July 15, 2004; 173(2): 945 - 954. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Nielsen, H Laustrup, A Voss, P Junker, S Husby, and S T Lillevang A putative regulatory polymorphism in PD-1 is associated with nephropathy in a population-based cohort of systemic lupus erythematosus patients Lupus, July 1, 2004; 13(7): 510 - 516. [Abstract] [PDF] |
||||
![]() |
L. E. Gamadia, E. M. M. van Leeuwen, E. B. M. Remmerswaal, S.-L. Yong, S. Surachno, P. M. E. Wertheim-van Dillen, I. J. M. ten Berge, and R. A. W. van Lier The Size and Phenotype of Virus-Specific T Cell Populations Is Determined by Repetitive Antigenic Stimulation and Environmental Cytokines J. Immunol., May 15, 2004; 172(10): 6107 - 6114. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Y. Balkhi, V. K. Latchumanan, B. Singh, P. Sharma, and K. Natarajan Cross-regulation of CD86 by CD80 differentially regulates T helper responses from Mycobacterium tuberculosis secretory antigen-activated dendritic cell subsets J. Leukoc. Biol., May 1, 2004; 75(5): 874 - 883. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Salama, T. Chitnis, J. Imitola, M. J. I. Ansari, H. Akiba, F. Tushima, M. Azuma, H. Yagita, M. H. Sayegh, and S. J. Khoury Critical Role of the Programmed Death-1 (PD-1) Pathway in Regulation of Experimental Autoimmune Encephalomyelitis J. Exp. Med., July 7, 2003; 198(1): 71 - 78. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |