The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yeo, S.-J.
Right arrow Articles by Yi, A.-K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yeo, S.-J.
Right arrow Articles by Yi, A.-K.
The Journal of Immunology, 2003, 170: 1052-1061.
Copyright © 2003 by The American Association of Immunologists

CpG DNA Induces Self and Cross-Hyporesponsiveness of RAW264.7 Cells in Response to CpG DNA and Lipopolysaccharide: Alterations in IL-1 Receptor-Associated Kinase Expression1

Seon-Ju Yeo*, Jae-Geun Yoon*, Soon-Cheol Hong{ddagger},§ and Ae-Kyung Yi2,*,{dagger}

* Children’s Foundation Research Center at Le Bonheur Children’s Hospital, and Department of Pediatrics, University of Tennessee Health Science Center, Memphis, TN 38103; {dagger} Department of Molecular Sciences, University of Tennessee Health Science Center, Memphis, TN 38163; {ddagger} Department of Microbiology and Immunology, Indiana University School of Medicine, Indianapolis, IN 46202; and § Walther Oncology Center, Walther Cancer Institute, Indianapolis, IN 46208


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Exposure of macrophages to LPS induces a state of hyporesponsiveness to subsequent challenge with LPS. It has not been known whether previous exposure to CpG DNA induces a similar suppressive response to subsequent stimulation with CpG DNA. In the present study, we demonstrate that pretreatment with CpG DNA induces suppression of cytokine release in a murine macrophage-like cell RAW264.7 in response to subsequent challenge by CpG DNA. Additionally, CpG DNA-mediated activation of mitogen-activated protein kinases, including c-Jun NH2-terminal kinase, extracellular signal-regulated kinase, and p38, and activation of transcription factors AP-1, CREB, NF-{kappa}B, and STAT1 are greatly suppressed in the cells pre-exposed to CpG DNA. Pretreatment with CpG DNA also partially inhibited LPS-mediated production of cytokines and activation of mitogen-activated protein kinases and transcription factors. Neither LPS nor CpG DNA treatment inhibited Toll-like receptor 4, MD2, Toll-like receptor 9, myeloid differentiation factor 88, Toll/IL-1R domain-containing adaptor protein, Tollip, and TNF-{alpha} receptor-associated factor 6 expression. Interestingly, CpG DNA or LPS stimulation led to the inhibition of IL-1R-associated kinase expression. These results indicate that CpG DNA-induced refractory of RAW264.7 cells may be, at least in part, due to suppressed IL-1R-associated kinase expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Innate immune cells, such as monocytes/macrophages and dendritic cells, play a critical role in directing the host immune response to infection. The innate immune cells recognize conserved molecular patterns present in microbes (pathogen-associated molecular patterns (PAMPs))3 through a family of proteins known as Toll-like receptors (TLRs), which function as pattern recognition receptors and are thereby activated to exert various effector functions, including secretion of proinflammatory cytokines and mediators such as TNF-{alpha}, IL-6, IL-12, and NO (reviewed in Ref. 1). Production of inflammatory mediators and proinflammatory cytokines by innate immune cells is indispensable for the efficient control of growth and dissemination of invading pathogens. However, excessive and uncontrolled production of inflammatory mediators and proinflammatory cytokines caused by bacterial infection is potentially harmful to the host and may lead to severe systematic inflammatory complications, including microcirculatory dysfunction, tissue damage, septic shock, and death (2, 3, 4, 5).

Patients who survive acute septic shock have persistent abnormalities of monocytic cell activation and have an elevated risk of mortality from secondary infections. Neutrophils and monocytes isolated from sepsis patients exhibit a state of hyporesponsiveness, including the absence of proinflammatory cytokine production, low levels of HLA-DR expression, and a reduced capacity for Ag presentation (6, 7, 8). This hypoinflammatory state of macrophages after sepsis is described as immunological paralysis and can be mimicked in vivo and in vitro by pretreating macrophages or injecting whole organisms with endotoxin or LPS, a cell wall component of Gram-negative bacteria and a main inducer of septic shock. This LPS-induced desensitization of macrophages to subsequent challenge with LPS or other bacterial products has been termed endotoxin tolerance and is known to be a unique property of LPS (9, 10). Whether bacterial products other than LPS can induce macrophage hyporesponsiveness similar to endotoxin tolerance has not been extensively studied. Very recently, it has been demonstrated that, like LPS, lipoteichoic acid (LTA) also induces macrophage refractory to subsequent stimulation with LPS or LTA, indicating that other bacterial products may have similar abilities to induce macrophage hyporesponsiveness (11).

Like other bacterial products, unmethylated CpG motifs (GACGTT for murine, GTCGTT for human) in bacterial DNA are capable of activating innate immune cells (12). Ability of bacterial DNA to activate innate immunity can be mimicked by synthetic oligodeoxynucleotides containing the unmethylated CpG motif (CpG DNA). Bacterial DNA and CpG DNA are recognized by a pattern recognition receptor, TLR9, in APCs as a conserved molecular pattern (13, 14). Upon recognition of CpG DNA, TLR9 recruits the adaptor molecule, myeloid differentiation factor 88 (MyD88), through interaction between their C-terminal Toll/IL-1R domains. This recruitment of MyD88 to Toll/IL-1R domain of TLR9 initiates a signaling pathway that sequentially involves IL-1R-associated kinase 1 (IRAK1) and TNF-{alpha} receptor-associated factor 6 (TRAF6) (13, 14, 15). Studies using gene-deficient mice and RAW264.7 cells transiently transfected with the dominant-negative forms of these molecules indicated that this MyD88-mediated signaling pathway is essential for the CpG DNA-induced activation of NF-{kappa}B and c-Jun NH2-terminal kinase (JNK), and subsequent production of cytokines in monocytic cells (13, 14, 15). Evidence for the presence of additional signaling pathways for CpG DNA has also been demonstrated. DNA-activated protein kinase has been suggested to be an upstream modulator of NF-{kappa}B in response to CpG DNA (16). Before cellular activation through these pathways, CpG DNA appears to be endocytosed by leukocytes and acidified in an endosomal compartment, which is coupled to the rapid generation of intracellular reactive oxygen species (17). Endosomal acidification of CpG DNA and the CpG DNA-induced reactive oxygen species generation precedes activation of NF-{kappa}B and mitogen-activated protein kinases (MAPKs) (18, 19). CpG DNA-mediated activation of NF-{kappa}B and MAPKs has been demonstrated to be required for all downstream events induced by CpG DNA (17, 18, 19, 20, 21, 22, 23, 24).

CpG DNA rapidly activates B cells to proliferate; to produce TNF-{alpha}, IL-6, IL-10, and Ig; and to express increased levels of costimulatory molecules (12, 25, 26, 27). CpG DNA also synergizes with B cell receptor-mediated signals, amplifying Ag-specific responses, including TNF-{alpha}, IL-6, IL-10, and Ig production and B cell proliferation, indicating its function as a costimulatory factor in the presence of specific Ag (12, 27) (Yi et al., unpublished data). In addition, CpG DNA rescues mature spleen B cells from spontaneous apoptosis, and WEHI-231 cells and primary immature B cells from Ag receptor-mediated apoptosis (21, 22, 28, 29). In addition to its profound effects on B cells, CpG DNA directly activates dendritic cells and macrophages/monocytes to secrete cytokines and chemokines, including TNF-{alpha}, IFN-{alpha}/{beta}, IL-6, IL-10, IL-12, macrophage-inflammatory protein 1a, macrophage-inflammatory protein 1b, IFN-{gamma}-inducible protein-10, and RANTES; to express increased levels of costimulatory molecules; and to increase Ab-dependent cellular cytotoxicity activity, Ag presentation, and cross priming (17, 30, 31, 32, 33). Cytokines secreted by monocytic cells act in concert with CpG DNA on NK cells to express IFN-{gamma} and to increase NK cell lytic activity (30, 34, 35). Overall, CpG DNA induces a Th1-like pattern of cytokine production dominated by IL-12 and IFN-{gamma}.

In contrast to the ability of CpG DNA to induce strong innate immune responses, recent studies have shown that macrophages previously exposed to CpG DNA produce reduced levels of TNF-{alpha} and NO when subsequently stimulated with LPS or costimulated with LPS and CpG DNA (36, 37, 38). These studies suggest that CpG DNA may have the ability to induce macrophage refractory to subsequent stimulation with LPS or other bacterial products. However, it has not been known whether CpG DNA induces similar hyporesponsiveness in macrophages to subsequent challenge with CpG DNA. In the present study, we demonstrate that CpG DNA induces hyporesponsiveness in a murine macrophage cell line RAW264.7 in response to the subsequent challenge with CpG DNA or LPS. Phosphorylation of MAPK, CREB, and STAT1; activation of AP-1 and NF-{kappa}B; degradation of I-{kappa}B; and expression of cytokines in response to CpG DNA or LPS are substantially suppressed in the RAW264.7 cells pre-exposed to CpG DNA. In addition, our results suggest that CpG DNA may induce a state of macrophage hyporesponsiveness, at least in part, through a dysregulation of IRAK.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Oligodeoxynucleotides

Nuclease-resistant phosphorothioate oligodeoxynucleotides were purchased from Operon (Alameda, CA) and had no detectable endotoxins by Limulus assay. The sequences of phosphorothioate oligodeoxynucleotides used are 5'-TCCATGACGTTCCTGACGTT-3' (CpG DNA: ODN1826) and 5'-TCCAGGACTTCTCTCAGGTT-3' (non-CpG DNA: ODN1982).

Cell lines, culture conditions, and reagents

RAW264.7 cells (American Type Culture Collection, Manassas, VA) were cultured at 37°C in a 5% CO2 humidified incubator and maintained in DMEM supplemented with 10% (v/v) heat-inactivated FCS, 1.5 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. All culture reagents were purchased from Life Technologies (Gaithersburg, MD). LPS (Salmonella minnesota Re 595) was purchased from Sigma-Aldrich (St. Louis, MO). Purity of LPS was confirmed by lacking of its ability to induce IL-6 production in macrophages isolated from LPS-nonresponder C3H/HeJ mice.

Pretreatment of cells

RAW264.7 cells (1 x 106 cells/ml) were pretreated with medium, LPS (10 ng/ml), CpG DNA (0.06–3 µg/ml), or non-CpG DNA (0.06–3 µg/ml) for designated time periods. After pretreatment, cells were washed three times with PBS, resuspended in medium, rested for 1 h, and then stimulated with medium, LPS, CpG DNA, or non-CpG DNA, as indicated for each specific experiment described below.

Cytokine-specific ELISA

The pretreated cells (5 x 105 cells/ml for TNF-{alpha}, and 1 x 106 cells/ml for IL-6, IL-10, and IL-12) were stimulated with medium, LPS (50 ng/ml), CpG DNA (3 µg/ml), or non-CpG DNA (3 µg/ml) for 6 h (for TNF-{alpha}) or 24 h (for IL-6, IL-10, and IL-12). Culture supernatants were analyzed by ELISA for TNF-{alpha}, IL-6, IL-10, or IL-12p40, as described previously (26). All recombinant murine cytokines and Abs specific for murine cytokines were purchased from BD PharMingen (San Diego, CA).

Preparation of RNA and real-time PCR

The pretreated cells (2 x 106 cells/ml) were stimulated with medium, LPS (50 ng/ml), CpG DNA (3 µg/ml), or non-CpG DNA (3 µg/ml) for 4 h. Cells were harvested and total RNA was isolated by using the RNeasy Mini Kit (Qiagen, Valencia, CA), following the manufacturer’s protocol. To measure the relative amount of selected gene transcripts, amplification of sample cDNA was monitored with the fluorescent DNA-binding dye SYBR Green in combination with the ABI 7900 sequence detection system (PE Applied Biosystems, Foster City, CA), according to the manufacturer’s instructions. Forward and reverse primers were designed using primerExpress software (PE Applied Biosystems) and listed in Table I. All PCR primers were purchased from Integrated DNA Technologies (Coralville, IA).


View this table:
[in this window]
[in a new window]
 
Table I. Sequences of real-time PCR primers

 
Preparation of cytoplasmic extracts and nuclear extracts and EMSA

The pretreated cells (2 x 106 cells/ml) were stimulated with medium, LPS (50 ng/ml), CpG DNA (3 µg/ml), or non-CpG DNA (3 µg/ml) for 1 h. Cells were harvested and then cytoplasmic extracts and nuclear extracts were prepared, as previously described (17). To detect DNA-binding activity of the transcription factor AP-1 or NF-{kappa}B, nuclear extracts (3 µg/lane) were analyzed by EMSA, as previously described (17), using 32P-labeled double-stranded oligodeoxynucleotides containing the AP1 (GATCTAGTGATGAGTCAGCCGGATC) (39)- or NF-{kappa}B (GTAGGGGACTTTCCGAGCTCGAGATCCTATG) (40)-binding sequence as a probe. Cytoplasmic extracts were used to detect presence of I-{kappa}B{alpha} and I-{kappa}B{beta} by Western blot analysis described below.

Preparation of whole cell lysates and Western blot analysis

The pretreated cells (2 x 106 cells/ml) were stimulated with medium, LPS (50 ng/ml), CpG DNA (3 µg/ml), or non-CpG DNA (3 µg/ml) for designated time periods. In some experiments, RAW264.7 cells were stimulated with medium, LPS, CpG DNA, or non-CpG DNA for 24 h without pretreatment. Whole cell lysates were prepared, as previously described (17, 19). To detect presence of a specific protein or phosphorylation status of a specific protein, equal amounts (15 µg/lane) of whole cell lysates or cytoplasmic extracts were subjected to electrophoresis on a 10% polyacrylamide gel containing 0.1% SDS, and then Western blots were performed, as previously described (19). Actin was used as a loading control. Specific Abs against I-{kappa}B{alpha}, I-{kappa}B{beta}, p38, MyD88, TLR4, TRAF6, or actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Specific Abs against the phosphorylated form of CREB, extracellular signal-regulated kinase (ERK), JNK, or p38 were purchased from New England Biolabs (Beverly, MA). Anti-IRAK and specific Abs against the phosphorylated forms of STAT1 were purchased from Upstate Biotechnology (Lake Placid, NY). Anti-TLR9 was purchased from BIOCARTA (San Diego, CA).

Surface and intracellular staining and flow cytometric analysis

RAW264.7 cells (1 x 106 cells/ml) were stimulated with medium, LPS (20 ng/ml), CpG DNA (1.2 µg/ml), or non-CpG DNA (1.2 µg/ml) for 4, 8, or 24 h. Cells were harvested. To detect TLR4/MD2 or TLR9 levels on the cell surface, cells were stained with PE-conjugated anti-mouse TLR4/MD2 (eBioscience, San Diego, CA) or anti-TLR9 (BIOCARTA), followed by staining with FITC-conjugated anti-mouse IgG1 (BD PharMingen). For intracellular staining, cells were incubated in Cytofix/Cytoperm reagent (BD PharMingen) for 15 min at room temperature and then stained with PE-conjugated anti-mouse TLR4/MD2 or anti-TLR9, followed by staining with FITC-conjugated anti-mouse IgG1. Stained cells were analyzed on an EPICS XL-MCL using EXPO32 ADC software (Coulter, Miami, FL).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pre-exposure to CpG DNA induces hyporesponsiveness of RAW264.7 cells to subsequent CpG DNA stimulation

Using a murine macrophage-like cell line, RAW264.7, we investigated whether pre-exposure to CpG DNA would induce hyporesponsiveness in macrophages in response to subsequent CpG DNA challenge. As shown in Fig. 1A, CpG DNA pretreatment of RAW264.7 cells for 24 h resulted in a substantial decrease in TNF-{alpha} production in response to CpG DNA stimulation. This inhibitory effect induced by CpG DNA pretreatment was dependent on the dose of CpG DNA used for the pretreatment. RAW264.7 cells pretreated with CpG DNA for 8 h also showed reduced levels of TNF-{alpha} production after subsequent CpG DNA challenge (data not shown). In addition, cells pretreated with CpG DNA for 4–8 h and then incubated for 20 h in the absence of CpG DNA still showed a similar degree of suppressed TNF-{alpha} production in response to CpG DNA stimulation (data not shown). Comparatively, cells pre-exposed to control non-CpG DNA showed normal levels of TNF-{alpha} production in response to CpG DNA stimulation (Fig. 1A). We next analyzed whether CpG DNA pretreatment causes similar hyporesponsiveness of RAW264.7 cells in regard to the production of other cytokines in response to subsequent CpG DNA challenge. Similar to the TNF-{alpha} production, RAW264.7 cells pretreated with CpG DNA showed dramatically suppressed production of IL-6, IL-10, and IL-12 in response to CpG DNA stimulation (Fig. 1, B–D). In contrast, cells pre-exposed to medium alone or control non-CpG DNA showed little or no suppression in the production of these cytokines in response to the subsequent CpG DNA challenge (Fig. 1).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1. Pre-exposure to CpG DNA induces hyporesponsiveness of murine macrophage-like cell line RAW264.7 cells to subsequent CpG DNA stimulation. RAW264.7 cells (1 x 106 cells/ml) were pretreated with medium, CpG DNA (0.06–3 µg/ml), or non-CpG DNA (0.06–3 µg/ml) for 24 h. After pretreatment, cells (5 x 105 cells/ml for TNF-{alpha}, and 1 x 106 cells/ml for IL-6, IL-10, and IL-12) were stimulated with medium (open bar), CpG DNA (3 µg/ml, filled bar), or non-CpG DNA (3 µg/ml, hatched bar) for 6 h (for TNF-{alpha}, A) or 24 h (for IL-6, IL-10, and IL-12, B–D). The levels of TNF-{alpha}, IL-10, or IL-12p40 in culture supernatants were determined by ELISA. Data represent the mean ± SD of triplicates. The experiment was done three to five times with similar results.

 
We further investigated whether these suppressed cytokine protein productions in RAW264.7 cells pre-exposed to CpG DNA correlate with cytokine mRNA expression. Compared with cells pre-exposed to medium or non-CpG DNA, the cells pre-exposed to CpG DNA showed higher background levels of TNF-{alpha}, IL-6, and IL-10 mRNA expression. However, levels of TNF-{alpha}, IL-6, IL-10, and IL-12p40 mRNA expression induced by subsequent CpG DNA challenge were greatly reduced, if not abolished, in the cells pre-exposed to CpG DNA, but not in the cells pre-exposed to medium or control non-CpG DNA (Fig. 2). These results indicate that, like LPS and LTA, CpG DNA induces refractory of macrophages to subsequent CpG DNA challenge.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 2. RAW264.7 cells pre-exposed to CpG DNA show reduced cytokine mRNA expression in response to subsequent CpG DNA stimulation. RAW264.7 cells (1 x 106 cells/ml) were pretreated with medium, CpG DNA (0.6 µg/ml), or non-CpG DNA (0.6 µg/ml) for 24 h. After pretreatment, cells (1 x 106 cells/ml) were stimulated with medium (open bar), CpG DNA (3 µg/ml, filled bar), or non-CpG DNA (3 µg/ml, hatched bar) for 4 h. Total RNA was isolated, and the presence of gene transcripts for TNF-{alpha}, IL-6, IL-10, IL-12p40, and GAPDH in each sample was detected by real-time PCR using SYBR Green. GAPDH was used for endogenous control. Data represent the mean (fold induction from unstimulated control) ± SD of triplicates. The experiment was done three times with similar results.

 
RAW264.7 cells previously exposed to CpG DNA or LPS show altered cytokine response to CpG DNA or LPS challenge

We further investigated whether macrophages pre-exposed to CpG DNA show hyporesponsiveness to subsequent LPS stimulation by examining the level of cytokine production. As shown in Fig. 3, pre-exposure of RAW264.7 cells to CpG DNA for 24 h resulted in suppressed release of TNF-{alpha} and IL-6 in response to LPS stimulation. Surprisingly, IL-10 production induced by LPS was substantially increased in the cells pre-exposed to CpG DNA (Fig. 3C). LPS did not induce IL-12 production in RAW264.7 cells and CpG DNA pretreatment did not alter IL-12 production in response to the subsequent LPS challenge (data not shown). These inhibitory or enhancing effects of the CpG DNA pretreatment on LPS-induced cytokine production were dependent on the dose of CpG DNA used for the pretreatment (Fig. 3). In contrast, control non-CpG DNA pretreatment resulted in little or no alteration in the cytokine production induced by LPS in RAW264.7 cells (Fig. 3).



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 3. CpG DNA pretreatment alters macrophage cytokine production by LPS. RAW264.7 cells (1 x 106 cells/ml) were pretreated with medium, CpG DNA (0.06–3 µg/ml), or non-CpG DNA (0.06–3 µg/ml) for 24 h. After pretreatment, cells (5 x 105 cells/ml for TNF-{alpha}, and 1 x 106 cells/ml for IL-6, IL-10, and IL-12) were stimulated with medium (open bar) or LPS (50 ng/ml, filled bar) for 6 h (for TNF-{alpha}, A) or 24 h (for IL-6 and IL-10, B and C). The levels of TNF-{alpha}, IL-6, or IL-10 in culture supernatants were determined by ELISA. Data represent the mean ± SD of triplicates. The experiment was done three times with similar results.

 
Similar to the effects of CpG DNA pretreatment on the LPS-mediated macrophage cytokine production, LPS pretreatment also induced hyporesponsiveness of RAW264.7 cells in response to CpG DNA stimulation. CpG DNA-mediated TNF-{alpha}, IL-10, and IL-12 production was greatly suppressed in the RAW264.7 cells previously exposed to LPS (Fig. 4). Interestingly, LPS pretreatment substantially potentiated IL-6 production induced by CpG DNA (Fig. 4B). Taken together, these results suggest that pretreatment with CpG DNA or LPS has differential effects on the different cytokines produced in RAW264.7 cells in response to subsequent LPS or CpG DNA challenge, and that the CpG DNA- or LPS-induced hyporesponsiveness of RAW264.7 cells may not be due to exhaustion of the cells, but is rather the result of a complicated reprogramming of the cells.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 4. LPS pretreatment alters macrophage cytokine production in response to CpG DNA. RAW264.7 cells (1 x 106 cells/ml) were pretreated with medium or LPS (10 or 50 ng/ml) for 24 h. After pretreatment, cells (5 x 105 cells/ml for TNF-{alpha}, and 1 x 106 cells/ml for IL-6, IL-10, and IL-12) were stimulated with medium (open bar), LPS (50 ng/ml, filled bar), CpG DNA (3 µg/ml, hatched bar), or non-CpG DNA (3 µg/ml, crossed bar) for 6 h (for TNF-{alpha}, A) or 24 h (for IL-6, IL-10, and IL-12, B–D). The levels of TNF-{alpha}, IL-6, IL-10, or IL-12p40 in culture supernatants were determined by ELISA. Data represent the mean ± SD of triplicates. The experiment was done more than three times with similar results.

 
CpG DNA or LPS pretreatment alters CpG DNA- or LPS-mediated activation of transcription factors

It has previously been demonstrated that CpG DNA induces activation of transcription factors AP-1, CREB, NF-{kappa}B, and STAT1, and that these transcription factors play a critical role in CpG DNA-mediated cytokine production (17, 19, 20, 24). Therefore, we investigated whether CpG DNA-mediated activation of one or more of these transcription factors is altered in the RAW264.7 cells pre-exposed to CpG DNA. As demonstrated in Fig. 5A, CpG DNA and LPS strongly induced activation of both NF-{kappa}B and AP-1 in RAW264.7 cells. In contrast, both CpG DNA- and LPS-mediated activation of NF-{kappa}B and AP-1 was substantially inhibited in the RAW264.7 cells previously exposed to CpG DNA. Similarly, LPS pretreatment substantially suppressed the activation of NF-{kappa}B in response to subsequent CpG DNA or LPS challenge. Interestingly, LPS-mediated AP-1 activation was abolished, but CpG DNA-mediated AP-1 activation was only partially inhibited in the RAW264.7 cells pre-exposed to LPS (Fig. 5A). Because phosphorylation, ubiquitination, and proteosomal degradation of I-{kappa}B precede the nuclear translocation of NF-{kappa}B (41), we investigated whether CpG DNA-induced degradation of I-{kappa}B{alpha} and I-{kappa}B{beta} is also suppressed by pretreatment with CpG DNA. As expected, CpG DNA- or LPS-mediated induction of I-{kappa}B{alpha} and I-{kappa}B{beta} degradation was substantially prevented by CpG DNA or LPS pretreatment (Fig. 5B). As previously demonstrated (24), both CpG DNA and LPS induced phosphorylation of STAT1 and CREB in RAW274.7 cells (Fig. 5C). CpG DNA pretreatment abolished STAT1 phosphorylation in RAW264.7 cells in response to CpG DNA or LPS challenge. In addition, LPS pretreatment substantially inhibited the CpG DNA- or LPS-mediated induction of STAT1 phosphorylation. CpG DNA- and LPS-induced phosphorylation of CREB was also partially inhibited by pretreatment of RAW264.7 cells with either CpG DNA or LPS. In contrast, neither CpG DNA nor LPS pretreatment led to the inhibition of CREB phosphorylation induced by PMA (Fig. 5C). Taken together, these results indicate that both CpG DNA and LPS pretreatment greatly attenuates activation of all the transcription factors we analyzed, but the degree of suppression is different for each transcription factor and is also dependent on the type of subsequent stimuli. These results also suggest that CpG DNA or LPS pretreatment may, at least partially, lead to the suppression of a step(s) in the signaling pathway that is commonly shared by CpG DNA and LPS.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 5. CpG DNA- and LPS-induced activation of transcription factor NF-{kappa}B and AP-1 is altered in macrophages pre-exposed to CpG DNA or LPS. RAW264.7 cells (1 x 106 cells/ml) were pretreated with medium, LPS (20 ng/ml), CpG DNA (1.2 µg/ml), or non-CpG DNA (1.2 µg/ml) for 24 h. After pretreatment, cells were washed three times with PBS, resuspended in medium, and then rested for 1 h. A and B, Cells (2 x 106 cells/ml) were stimulated with medium, LPS (50 ng/ml), or CpG DNA (3 µg/ml) for 1 h. Cytoplasmic extracts and nuclear extracts were prepared. DNA-binding activities of transcription factor NF-{kappa}B or AP-1 in equal amounts of nuclear extracts (3 µg/lane) were analyzed by EMSA using 32P-labeled double-stranded oligodeoxynucleotides containing the AP-1 or NF-{kappa}B consensus DNA-binding sequence as a probe (A). Specificity of bands was determined by cold-competition and supershift EMSA. To detect presence of I-{kappa}B{alpha} and I-{kappa}B{beta} in the cytoplasm, equal amounts of cytoplasmic extracts (15 µg/lane) were subjected to SDS-PAGE, followed by Western blot analysis. C, Cells (2 x 106 cells/ml) were stimulated with medium, LPS (50 ng/ml), or CpG DNA (3 µg/ml) for 3 h. Equal amounts of whole cell lysates (15 µg/lane) were subjected to SDS-PAGE, and then Western blots were performed using a specific Ab against the phosphorylated form of CREB (pCREB) or STAT1 (pSTAT1, recognize phosphorylation of STAT1 at tyrosine 701). Actin was used as a loading control. The experiment was done three times with similar results.

 
Macrophages pre-exposed to CpG DNA or LPS show suppressed activation of MAPK in response to CpG DNA or LPS second challenge

MAPKs play a critical role in the CpG DNA-mediated activation of transcription factor AP-1, CREB, and STAT1 (19, 23, 24). Because CpG DNA- or LPS-mediated activation of transcription factors was substantially altered in the RAW264.7 cells pre-exposed to CpG DNA or LPS, we further investigated whether CpG DNA or LPS pretreatment also influences the MAPK activation after subsequent CpG DNA or LPS stimulation. As shown in Fig. 6, CpG DNA failed to induce phosphorylation of JNK and ERK above background levels in the RAW264.7 cells pre-exposed to CpG DNA. However, CpG DNA still induced phosphorylation of p38 in the same cells. In contrast, LPS-mediated JNK activation was only partially inhibited in the RAW264.7 cells pretreated with CpG DNA. CpG DNA pretreatment also showed little or no effect on the LPS-induced phosphorylation of ERK or p38. In the RAW264.7 cells pre-exposed to LPS, activation of p38 and ERK induced by CpG DNA was substantially suppressed compared with those in cells pretreated with medium alone (Fig. 6). However, LPS pretreatment resulted in only partial inhibition of CpG DNA-induced JNK phosphorylation. In contrast, activation of all three MAPKs, JNK, ERK, and p38, induced by LPS was greatly inhibited in the RAW264.7 cells pre-exposed to LPS (Fig. 6). These results demonstrate that as for the cytokine production, CpG DNA pretreatment induces hyporesponsiveness to subsequent CpG DNA challenge for MAPK activation, but induces less suppressive effects on LPS-mediated MAPK activation. In contrast, LPS pretreatment induces hyporesponsiveness to both CpG DNA and LPS challenges with regard to MAPK activation in RAW264.7 cells. These results indicate that CpG DNA and LPS may have differential effects on the upstream signaling modulators in the MAPK activation pathways.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 6. CpG DNA- and LPS-induced activation of MAPK is altered in RAW264.7 cells pre-exposed to CpG DNA or LPS. RAW264.7 cells (1 x 106 cells/ml) were pretreated with medium, LPS (20 ng/ml), or CpG DNA (1.2 µg/ml) for 24 h. After pretreatment, cells were washed three times with PBS, resuspended in medium, and then rested for 1 h. Cells (2 x 106 cells/ml) were stimulated with medium, LPS (50 ng/ml), or CpG DNA (3 µg/ml) for 1 h. Equal amounts of whole cell lysates (15 µg/lane) were subjected to SDS-PAGE, and then Western blots were performed using a specific Ab against the phosphorylated form of JNK (pJNKp52 and pJNKp46), ERK (pERK1 and pERK2), or p38 (pp38). Actin was used as a loading control. The experiment was done three times with similar results.

 
CpG DNA suppresses the expression of IRAK, but not TLR4 or TLR9

CpG DNA- or LPS-induced hyporesponsiveness of RAW264.7 cells could be due to alterations in the expression level or function of TLRs or signaling molecules in the TLR-mediated signaling pathway. Therefore, we investigated whether CpG DNA treatment can affect the expression of TLR4, TLR9, and/or TLR downstream signaling modulators. As shown in Fig. 7, expression of surface TLR4/MD2 was decreased within 8 h after stimulation with LPS or CpG DNA, but increased at later time periods (Fig. 7, Aa and Ba). In addition, CpG DNA or LPS stimulation led to decreased TLR4 mRNA expression within 8 h, but levels returned to normal by 24 h after stimulation (Fig. 7C). In contrast to the surface TLR4/MD2 expression and TLR4 mRNA expression, total TLR4/MD2 protein levels were slightly increased within 8 h after stimulation with CpG DNA or LPS (Fig. 7, Ab, Bb, and H). Additionally, MD2 mRNA levels were also slightly increased at 24 h after stimulation with CpG DNA or LPS (Fig. 7D). Unlike TLR4, levels of TLR9 on the cell surface were low compared with the levels of TLR9 in whole cells (Fig. 7, compare Ea and Fa with Eb and Fb), indicating that TLR9 may present in both cell membrane and intracellular organelles or cytoplasm. Interestingly, CpG DNA or LPS induced slight increases in the expression of TLR9 at both mRNA and protein levels (Fig. 7, E–H). These results indicate that macrophage hyporesponsiveness induced by CpG DNA may not be due to alterations in TLR4 or TLR9 expression.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 7. Effects of CpG DNA or LPS on the expression of TLR4, MD2, and TLR9 in RAW264.7 cells. A, B, E, and F, RAW264.7 cells (1 x 106 cells/ml) were stimulated with medium (shaded area), LPS (20 ng/ml, solid line, for A and E), CpG DNA (1.2 µg/ml, thick solid line, for B and F), or non-CpG DNA (1.2 µg/ml, thin solid line, for B and F) for 4–24 h. For surface expression of TLR4 (Aa and Ba) or TLR9 (Ea and Fa), cells were stained with PE-conjugated anti-mouse TLR4/MD2 or anti-TLR9, followed by staining with FITC-conjugated anti-mouse IgG1. For intracellular staining of TLR4 (Ab and Bb) or TLR9 (Eb and Fb), cells were incubated in Cytofix/Cytoperm reagent for 15 min at room temperature and then stained with PE-conjugated anti-mouse TLR4/MD2 or anti-TLR9, followed by staining with FITC-conjugated anti-mouse IgG1. Stained cells were analyzed by FACS. C and G, RAW264.7 cells were stimulated with medium ({diamondsuit}), CpG DNA (0.6 µg/ml, {square}), or LPS (10 ng/ml, x) for indicated time periods. Total RNA was isolated, and the presence of mRNA for GAPDH and TLR4 (C) or TLR9 (G) in each sample was detected by real-time PCR using SYBR Green. GAPDH was used for endogenous control. Data represent the mean (% of unstimulated control) ± SD of triplicates. D, RAW264.7 cells were stimulated with medium, CpG DNA (0.6 µg/ml), or LPS (10 ng/ml) for 24 h. Total RNA was isolated, and the presence of mRNA for GAPDH and MD2 in each sample was detected by real-time PCR using SYBR Green. GAPDH was used for endogenous control. Data represent the mean (% of unstimulated control) ± SD of triplicates. H, RAW264.7 cells were stimulated with medium, LPS (10 ng/ml), CpG DNA (0.6 µg/ml), or non-CpG DNA (0.6 µg/ml) for 24 h. The levels of TLR9, TLR4, or actin in whole cell lysates (60 µg/lane) were analyzed by Western blot using an Ab specific for TLR9, TLR4, or actin. Actin was used as loading control. The experiments were done three times with similar results.

 
Upon activation, TLRs recruit the signaling modulators MyD88, Toll/IL-1R domain-containing adapter protein (TIRAP), Tollip and IRAK complex, and TRAF6, and play a critical role in immune cell activation by PAMPs, including LPS and CpG DNA (reviewed in Refs. 1 and 42). We therefore investigated whether CpG DNA induces alterations in the expression of these signaling modulators. Our results demonstrated that CpG DNA or LPS showed little or no effect on the expression of MyD88, Tollip, and TRAF6, but induced expression of TIRAP (Fig. 8, A and C). Surprisingly, both CpG DNA and LPS induced disappearance of IRAK within 1 h (data not shown). Moreover, both CpG DNA and LPS induced suppression of IRAK expression at both mRNA and protein levels (Fig. 8, B and C). These results suggest an exciting new possibility that CpG DNA as well as LPS may lead to macrophage hyporesponsiveness by, at least partially, inducing IRAK degradation and inhibiting IRAK expression.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 8. Effects of CpG DNA or LPS stimulation on the expression of MyD88, TIRAP, Tollip, IRAK, and TRAF6 in RAW264.7 cells. A, RAW264.7 cells (1 x 106 cells/ml) were stimulated with medium, LPS (10 ng/ml), or CpG DNA (0.6 µg/ml) for 24 h. Total RNA was isolated, and the presence of mRNA for GAPDH, MyD88, TIRAP, Tollip, and TRAF6 in each sample was detected by real-time PCR using SYBR Green. GAPDH was used for endogenous control. B, RAW264.7 cells were stimulated with medium ({diamondsuit}), CpG DNA (0.6 µg/ml, {square}), or LPS (10 ng/ml, x) for indicated time periods. Total RNA was isolated, and the presence of mRNA for GAPDH and IRAK in each sample was detected by real-time PCR using SYBR Green. GAPDH was used for endogenous control. C, RAW264.7 cells were stimulated with medium, LPS (10 ng/ml), CpG DNA (0.6 µg/ml), or non-CpG DNA (0.6 µg/ml) for 24 h. Equal amounts of whole cell lysates (30 µg/lane) were subjected to SDS-PAGE, and then Western blots were performed using a specific Ab against MyD88, IRAK, TRAF6, or actin. Actin was used as loading control. The experiments were done three times with similar results.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In recent years, much progress has been made in uncovering the proximal signaling pathways responsible for CpG DNA-mediated innate immune cell activation and the beneficial effects and therapeutic applications of CpG DNA. However, it is yet to be understood how CpG DNA-induced inflammation is eventually down-regulated and whether the innate immune system has developed a protection mechanism to prevent CpG DNA-mediated septic shock-like syndrome and/or chronic inflammatory diseases. In the present study, we investigated whether CpG DNA has the ability to induce a refractory state in macrophages using a murine macrophage cell line RAW264.7 as a model system.

For a long time, hyporesponsiveness of monocytic cells after sepsis has been known to be due to a unique function of LPS that induces desensitization of macrophages to subsequent challenge with LPS and other bacterial products (9, 10, 11). Therefore, whether bacterial products other than LPS can induce macrophage hyporesponsiveness has not been intensively studied. Our results demonstrated that CpG DNA pretreatment, but not control non-CpG DNA pretreatment, dramatically suppressed expression of several cytokines, including TNF-{alpha}, IL-6, IL-10, and IL-12, in RAW264.7 cells in response to subsequent stimulation with CpG DNA (Figs. 1 and 2). In addition, pretreatment with CpG DNA also partially inhibited TNF-{alpha} and IL-6 production in response to LPS (Fig. 3). Furthermore, recent studies also showed that macrophages previously exposed to CpG DNA produce reduced levels of TNF-{alpha} and NO in response to subsequent stimulation with LPS or costimulation with LPS and CpG DNA (36, 37, 38). Similar to the ability of CpG DNA to induce macrophage hyporesponsiveness to subsequent challenge with CpG DNA or LPS, other PAMPs such as LPS and LTA have also been shown to induce a refractory state of macrophages to subsequent stimulation with LPS, LTA, or mycoplasmal lipopeptides (macrophage-activating lipopeptides 2 kDa) (9, 10, 11, 43, 44). Moreover, our results showed that LPS pretreatment also suppressed the CpG DNA-mediated TNF-{alpha}, IL-10, and IL-12 production (Fig. 4). These observations indicate that the ability to induce macrophage refractory may not be a unique property of LPS, but rather a common characteristic of PAMPs, such as LTA and CpG DNA. The abilities of CpG DNA, LPS, and LTA to induce macrophage refractory might contribute to induction of the hypoinflammatory state of neutrophils and monocytes/macrophages, described as immunological paralysis, observed in patients who have survived acute septic shock (6, 7, 8). Although it has some detrimental consequences, this hyporesponsiveness of monocytic cells after sepsis may have developed as a part of a host defense mechanism to minimize damage from severe inflammatory reactions and to prevent chronic inflammatory illness.

The hyporesponsiveness of macrophages induced by LPS or CpG DNA does not reflect a global deactivation of macrophage function. Although the LPS-induced production of several pro- and anti-inflammatory cytokines (e.g., TNF-{alpha}, IL-1, IL-6, IL-10, and IL-12) is suppressed in the macrophages pre-exposed to LPS, expression of other modulators (e.g., IL-1R antagonist, TNFRII, and NO) is not inhibited in the same cells (10, 43, 45). In addition, LPS pretreatment enhanced the CpG DNA-induced IL-6 production, while it suppressed the CpG DNA-mediated production of TNF-{alpha}, IL-10, and IL-12 (Fig. 4). CpG DNA pretreatment also suppressed the LPS-induced TNF-{alpha} and IL-6 production. However, the LPS-induced IL-10 production was dramatically enhanced in the cells pre-exposed to CpG DNA (Fig. 3). These findings indicate that hyporesponsiveness of macrophages induced by CpG DNA or LPS is not simply due to the exhaustion of macrophages, but rather due to a more complicated reprogramming of cells.

Inhibition of LPS signaling in macrophages pretreated with LPS occurs very early in the signaling cascade, involving suppressed IRAK activation, decreased membrane GTP-binding capacity and G protein content, and altered expression of phospholipase C-{gamma}1 and phosphatidylinositol-3' kinase (46, 47, 48). Endotoxin-tolerant cells also show suppressed activation of MAPKs and I-{kappa}B kinase, and decreased degradation of I-{kappa}B{alpha} and I-{kappa}B{beta} in response to LPS stimulation (49, 50, 51, 52, 53). In addition, endotoxin-tolerant macrophages have been found to express decreased levels of Jun B and suppressed transcriptional activation of AP-1 and NF-{kappa}B after LPS stimulation (49, 54). Our results also demonstrated that LPS pretreatment partially inhibited LPS-induced STAT1 and CREB activation (Fig. 5C). Furthermore, LPS pretreatment prevented degradation of I-{kappa}B{alpha} and I-{kappa}B{beta} and greatly suppressed activation of transcription factors, including NF-{kappa}B, AP-1, CREB, and STAT1, in response to subsequent CpG DNA challenge (Fig. 5). Of note, it has been previously demonstrated that macrophages pre-exposed to LPS show reduced activation of NF-{kappa}B in response to LTA or macrophage-activating lipopeptides 2 kDa (11, 44). Similarly, CpG DNA- or LPS-mediated activation of NF-{kappa}B, AP-1, and STAT1 was almost completely abolished in the RAW264.7 cells pretreated with CpG DNA (Fig. 5). In addition, CpG DNA failed to induce phosphorylation of JNK and ERK above the background levels in the RAW264.7 cells pre-exposed to CpG DNA (Fig. 6). However, activation of CREB in response to CpG DNA or LPS in the same cells was only partially suppressed (Fig. 5C). Moreover, CpG DNA- or LPS-mediated p38 activation was only minimally affected by CpG DNA pretreatment (Fig. 6). Of interest, we have previously demonstrated that CpG DNA activates CREB through a p38-dependent manner (24). These results indicate that both CpG DNA and LPS pretreatment greatly attenuate activation of all transcription factors and MAPKs we analyzed; however, the degree of suppression is different for each transcription factor and MAPK, and it is also dependent on the type of second stimuli. These results also suggest that inhibited expression of cytokines seen in the CpG DNA-pretreated RAW264.7 cells in response to CpG DNA or LPS stimulation is likely to result from decreased activation of the transcription factors and MAPKs that are pivotal in governing expression of a variety of cytokine genes, and that pretreatment with CpG DNA or LPS may, at least partially, lead to the suppression of a step(s) in the signaling pathway that is commonly shared by CpG DNA and LPS.

Molecular mechanisms of the bacterial products-mediated induction of macrophage hyporesponsiveness are not completely understood at the present time. CpG DNA- or LPS-induced macrophage hyporesponsiveness could be due to alterations in the expression or function of TLR or signaling molecules in the TLR-mediated signaling pathway. LPS-induced macrophage hyporesponsiveness is not accompanied by decreased expression of CD14 (55, 56). In addition, controversy exists regarding the involvement of TLR4 expression in the induction of tolerance to LPS (44, 57, 58). Similar to the observation by Nomura et al. (57), both mRNA and surface protein expressions of TLR4 are decreased within 8 h after stimulation with either LPS or CpG DNA in RAW264.7 cells (Fig. 7, A–C). However, the levels of both TLR4 mRNA and protein returned to normal by 24 h after stimulation, the actual time of the second challenge. In addition, both CpG DNA and LPS induced slight increases in the expression of TLR9 at both mRNA and protein levels (Fig. 7, E–H). Furthermore, pretreatment of RAW264.7 cells with either CpG DNA or LPS for >4 h induced the hyporesponsiveness of these cells to subsequent challenge with LPS (data not shown). Taken together, our results suggest that the CpG DNA- and LPS-induced hyporesponsiveness of RAW264.7 cells to LPS or CpG DNA may not likely be due to alterations in the TLR4 or TLR9 expression.

After recognition of PAMPs, TLRs recruit MyD88, TIRAP, Tollip and IRAK complex, and TRAF6, signaling modulators that play a critical role in the macrophage activation by LPS or CpG DNA (reviewed in Refs 1 and 42). Because CpG DNA and LPS induce cross-tolerance as well as self-tolerance, it is likely that prolonged treatment of CpG DNA or LPS might induce alterations in the function and/or expression of one or more of these downstream signaling modulators commonly shared by TLR4- and TLR9-signaling pathways. It has been demonstrated that expression of MyD88 and IRAK is normal in endotoxin-tolerant peritoneal macrophages (44, 58). Our results also demonstrated that neither CpG DNA nor LPS inhibits MyD88 expression at both mRNA and protein levels (Fig. 8, A and C). In addition, either CpG DNA or LPS stimulation shows little or no effects on the expression of Tollip and TRAF6 (Fig. 8, A and C). However, stimulation of RAW264.7 cells with either CpG DNA or LPS resulted in the disappearance of IRAK within 1 h (data not shown), which might be due to multiphosphorylation, ubiquitination, and proteosomal degradation of IRAK following activation (59). Furthermore, both CpG DNA and LPS induced suppression of IRAK expression at both mRNA and protein levels in RAW264.7 cells (Fig. 8, B and C). Of interest, previous studies revealed that LPS pretreatment leads to the inhibition of IRAK enzyme activity (48, 57). In addition, IRAK-deficient mice or macrophages show impaired cytokine production and septic shock in response to LPS (60, 61, 62). Of note, during the preparation of this manuscript, Li and colleagues (63) reported that LPS, but not LTA, induces degradation and down-regulation of IRAK in THP-1 cells. Furthermore, Adib-Conquy and Cavaillon (64) found that IRAK expression and kinase activity are inhibited in the endotoxin-tolerant human monocytes, and IFN-{gamma} and GM-CSF prevent endotoxin tolerance by inhibiting IRAK degradation and by promoting IRAK expression and its association with MyD88. Collectively, these observations indicate that the CpG DNA-induced inhibition of IRAK expression may be one of the factors that contribute to the hyporesponsiveness of RAW264.7 cells to subsequent challenge with CpG DNA or LPS.

In summary, the present study demonstrates that prolonged treatment with CpG DNA leads to the hyporesponsiveness of macrophages to CpG DNA and LPS. This CpG DNA-mediated refractory of macrophages may, at least partially, be due to dysregulation of IRAK expression.


    Footnotes
 
1 A.-K.Y. was supported by Children’s Foundation Research Center at Le Bonheur Children’s Hospital, and Vascular Biology Center of Excellence, Center of Excellence for Diseases of Connective Tissue, and Rheumatic Disease Research Core Center (U.S. Public Health Service Grant AR-47379) at the University of Tennessee, and grants from National Institutes of Health 1R03AR47757, Leukemia Research Foundation, and Le Bonheur Children’s Medical Center. S.-C.H. was supported by National Institutes of Health R01 DE13988. Back

2 Address correspondence and reprint requests to Dr. Ae-Kyung Yi, Department of Pediatrics, University of Tennessee Health Science Center, 50 North Dunlap Street, Room 315, Memphis, TN 38103. E-mail address: ayi{at}utmem.edu Back

3 Abbreviations used in this paper: PAMP, pathogen-associated molecular pattern; ERK, extracellular signal-regulated kinase; IRAK, IL-1R-associated kinase; JNK, c-Jun NH2-terminal kinase; LTA, lipoteichoic acid; MAPK, mitogen-activated protein kinase; MyD88, myeloid differentiation factor 88; TIRAP, Toll/IL-1R domain-containing adaptor protein; TLR, Toll-like receptor; TRAF6, TNF-{alpha} receptor-associated factor 6. Back

Received for publication July 15, 2002. Accepted for publication November 12, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Aderem, A., R. J. Ulevitch. 2000. Toll-like receptors in the induction of the innate immune response. Nature 406:782.[Medline]
  2. Tracey, K., Y. Fong, D. Hesse, K. Manogue, A. Lee, G. Kuo, S. Lowry, A. Cerami. 1987. Anti-cachectin/TNF monoclonal antibodies prevent septic shock during lethal bacteraemia. Nature 330:662.[Medline]
  3. Morrison, D. C., J. L. Ryan. 1987. Endotoxins and disease mechanisms. Annu. Rev. Med. 38:417.[Medline]
  4. Danner, R. L., R. J. Elin, J. M. Hosseini, R. A. Wesley, J. M. Reilly, J. E. Parillo. 1991. Endotoxemia in human septic shock. Chest 99:169.[Abstract/Free Full Text]
  5. Haimovitz-Friedman, A., C. Gordon-Cardo, S. Bayoumy, M. Garzotto, M. McLoughlin, R. Gallily, C. K. Edwards, III, E. H. Schuchman, Z. Fuks, R. Kolesnick. 1997. Lipopolysaccharide induces disseminated endothelial apoptosis requiring ceramide generation. J. Exp. Med. 186:1831.[Abstract/Free Full Text]
  6. Volk, H. D., M. Thieme, U. Ruppe, S. Heym, W.-D. Docke, D. Manger, S. Zuckermann, A. Golosubow, B. Nieter, H. Klug, R. van Baehr. 1993. Alterations in function and phenotype of monocytes from patients with septic disease: predictive value and new therapeutic strategies. E. Faist, III, and J. L. Meakins, III, eds. Host Defense Dysfunction in Trauma, Shock, and Sepsis 246.-271. Springer, Berlin.
  7. Docke, W.-D., U. Syrbe, A. Meinecke, C. Platzer, A. Makki, K. A. Asadullah, C. Klug, H. Zuckermann, P. Reinke, H. Brunner, et al 1994. Improvement of monocytic function: a new therapeutic approach?. K. Reinhart, III, and K. Eyrich, III, and C. Sprung, III, eds. Sepsis: Current Perspectives in Pathophysiology and Therapy 437.-500. Springer, Berlin.
  8. Docke, W.-D., F. Randow, U. Syrbe, D. Krausch, K. A. Asadullah, P. Reinke, H.-D. Volk, W. Kox. 1997. Monocytes deactivation in septic patients: restoration by IFN-{gamma} treatment. Nat. Med. 3:678.[Medline]
  9. Ziegler-Heitbrock, H. W.. 1995. Molecular mechanism in tolerance to lipopolysaccharide. J. Inflamm. 45:13.[Medline]
  10. Shnyra, A., R. Brewington, A. Alipio, C. Amura, D. C. Morrison. 1998. Reprogramming of lipopolysaccharide-primed macrophages is controlled by a counterbalanced production of IL-10 and IL-12. J. Immunol. 160:3729.[Abstract/Free Full Text]
  11. Lehner, M. D., S. Morath, K. S. Michelsen, R. R. Schumann, T. Hartung. 2001. Induction of cross-tolerance by lipopolysaccharide and highly purified lipoteichoic acid via different Toll-like receptors independent of paracrine mediators. J. Immunol. 166:5161.[Abstract/Free Full Text]
  12. Krieg, A. M., A.-K. Yi, S. Matson, T. Waldscmidt, G. Bishop, R. Teasdale, G. A. Koretzky, D. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B cell activation. Nature 374:546.[Medline]
  13. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  14. Bauer, S., C. J. Kirschning, H. Häcker, V. Redecke, S. Hausmann, S. Akira, H. Wagner, G. B. Lipford. 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad. Sci. USA 98:9237.[Abstract/Free Full Text]
  15. Hacker, H., R. M. Vabulas, O. Takeuchi, K. Hoshino, S. Akira, H. Wagner. 2000. Immune cell activation by bacterial CpG-DNA through myeloid differentiation marker 88 and tumor necrosis factor receptor-associated factor (TRAF) 6. J. Exp. Med. 192:595.[Abstract/Free Full Text]
  16. Chu, W., X. Gong, Z. Li, K. Takabayashi, H. Ouyang, Y. Chen, A. Lois, D. J. Chen, G. C. Li, M. Karin, E. Raz. 2000. DNA-PKcs is required for activation of innate immunity by immunostimulatory DNA. Cell 103:909.[Medline]
  17. Yi, A.-K., R. Tuetken, T. Redford, M. Waldschmidt, J. Kirsch, A. M. Krieg. 1998. CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species. J. Immunol. 160:4755.[Abstract/Free Full Text]
  18. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, K. Heeg, G. B. Lipford, H. Wagner. 1998. CpG DNA specific activation of antigen presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO J. 17:6230.[Medline]
  19. Yi, A.-K., A. M. Krieg. 1998. Rapid induction of mitogen activated protein kinases by immune stimulatory CpG DNA. J. Immunol. 161:4493.[Abstract/Free Full Text]
  20. Stacey, K. J., M. J. Sweet, D. A. Hume. 1996. Macrophages ingest and are activated by bacterial DNA. J. Immunol. 157:2116.[Abstract]
  21. Yi, A.-K., A. M. Krieg. 1998. CpG DNA rescue from anti-IgM induced WEHI-231 B lymphoma apoptosis via modulation of I{kappa}B{alpha} and I{kappa}B{beta} and sustained activation of nuclear factor-{kappa}B/c-Rel. J. Immunol. 160:1240.[Abstract/Free Full Text]
  22. Yi, A.-K., D. W. Peckham, R. F. Ashman, A. M. Krieg. 1999. CpG DNA rescues B cells from apoptosis by activating NF{kappa}B and preventing mitochondrial membrane potential disruption via a chloroquine sensitive pathway. Int. Immunol. 11:2015.[Abstract/Free Full Text]
  23. Hacker, H., H. Mischak, G. Hacker, S. Eser, N. Prenzel, A. Ullrich, H. Wagner. 1999. Cell type-specific activation of mitogen-activated protein kinases by CpG-DNA controls interleukin-12 release from antigen-presenting cells. EMBO J. 18:6973.[Medline]
  24. Yi, A.-K., J.-G. Yoon, S.-J. Yeo, S.-C. Hong, B. K. English, A. M. Krieg. 2002. Role of mitogen-activated protein kinases in CpG DNA-mediated IL-10 and IL-12 production: central role of extracellular signal-regulated kinase in the negative feedback loop of the CpG DNA-mediated Th1 response. J. Immunol. 168:4711.[Abstract/Free Full Text]
  25. Klinman, D. M., A.-K. Yi, S. L. Beaucage, J. Conover, A. M. Krieg. 1996. CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon {gamma}. Proc. Natl. Acad. Sci. USA 93:2879.[Abstract/Free Full Text]
  26. Yi, A.-K., J. H. Chace, J. S. Cowdery, A. M. Krieg. 1996. IFN-{gamma} promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J. Immunol. 156:558.[Abstract]
  27. Yi, A.-K., D. M. Klinman, T. L. Martin, S. Matson, A. M. Krieg. 1996. Rapid immune activation by CpG motifs in bacterial DNA: systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. J. Immunol. 157:5394.[Abstract]
  28. Yi, A.-K., P. Hornbeck, D. E. Lafrenz, A. M. Krieg. 1996. CpG DNA rescue of murine B lymphoma cells from anti-IgM induced growth arrest and programmed cell death is associated with increased expression of c-myc and bcl-xL. J. Immunol. 157:4918.[Abstract]
  29. Yi, A.-K., M. Chang, D. W. Peckham, A. M. Kreig, R. F. Ashman. 1998. CpG oligodeoxyribonucleotides rescue mature murine spleen B cells from spontaneous apoptosis and promote cell cycle entry. J. Immunol. 160:5898.[Abstract/Free Full Text]
  30. Cowdery, J. S., J. H. Chace, A.-K. Yi, A. M. Krieg. 1996. Bacterial DNA induces NK cells to produce interferon-{gamma} in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
  31. Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28:2045.[Medline]
  32. Jakob, T., P. S. Walker, A. M. Krieg, M. C. Udey, J. C. Vogel. 1998. Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J. Immunol. 161:3042.[Abstract/Free Full Text]
  33. Hartmann, G., G. J. Weiner, A. M. Krieg. 1999. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc. Natl. Acad. Sci. USA 96:9305.[Abstract/Free Full Text]
  34. Ballas, Z. K., W. L. Rasmussen, A. M. Krieg. 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157:1840.[Abstract]
  35. Iho, S., T. Yamamoto, T. Takahashi, S. Yamamoto. 1999. Oligodeoxynucleotides containing palindrome sequences with internal 5'-CpG-3' act directly on human NK and activated T cells to induce IFN-{gamma} production in vitro. J. Immunol. 163:3642.[Abstract/Free Full Text]
  36. Crabtree, T. D., L. Jin, D. P. Raymond, S. J. Pelletier, C. W. Houlgrave, T. G. Gleason, T. L. Pruett, R. G. Sawyer. 2001. Preexposure of murine macrophages to CpG oligonucleotide results in a biphasic tumor necrosis factor {alpha} response to subsequent lipopolysaccharide challenge. Infect. Immun. 69:2123.[Abstract/Free Full Text]
  37. Gao, J. J., E. G. Zuvanich, Q. Xue, D. L. Horn, R. Silverstein, D. C. Morrison. 1999. Bacterial DNA and LPS act in synergy in inducing nitric oxide production in RAW264.7 macrophages. J. Immunol. 163:4095.[Abstract/Free Full Text]
  38. Gao, J. J., Q. Xue, C. J. Papasian, D. C. Morrison. 2001. Bacterial DNA and lipopolysaccharide induce synergistic production of TNF-{alpha} through a post-transcriptional mechanism. J. Immunol. 166:6855.[Abstract/Free Full Text]
  39. Olsson, C., K. Riebeck, M. Dohlsten, E. Michaelsson. 1999. CTLA-4 ligation suppresses CD28-induced NF-{kappa}B and AP-1 activity in mouse T cell blasts. J. Biol. Chem. 274:14400.[Abstract/Free Full Text]
  40. Plaisance, S., B. W. Vanden, E. Boone, W. Fiers, G. Haegeman. 1997. Recombination signal sequence binding protein J{kappa} is constitutively bound to the NF-{kappa}B site of the interleukin-6 promoter and acts as a negative regulatory factor. Mol. Cell. Biol. 17:3733.[Abstract]
  41. Ghosh, S., M. J. May, E. B. Kopp. 1998. NF-{kappa}B and Rel proteins: evolutionary conserved mediators of immune responses. Annu. Rev. Immunol. 66:225.
  42. Akira, S., K. Takeda, T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immun. 2:675.[Medline]
  43. Schade, F. U., R. Flash, S. Flohe, M. Majetschak, E. Kreuzfelder, E. Dominguez-Fernandez, J. Borgermann, M. Reuter, U. Obertacke. 1999. Endotoxin tolerance. H. Brade, III, and S. M. Opal, III, and S. N. Vogel, III, and D. C. Morrison, III, eds. Endotoxin in Health and Disease 50. Marcel Dekker, New York.
  44. Sato, S., F. Nomura, T. Kawai, O. Takeuchi, P. F. Mühlradt, K. Takeda, S. Akira. 2000. Synergy and cross-tolerance between Toll-like receptor (TLR) 2- and TLR4-mediated signaling pathways. J. Immunol. 165:7096.[Abstract/Free Full Text]
  45. Karp, C. L., M. Wysocka, X. Ma, M. Marovich, R. E. Factor, T. Nutman, M. Armant, L. Wahl, P. Cuomo, G. Trinchieri. 1998. Potent suppression of IL-12 production from monocytes and dendritic cells during endotoxin tolerance. Eur. J. Immunol. 28:3128.[Medline]
  46. Bowling, W. M., D. G. Hafenrichter, M. W. Flye, M. P. Callery. 1995. Endotoxin tolerance alters phopholipase C-{gamma}1 and phosphatidylinositol-3'-kinase expression in peritoneal macrophages. J. Surg. Res. 58:592.[Medline]
  47. Makhlouf, M., B. Zingarelli, P. V. Halushka, J. A. Cook. 1998. Endotoxin tolerance alters macrophage membrane regulatory G proteins. Prog. Clin. Biol. Res. 397:217.[Medline]
  48. Li, L., S. Cousart, J. Hu, C. E. McCall. 2000. Characterization of interleukin-1 receptor-associated kinase in normal and endotoxin-tolerant cells. J. Biol. Chem. 275:23340.[Abstract/Free Full Text]
  49. Medvedev, A. E., K. M. Kopydlowski, S. N. Vogel. 2000. Inhibition of lipopolysaccharide-induced signal transduction in endotoxin-tolerized mouse macrophages: dysregulation of cytokine, chemokine, and Toll-like receptor 2 and 4 gene expression. J. Immunol. 164:5564.[Abstract/Free Full Text]
  50. Kraatz, J., L. Clair, J. L. Rodriguez, M. A. West. 1999. In vitro macrophage endotoxin tolerance: defective in vitro macrophage MAPK kinase signal transduction after LPS pretreatment is not present in macrophages from C3H/HeJ endotoxin resistant mice. Shock 11:58.[Medline]
  51. Kraatz, J., L. Clair, J. L. Rodriguez, M. A. West. 1999. Macrophage TNF secretion in endotoxin tolerance: role of SAPK, p38, and MAPK. J. Surg. Res. 83:158.[Medline]
  52. Tominaga, K., S. Saito, M. Matsuura, M. Nakano. 1999. Lipopolysaccharide tolerance in murine peritoneal macrophages induces down-regulation of the lipopolysaccharide signal transduction pathway through mitogen-activated protein kinase and nuclear factor-{kappa}B cascades, but not lipopolysaccharide-incorporation steps. Biochim. Biophys. Acta 1450:130.[Medline]
  53. Kohler, N. G., A. Joly. 1997. The involvement of an LPS inducible I{kappa}B kinase in endotoxin tolerance. Biochem. Biophys. Res. Commun. 232:602.[Medline]
  54. Fujihara, M., K. Ikebuchi, T. L. Maekawa, S. Wakamoto, T. Ito, T. Suzuki, T. A. Takahashi, S. Sekiguchi. 1998. Lipopolysaccharide-induced desensitization of junB gene expression in a mouse macrophage-like cell line, P388D1. J. Immunol. 161:3659.[Abstract/Free Full Text]
  55. Takasuka, N., K. Matsuura, S. Yamamoto, K. S. Akagawa. 1995. Suppression of TNF-{alpha} mRNA expression in LPS-primed macrophages occurs at the level of nuclear factor-{kappa}B activation, but not at the level of protein kinase C or CD14 expression. J. Immunol. 154:4803.[Abstract]
  56. Labeta, M. O., J. J. Durieux, G. Spagnoli, N. Fernandez, J. Wijdenes, R. Herrmann. 1993. CD14 and tolerance to lipopolysaccharide: biochemical and functional analysis. Immunology 80:415.[Medline]
  57. Nomura, F., S. Akashi, Y. Sakao, S. Sato, T. Kawai, M. Matsumoto, K. Nakanishi, M. Kimoto, K. Miyake, K. Takeda, S. Akira. 2000. Endotoxin tolerance in mouse peritoneal macrophages correlates with down-regulation of surface Toll-like receptor 4 expression. J. Immunol. 164:3476.[Abstract/Free Full Text]
  58. Medvedev, A. E., P. Henneke, A. Schromm, E. Lien, R. Ingalls, M. J. Fenton, D. T. Golenbock, S. N. Vogel. 2001. Induction of tolerance to lipopolysaccharide and mycobacterial components in Chinese hamster ovary/CD14 cells is not affected by overexpression of Toll-like receptors 2 or 4. J. Immunol. 167:2257.[Abstract/Free Full Text]
  59. Yamin, T.-T., D. K. Miller. 1997. The interleukin-1 receptor-associated kinase is degraded by proteasomes following its phosphorylation. J. Biol. Chem. 272:21540.[Abstract/Free Full Text]
  60. Thomas, J. A., J. L. Allen, M. Tsen, T. Dubnicoff, J. Danao, X. C. Liao, Z. Cao, S. A. Wasserman. 1999. Impaired cytokine signaling in mice lacking the IL-1 receptor-associated kinase. J. Immunol. 163:978.[Abstract/Free Full Text]
  61. Kanakaraj, P., P. H. Schafer, D. E. Cavender, Y. Wu, K. Ngo, P. F. Grealish, S. A. Wadsworth, P. A. Peterson, J. J. Siekierka, C. A. Harris, W. P. Fung-Leung. 1998. Interleukin (IL)-1 receptor-associated kinase (IRAK) requirement for optimal induction of multiple IL-1 signaling pathways and IL-6 production. J. Exp. Med. 187:2073.[Abstract/Free Full Text]
  62. Swantek, J. L., M. F. Tsen, M. H. Cobb, J. A. Thomas. 2000. IL-1 receptor-associated kinase modulates host responsiveness to endotoxin. J. Immunol. 164:4301.[Abstract/Free Full Text]
  63. Jacinto, R., T. Hartung, C. McCall, L. Li. 2002. Lipopolysaccharide- and lipoteichoic acid-induced tolerance and cross-tolerance: distinct alterations in IL-1 receptor-associated kinase. J. Immunol. 168:6136.[Abstract/Free Full Text]
  64. Adib-Conquy, M., J. M. Cavaillon. 2002. {gamma} Interferon and granulocyte/monocyte colony-stimulating factor prevent endotoxin tolerance in human monocytes by promoting interleukin-1 receptor-associated kinase expression and its association to MyD88, and not by modulating TLR4 expression. J. Biol. Chem. 277:27927.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. S. Poovassery, T. J. Vanden Bush, and G. A. Bishop
Antigen Receptor Signals Rescue B Cells from TLR Tolerance
J. Immunol., September 1, 2009; 183(5): 2974 - 2983.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. F. de Vos, J. M. Pater, P. S. van den Pangaart, M. D. de Kruif, C. van 't Veer, and T. van der Poll
In Vivo Lipopolysaccharide Exposure of Human Blood Leukocytes Induces Cross-Tolerance to Multiple TLR Ligands
J. Immunol., July 1, 2009; 183(1): 533 - 542.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J.-E. Park, Y.-I. Kim, and A.-K. Yi
Protein Kinase D1: A New Component in TLR9 Signaling
J. Immunol., August 1, 2008; 181(3): 2044 - 2055.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-I. Kim, J.-E. Park, A. Martinez-Hernandez, and A.-K. Yi
CpG DNA Prevents Liver Injury and Shock-mediated Death by Modulating Expression of Interleukin-1 Receptor-associated Kinases
J. Biol. Chem., May 30, 2008; 283(22): 15258 - 15270.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
P. Knuefermann, M. Schwederski, M. Velten, P. Krings, H. Ehrentraut, M. Rudiger, O. Boehm, K. Fink, U. Dreiner, C. Grohe, et al.
Bacterial DNA induces myocardial inflammation and reduces cardiomyocyte contractility: role of Toll-like receptor 9
Cardiovasc Res, April 1, 2008; 78(1): 26 - 35.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Kumar, L. D. Hazlett, and F.-S. X. Yu
Flagellin Suppresses the Inflammatory Response and Enhances Bacterial Clearance in a Murine Model of Pseudomonas aeruginosa Keratitis
Infect. Immun., January 1, 2008; 76(1): 89 - 96.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Kumar, J. Yin, J. Zhang, and F.-S. X. Yu
Modulation of Corneal Epithelial Innate Immune Response to Pseudomonas Infection by Flagellin Pretreatment
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4664 - 4670.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. A. Kittan, A. Bergua, S. Haupt, N. Donhauser, P. Schuster, K. Korn, T. Harrer, and B. Schmidt
Impaired Plasmacytoid Dendritic Cell Innate Immune Responses in Patients with Herpes Virus-Associated Acute Retinal Necrosis
J. Immunol., September 15, 2007; 179(6): 4219 - 4230.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
A. E. Medvedev, I. Sabroe, J. D. Hasday, and S. N. Vogel
Invited review: Tolerance to microbial TLR ligands: molecular mechanisms and relevance to disease
Innate Immunity, June 1, 2006; 12(3): 133 - 150.
[Abstract] [PDF]


Home page
J. Leukoc. Biol.Home page
C. H. Li, J. H. Wang, and H. P. Redmond
Bacterial lipoprotein-induced self-tolerance and cross-tolerance to LPS are associated with reduced IRAK-1 expression and MyD88-IRAK complex formation
J. Leukoc. Biol., April 1, 2006; 79(4): 867 - 875.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Zhou, S.-X. Zheng, W. Tang, P.-L. He, X.-Y. Li, Y.-F. Yang, Y.-C. Li, J.-G. Geng, and J.-P. Zuo
Inhibition of Inducible Nitric-Oxide Synthase Expression by (5R)-5-Hydroxytriptolide in Interferon-{gamma}- and Bacterial Lipopolysaccharide-Stimulated Macrophages
J. Pharmacol. Exp. Ther., January 1, 2006; 316(1): 121 - 128.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Jozefowski, M. Arredouani, T. Sulahian, and L. Kobzik
Disparate Regulation and Function of the Class A Scavenger Receptors SR-AI/II and MARCO
J. Immunol., December 15, 2005; 175(12): 8032 - 8041.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. Jiang, R. Sun, H. Wei, and Z. Tian
Toll-like receptor 3 ligand attenuates LPS-induced liver injury by down-regulation of toll-like receptor 4 expression on macrophages
PNAS, November 22, 2005; 102(47): 17077 - 17082.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. V. Pedchenko, G. Y. Park, M. Joo, T. S. Blackwell, and J. W. Christman
Inducible binding of PU.1 and interacting proteins to the Toll-like receptor 4 promoter during endotoxemia
Am J Physiol Lung Cell Mol Physiol, September 1, 2005; 289(3): L429 - L437.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Rao, S. Nguyen, K. Ngo, and W.-P. Fung-Leung
A Novel Splice Variant of Interleukin-1 Receptor (IL-1R)-Associated Kinase 1 Plays a Negative Regulatory Role in Toll/IL-1R-Induced Inflammatory Signaling
Mol. Cell. Biol., August 1, 2005; 25(15): 6521 - 6532.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. A. Perry, C. S. Olver, R. C. Burnett, and A. C. Avery
Cutting Edge: The Acquisition of TLR Tolerance during Malaria Infection Impacts T Cell Activation
J. Immunol., May 15, 2005; 174(10): 5921 - 5925.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. S. Goodridge, F. A. Marshall, K. J. Else, K. M. Houston, C. Egan, L. Al-Riyami, F.-Y. Liew, W. Harnett, and M. M. Harnett
Immunomodulation via Novel Use of TLR4 by the Filarial Nematode Phosphorylcholine-Containing Secreted Product, ES-62
J. Immunol., January 1, 2005; 174(1): 284 - 293.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Yang, F. M. Murillo, H. Cui, R. Blosser, S. Uematsu, K. Takeda, S. Akira, R. P. Viscidi, and R. B. S. Roden
Papillomavirus-Like Particles Stimulate Murine Bone Marrow-Derived Dendritic Cells To Produce Alpha Interferon and Th1 Immune Responses via MyD88
J. Virol., October 15, 2004; 78(20): 11152 - 11160.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
F. Hatao, M. Muroi, N. Hiki, T. Ogawa, Y. Mimura, M. Kaminishi, and K.-i. Tanamoto
Prolonged Toll-like receptor stimulation leads to down-regulation of IRAK-4 protein
J. Leukoc. Biol., October 1, 2004; 76(4): 904 - 908.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Siedlar, M. Frankenberger, E. Benkhart, T. Espevik, M. Quirling, K. Brand, M. Zembala, and L. Ziegler-Heitbrock
Tolerance Induced by the Lipopeptide Pam3Cys Is Due to Ablation of IL-1R-Associated Kinase-1
J. Immunol., August 15, 2004; 173(4): 2736 - 2745.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Wongratanacheewin, W. Kespichayawattana, P. Intachote, S. Pichyangkul, R. W. Sermswan, A. M. Krieg, and S. Sirisinha
Immunostimulatory CpG Oligodeoxynucleotide Confers Protection in a Murine Model of Infection with Burkholderia pseudomallei
Infect. Immun., August 1, 2004; 72(8): 4494 - 4502.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Bafica, C. A. Scanga, M. Schito, D. Chaussabel, and A. Sher
Influence of Coinfecting Pathogens on HIV Expression: Evidence for a Role of Toll-Like Receptors
J. Immunol., June 15, 2004; 172(12): 7229 - 7234.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. L. McCoy, S. E. Kurtz, F. A. Hausman, D. R. Trune, R. M. Bennett, and S. H. Hefeneider
Activation of RAW264.7 Macrophages by Bacterial DNA and Lipopolysaccharide Increases Cell Surface DNA Binding and Internalization
J. Biol. Chem., April 23, 2004; 279(17): 17217 - 17223.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. H. Stovall, A.-K. Yi, E. A. Meals, A. J. Talati, S. A. Godambe, and B. K. English
Role of vav1- and src-related Tyrosine Kinases in Macrophage Activation by CpG DNA
J. Biol. Chem., April 2, 2004; 279(14): 13809 - 13816.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
Hongkuan Fan and J. A. Cook
Review: Molecular mechanisms of endotoxin tolerance
Innate Immunity, April 1, 2004; 10(2): 71 - 84.
[Abstract] [PDF]


Home page
J. Leukoc. Biol.Home page
K. S. Kobayashi and R. A. Flavell
Shielding the double-edged sword: negative regulation of the innate immune system
J. Leukoc. Biol., March 1, 2004; 75(3): 428 - 433.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Bafica, C. A. Scanga, O. Equils, and A. Sher
The induction of Toll-like receptor tolerance enhances rather than suppresses HIV-1 gene expression in transgenic mice
J. Leukoc. Biol., March 1, 2004; 75(3): 460 - 466.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Haase, C. J. Kirschning, A. Sing, P. Schrottner, K. Fukase, S. Kusumoto, H. Wagner, J. Heesemann, and K. Ruckdeschel
A Dominant Role of Toll-Like Receptor 4 in the Signaling of Apoptosis in Bacteria-Faced Macrophages
J. Immunol., October 15, 2003; 171(8): 4294 - 4303.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yeo, S.-J.
Right arrow Articles by Yi, A.-K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yeo, S.-J.
Right arrow Articles by Yi, A.-K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS