| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,
* Children’s Foundation Research Center at Le Bonheur Children’s Hospital, and Department of Pediatrics, University of Tennessee Health Science Center, Memphis, TN 38103;
Department of Molecular Sciences, University of Tennessee Health Science Center, Memphis, TN 38163;
Department of Microbiology and Immunology, Indiana University School of Medicine, Indianapolis, IN 46202; and
Walther Oncology Center, Walther Cancer Institute, Indianapolis, IN 46208
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B, and STAT1 are greatly suppressed in the
cells pre-exposed to CpG DNA. Pretreatment with CpG DNA also partially
inhibited LPS-mediated production of cytokines and activation of
mitogen-activated protein kinases and transcription factors. Neither
LPS nor CpG DNA treatment inhibited Toll-like receptor 4, MD2,
Toll-like receptor 9, myeloid differentiation factor 88, Toll/IL-1R
domain-containing adaptor protein, Tollip, and TNF-
receptor-associated factor 6 expression. Interestingly, CpG DNA or LPS
stimulation led to the inhibition of IL-1R-associated kinase
expression. These results indicate that CpG DNA-induced refractory of
RAW264.7 cells may be, at least in part, due to suppressed
IL-1R-associated kinase expression. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-6, IL-12, and NO (reviewed
in Ref. 1). Production of inflammatory mediators and
proinflammatory cytokines by innate immune cells is indispensable for
the efficient control of growth and dissemination of invading
pathogens. However, excessive and uncontrolled production of
inflammatory mediators and proinflammatory cytokines caused by
bacterial infection is potentially harmful to the host and may lead to
severe systematic inflammatory complications, including
microcirculatory dysfunction, tissue damage, septic shock, and death
(2, 3, 4, 5). Patients who survive acute septic shock have persistent abnormalities of monocytic cell activation and have an elevated risk of mortality from secondary infections. Neutrophils and monocytes isolated from sepsis patients exhibit a state of hyporesponsiveness, including the absence of proinflammatory cytokine production, low levels of HLA-DR expression, and a reduced capacity for Ag presentation (6, 7, 8). This hypoinflammatory state of macrophages after sepsis is described as immunological paralysis and can be mimicked in vivo and in vitro by pretreating macrophages or injecting whole organisms with endotoxin or LPS, a cell wall component of Gram-negative bacteria and a main inducer of septic shock. This LPS-induced desensitization of macrophages to subsequent challenge with LPS or other bacterial products has been termed endotoxin tolerance and is known to be a unique property of LPS (9, 10). Whether bacterial products other than LPS can induce macrophage hyporesponsiveness similar to endotoxin tolerance has not been extensively studied. Very recently, it has been demonstrated that, like LPS, lipoteichoic acid (LTA) also induces macrophage refractory to subsequent stimulation with LPS or LTA, indicating that other bacterial products may have similar abilities to induce macrophage hyporesponsiveness (11).
Like other bacterial products, unmethylated CpG motifs (GACGTT for
murine, GTCGTT for human) in bacterial DNA are capable of activating
innate immune cells (12). Ability of bacterial DNA to
activate innate immunity can be mimicked by synthetic
oligodeoxynucleotides containing the unmethylated CpG motif (CpG DNA).
Bacterial DNA and CpG DNA are recognized by a pattern recognition
receptor, TLR9, in APCs as a conserved molecular pattern (13, 14). Upon recognition of CpG DNA, TLR9 recruits the adaptor
molecule, myeloid differentiation factor 88 (MyD88), through
interaction between their C-terminal Toll/IL-1R domains. This
recruitment of MyD88 to Toll/IL-1R domain of TLR9 initiates a signaling
pathway that sequentially involves IL-1R-associated kinase 1 (IRAK1)
and TNF- receptor-associated factor 6 (TRAF6) (13, 14, 15).
Studies using gene-deficient mice and RAW264.7 cells transiently
transfected with the dominant-negative forms of these molecules
indicated that this MyD88-mediated signaling pathway is essential for
the CpG DNA-induced activation of NF-B and c-Jun
NH2-terminal kinase (JNK), and subsequent
production of cytokines in monocytic cells (13, 14, 15).
Evidence for the presence of additional signaling pathways for CpG DNA
has also been demonstrated. DNA-activated protein kinase has been
suggested to be an upstream modulator of NF-B in response to CpG DNA
(16). Before cellular activation through these pathways,
CpG DNA appears to be endocytosed by leukocytes and acidified in an
endosomal compartment, which is coupled to the rapid generation of
intracellular reactive oxygen species (17). Endosomal
acidification of CpG DNA and the CpG DNA-induced reactive oxygen
species generation precedes activation of NF-B and mitogen-activated
protein kinases (MAPKs) (18, 19). CpG DNA-mediated
activation of NF-B and MAPKs has been demonstrated to be required
for all downstream events induced by CpG DNA (17, 18, 19, 20, 21, 22, 23, 24).
CpG DNA rapidly activates B cells to proliferate; to produce TNF-,
IL-6, IL-10, and Ig; and to express increased levels of costimulatory
molecules (12, 25, 26, 27). CpG DNA also synergizes with B
cell receptor-mediated signals, amplifying Ag-specific responses,
including TNF-, IL-6, IL-10, and Ig production and B cell
proliferation, indicating its function as a costimulatory factor in the
presence of specific Ag (12, 27) (Yi et al., unpublished
data). In addition, CpG DNA rescues mature spleen B cells from
spontaneous apoptosis, and WEHI-231 cells and primary immature B cells
from Ag receptor-mediated apoptosis (21, 22, 28, 29). In
addition to its profound effects on B cells, CpG DNA directly activates
dendritic cells and macrophages/monocytes to secrete cytokines and
chemokines, including TNF-, IFN-/
, IL-6, IL-10, IL-12,
macrophage-inflammatory protein 1a, macrophage-inflammatory protein 1b,
IFN-
-inducible protein-10, and RANTES; to express increased levels
of costimulatory molecules; and to increase Ab-dependent cellular
cytotoxicity activity, Ag presentation, and cross priming (17, 30, 31, 32, 33). Cytokines secreted by monocytic cells act in concert
with CpG DNA on NK cells to express IFN- and to increase NK cell
lytic activity (30, 34, 35). Overall, CpG DNA induces a
Th1-like pattern of cytokine production dominated by IL-12 and
IFN-.
In contrast to the ability of CpG DNA to induce strong innate immune
responses, recent studies have shown that macrophages previously
exposed to CpG DNA produce reduced levels of TNF- and NO when
subsequently stimulated with LPS or costimulated with LPS and CpG DNA
(36, 37, 38). These studies suggest that CpG DNA may have the
ability to induce macrophage refractory to subsequent stimulation with
LPS or other bacterial products. However, it has not been known whether
CpG DNA induces similar hyporesponsiveness in macrophages to subsequent
challenge with CpG DNA. In the present study, we demonstrate that CpG
DNA induces hyporesponsiveness in a murine macrophage cell line
RAW264.7 in response to the subsequent challenge with CpG DNA or LPS.
Phosphorylation of MAPK, CREB, and STAT1; activation of AP-1 and
NF-B; degradation of I-B; and expression of cytokines in response
to CpG DNA or LPS are substantially suppressed in the RAW264.7 cells
pre-exposed to CpG DNA. In addition, our results suggest that CpG DNA
may induce a state of macrophage hyporesponsiveness, at least in part,
through a dysregulation of IRAK.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Nuclease-resistant phosphorothioate oligodeoxynucleotides were purchased from Operon (Alameda, CA) and had no detectable endotoxins by Limulus assay. The sequences of phosphorothioate oligodeoxynucleotides used are 5'-TCCATGACGTTCCTGACGTT-3' (CpG DNA: ODN1826) and 5'-TCCAGGACTTCTCTCAGGTT-3' (non-CpG DNA: ODN1982).
Cell lines, culture conditions, and reagents
RAW264.7 cells (American Type Culture Collection, Manassas, VA) were cultured at 37°C in a 5% CO2 humidified incubator and maintained in DMEM supplemented with 10% (v/v) heat-inactivated FCS, 1.5 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. All culture reagents were purchased from Life Technologies (Gaithersburg, MD). LPS (Salmonella minnesota Re 595) was purchased from Sigma-Aldrich (St. Louis, MO). Purity of LPS was confirmed by lacking of its ability to induce IL-6 production in macrophages isolated from LPS-nonresponder C3H/HeJ mice.
Pretreatment of cells
RAW264.7 cells (1 x 106 cells/ml) were pretreated with medium, LPS (10 ng/ml), CpG DNA (0.06–3 µg/ml), or non-CpG DNA (0.06–3 µg/ml) for designated time periods. After pretreatment, cells were washed three times with PBS, resuspended in medium, rested for 1 h, and then stimulated with medium, LPS, CpG DNA, or non-CpG DNA, as indicated for each specific experiment described below.
Cytokine-specific ELISA
The pretreated cells (5 x 105
cells/ml for TNF-, and 1 x 106 cells/ml
for IL-6, IL-10, and IL-12) were stimulated with medium, LPS (50
ng/ml), CpG DNA (3 µg/ml), or non-CpG DNA (3 µg/ml) for 6 h
(for TNF-) or 24 h (for IL-6, IL-10, and IL-12). Culture
supernatants were analyzed by ELISA for TNF-, IL-6, IL-10, or
IL-12p40, as described previously (26). All recombinant
murine cytokines and Abs specific for murine cytokines were purchased
from BD PharMingen (San Diego, CA).
Preparation of RNA and real-time PCR
The pretreated cells (2 x 106 cells/ml) were stimulated with medium, LPS (50 ng/ml), CpG DNA (3 µg/ml), or non-CpG DNA (3 µg/ml) for 4 h. Cells were harvested and total RNA was isolated by using the RNeasy Mini Kit (Qiagen, Valencia, CA), following the manufacturer’s protocol. To measure the relative amount of selected gene transcripts, amplification of sample cDNA was monitored with the fluorescent DNA-binding dye SYBR Green in combination with the ABI 7900 sequence detection system (PE Applied Biosystems, Foster City, CA), according to the manufacturer’s instructions. Forward and reverse primers were designed using primerExpress software (PE Applied Biosystems) and listed in Table I. All PCR primers were purchased from Integrated DNA Technologies (Coralville, IA).
|
The pretreated cells (2 x 106
cells/ml) were stimulated with medium, LPS (50 ng/ml), CpG DNA (3
µg/ml), or non-CpG DNA (3 µg/ml) for 1 h. Cells were harvested
and then cytoplasmic extracts and nuclear extracts were prepared, as
previously described (17). To detect DNA-binding activity
of the transcription factor AP-1 or NF-B, nuclear extracts (3
µg/lane) were analyzed by EMSA, as previously described
(17), using 32P-labeled
double-stranded oligodeoxynucleotides containing the AP1
(GATCTAGTGATGAGTCAGCCGGATC) (39)- or NF-B
(GTAGGGGACTTTCCGAGCTCGAGATCCTATG) (40)-binding
sequence as a probe. Cytoplasmic extracts were used to detect presence
of I-B and I-B by Western blot analysis described
below.
Preparation of whole cell lysates and Western blot analysis
The pretreated cells (2 x 106
cells/ml) were stimulated with medium, LPS (50 ng/ml), CpG DNA (3
µg/ml), or non-CpG DNA (3 µg/ml) for designated time periods. In
some experiments, RAW264.7 cells were stimulated with medium, LPS, CpG
DNA, or non-CpG DNA for 24 h without pretreatment. Whole cell
lysates were prepared, as previously described (17, 19).
To detect presence of a specific protein or phosphorylation status of a
specific protein, equal amounts (15 µg/lane) of whole cell lysates or
cytoplasmic extracts were subjected to electrophoresis on a 10%
polyacrylamide gel containing 0.1% SDS, and then Western blots were
performed, as previously described (19). Actin was used as
a loading control. Specific Abs against I-B, I-B, p38,
MyD88, TLR4, TRAF6, or actin were purchased from Santa Cruz
Biotechnology (Santa Cruz, CA). Specific Abs against the phosphorylated
form of CREB, extracellular signal-regulated kinase (ERK), JNK, or p38
were purchased from New England Biolabs (Beverly, MA). Anti-IRAK
and specific Abs against the phosphorylated forms of STAT1 were
purchased from Upstate Biotechnology (Lake Placid, NY). Anti-TLR9 was
purchased from BIOCARTA (San Diego, CA).
Surface and intracellular staining and flow cytometric analysis
RAW264.7 cells (1 x 106 cells/ml) were stimulated with medium, LPS (20 ng/ml), CpG DNA (1.2 µg/ml), or non-CpG DNA (1.2 µg/ml) for 4, 8, or 24 h. Cells were harvested. To detect TLR4/MD2 or TLR9 levels on the cell surface, cells were stained with PE-conjugated anti-mouse TLR4/MD2 (eBioscience, San Diego, CA) or anti-TLR9 (BIOCARTA), followed by staining with FITC-conjugated anti-mouse IgG1 (BD PharMingen). For intracellular staining, cells were incubated in Cytofix/Cytoperm reagent (BD PharMingen) for 15 min at room temperature and then stained with PE-conjugated anti-mouse TLR4/MD2 or anti-TLR9, followed by staining with FITC-conjugated anti-mouse IgG1. Stained cells were analyzed on an EPICS XL-MCL using EXPO32 ADC software (Coulter, Miami, FL).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Using a murine macrophage-like cell line, RAW264.7, we
investigated whether pre-exposure to CpG DNA would induce
hyporesponsiveness in macrophages in response to subsequent CpG DNA
challenge. As shown in Fig. 1A, CpG DNA pretreatment of
RAW264.7 cells for 24 h resulted in a substantial decrease in
TNF- production in response to CpG DNA stimulation. This inhibitory
effect induced by CpG DNA pretreatment was dependent on the dose of CpG
DNA used for the pretreatment. RAW264.7 cells pretreated with CpG DNA
for 8 h also showed reduced levels of TNF- production after
subsequent CpG DNA challenge (data not shown). In addition, cells
pretreated with CpG DNA for 4–8 h and then incubated for 20 h in
the absence of CpG DNA still showed a similar degree of suppressed
TNF- production in response to CpG DNA stimulation (data not shown).
Comparatively, cells pre-exposed to control non-CpG DNA showed normal
levels of TNF- production in response to CpG DNA stimulation (Fig. 1A). We next analyzed whether CpG DNA pretreatment causes
similar hyporesponsiveness of RAW264.7 cells in regard to the
production of other cytokines in response to subsequent CpG DNA
challenge. Similar to the TNF- production, RAW264.7 cells pretreated
with CpG DNA showed dramatically suppressed production of IL-6, IL-10,
and IL-12 in response to CpG DNA stimulation (Fig. 1, B–D).
In contrast, cells pre-exposed to medium alone or control non-CpG DNA
showed little or no suppression in the production of these cytokines in
response to the subsequent CpG DNA challenge (Fig. 1).
|
, IL-6, and IL-10 mRNA expression. However, levels of
TNF-, IL-6, IL-10, and IL-12p40 mRNA expression induced by
subsequent CpG DNA challenge were greatly reduced, if not abolished, in
the cells pre-exposed to CpG DNA, but not in the cells pre-exposed to
medium or control non-CpG DNA (Fig. 2).
These results indicate that, like LPS and LTA, CpG DNA induces
refractory of macrophages to subsequent CpG DNA challenge.
|
We further investigated whether macrophages pre-exposed to CpG DNA
show hyporesponsiveness to subsequent LPS stimulation by examining the
level of cytokine production. As shown in Fig. 3, pre-exposure of RAW264.7 cells to CpG
DNA for 24 h resulted in suppressed release of TNF- and IL-6 in
response to LPS stimulation. Surprisingly, IL-10 production induced by
LPS was substantially increased in the cells pre-exposed to CpG DNA
(Fig. 3C). LPS did not induce IL-12 production in RAW264.7
cells and CpG DNA pretreatment did not alter IL-12 production in
response to the subsequent LPS challenge (data not shown). These
inhibitory or enhancing effects of the CpG DNA pretreatment on
LPS-induced cytokine production were dependent on the dose of CpG DNA
used for the pretreatment (Fig. 3). In contrast, control non-CpG DNA
pretreatment resulted in little or no alteration in the cytokine
production induced by LPS in RAW264.7 cells (Fig. 3).
|
, IL-10, and IL-12 production was
greatly suppressed in the RAW264.7 cells previously exposed to LPS
(Fig. 4). Interestingly, LPS pretreatment
substantially potentiated IL-6 production induced by CpG DNA (Fig. 4B). Taken together, these results suggest that pretreatment
with CpG DNA or LPS has differential effects on the different cytokines
produced in RAW264.7 cells in response to subsequent LPS or CpG DNA
challenge, and that the CpG DNA- or LPS-induced hyporesponsiveness of
RAW264.7 cells may not be due to exhaustion of the cells, but is rather
the result of a complicated reprogramming of the cells.
|
It has previously been demonstrated that CpG DNA induces
activation of transcription factors AP-1, CREB, NF-B, and STAT1, and
that these transcription factors play a critical role in CpG
DNA-mediated cytokine production (17, 19, 20, 24).
Therefore, we investigated whether CpG DNA-mediated activation of one
or more of these transcription factors is altered in the RAW264.7 cells
pre-exposed to CpG DNA. As demonstrated in Fig. 5A, CpG DNA and LPS strongly
induced activation of both NF-B and AP-1 in RAW264.7 cells. In
contrast, both CpG DNA- and LPS-mediated activation of NF-B and AP-1
was substantially inhibited in the RAW264.7 cells previously exposed to
CpG DNA. Similarly, LPS pretreatment substantially suppressed the
activation of NF-B in response to subsequent CpG DNA or LPS
challenge. Interestingly, LPS-mediated AP-1 activation was abolished,
but CpG DNA-mediated AP-1 activation was only partially inhibited in
the RAW264.7 cells pre-exposed to LPS (Fig. 5A). Because
phosphorylation, ubiquitination, and proteosomal degradation of I-B
precede the nuclear translocation of NF-B (41), we
investigated whether CpG DNA-induced degradation of I-B and
I-B is also suppressed by pretreatment with CpG DNA. As expected,
CpG DNA- or LPS-mediated induction of I-B and I-B
degradation was substantially prevented by CpG DNA or LPS pretreatment
(Fig. 5B). As previously demonstrated (24),
both CpG DNA and LPS induced phosphorylation of STAT1 and CREB in
RAW274.7 cells (Fig. 5C). CpG DNA pretreatment abolished
STAT1 phosphorylation in RAW264.7 cells in response to CpG DNA or LPS
challenge. In addition, LPS pretreatment substantially inhibited the
CpG DNA- or LPS-mediated induction of STAT1 phosphorylation. CpG DNA-
and LPS-induced phosphorylation of CREB was also partially inhibited by
pretreatment of RAW264.7 cells with either CpG DNA or LPS. In contrast,
neither CpG DNA nor LPS pretreatment led to the inhibition of CREB
phosphorylation induced by PMA (Fig. 5C). Taken together,
these results indicate that both CpG DNA and LPS pretreatment greatly
attenuates activation of all the transcription factors we analyzed, but
the degree of suppression is different for each transcription factor
and is also dependent on the type of subsequent stimuli. These results
also suggest that CpG DNA or LPS pretreatment may, at least partially,
lead to the suppression of a step(s) in the signaling pathway that is
commonly shared by CpG DNA and LPS.
|
MAPKs play a critical role in the CpG DNA-mediated activation of transcription factor AP-1, CREB, and STAT1 (19, 23, 24). Because CpG DNA- or LPS-mediated activation of transcription factors was substantially altered in the RAW264.7 cells pre-exposed to CpG DNA or LPS, we further investigated whether CpG DNA or LPS pretreatment also influences the MAPK activation after subsequent CpG DNA or LPS stimulation. As shown in Fig. 6, CpG DNA failed to induce phosphorylation of JNK and ERK above background levels in the RAW264.7 cells pre-exposed to CpG DNA. However, CpG DNA still induced phosphorylation of p38 in the same cells. In contrast, LPS-mediated JNK activation was only partially inhibited in the RAW264.7 cells pretreated with CpG DNA. CpG DNA pretreatment also showed little or no effect on the LPS-induced phosphorylation of ERK or p38. In the RAW264.7 cells pre-exposed to LPS, activation of p38 and ERK induced by CpG DNA was substantially suppressed compared with those in cells pretreated with medium alone (Fig. 6). However, LPS pretreatment resulted in only partial inhibition of CpG DNA-induced JNK phosphorylation. In contrast, activation of all three MAPKs, JNK, ERK, and p38, induced by LPS was greatly inhibited in the RAW264.7 cells pre-exposed to LPS (Fig. 6). These results demonstrate that as for the cytokine production, CpG DNA pretreatment induces hyporesponsiveness to subsequent CpG DNA challenge for MAPK activation, but induces less suppressive effects on LPS-mediated MAPK activation. In contrast, LPS pretreatment induces hyporesponsiveness to both CpG DNA and LPS challenges with regard to MAPK activation in RAW264.7 cells. These results indicate that CpG DNA and LPS may have differential effects on the upstream signaling modulators in the MAPK activation pathways.
|
CpG DNA- or LPS-induced hyporesponsiveness of RAW264.7 cells could be due to alterations in the expression level or function of TLRs or signaling molecules in the TLR-mediated signaling pathway. Therefore, we investigated whether CpG DNA treatment can affect the expression of TLR4, TLR9, and/or TLR downstream signaling modulators. As shown in Fig. 7, expression of surface TLR4/MD2 was decreased within 8 h after stimulation with LPS or CpG DNA, but increased at later time periods (Fig. 7, Aa and Ba). In addition, CpG DNA or LPS stimulation led to decreased TLR4 mRNA expression within 8 h, but levels returned to normal by 24 h after stimulation (Fig. 7C). In contrast to the surface TLR4/MD2 expression and TLR4 mRNA expression, total TLR4/MD2 protein levels were slightly increased within 8 h after stimulation with CpG DNA or LPS (Fig. 7, Ab, Bb, and H). Additionally, MD2 mRNA levels were also slightly increased at 24 h after stimulation with CpG DNA or LPS (Fig. 7D). Unlike TLR4, levels of TLR9 on the cell surface were low compared with the levels of TLR9 in whole cells (Fig. 7, compare Ea and Fa with Eb and Fb), indicating that TLR9 may present in both cell membrane and intracellular organelles or cytoplasm. Interestingly, CpG DNA or LPS induced slight increases in the expression of TLR9 at both mRNA and protein levels (Fig. 7, E–H). These results indicate that macrophage hyporesponsiveness induced by CpG DNA may not be due to alterations in TLR4 or TLR9 expression.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
For a long time, hyporesponsiveness of monocytic cells after
sepsis has been known to be due to a unique function of LPS that
induces desensitization of macrophages to subsequent challenge with LPS
and other bacterial products (9, 10, 11). Therefore,
whether bacterial products other than LPS can induce macrophage
hyporesponsiveness has not been intensively studied. Our results
demonstrated that CpG DNA pretreatment, but not control non-CpG DNA
pretreatment, dramatically suppressed expression of several cytokines,
including TNF-, IL-6, IL-10, and IL-12, in RAW264.7 cells in
response to subsequent stimulation with CpG DNA (Figs. 1 and 2). In
addition, pretreatment with CpG DNA also partially inhibited TNF-
and IL-6 production in response to LPS (Fig. 3). Furthermore, recent
studies also showed that macrophages previously exposed to CpG DNA
produce reduced levels of TNF- and NO in response to subsequent
stimulation with LPS or costimulation with LPS and CpG DNA
(36, 37, 38). Similar to the ability of CpG DNA to induce
macrophage hyporesponsiveness to subsequent challenge with CpG DNA or
LPS, other PAMPs such as LPS and LTA have also been shown to induce a
refractory state of macrophages to subsequent stimulation with LPS,
LTA, or mycoplasmal lipopeptides (macrophage-activating lipopeptides 2
kDa) (9, 10, 11, 43, 44). Moreover, our results showed that
LPS pretreatment also suppressed the CpG DNA-mediated TNF-, IL-10,
and IL-12 production (Fig. 4). These observations indicate that the
ability to induce macrophage refractory may not be a unique property of
LPS, but rather a common characteristic of PAMPs, such as LTA and CpG
DNA. The abilities of CpG DNA, LPS, and LTA to induce macrophage
refractory might contribute to induction of the hypoinflammatory state
of neutrophils and monocytes/macrophages, described as immunological
paralysis, observed in patients who have survived acute septic shock
(6, 7, 8). Although it has some detrimental consequences,
this hyporesponsiveness of monocytic cells after sepsis may have
developed as a part of a host defense mechanism to minimize damage from
severe inflammatory reactions and to prevent chronic inflammatory
illness.
The hyporesponsiveness of macrophages induced by LPS or CpG DNA does
not reflect a global deactivation of macrophage function. Although the
LPS-induced production of several pro- and anti-inflammatory
cytokines (e.g., TNF-, IL-1, IL-6, IL-10, and IL-12) is suppressed
in the macrophages pre-exposed to LPS, expression of other modulators
(e.g., IL-1R antagonist, TNFRII, and NO) is not inhibited in the same
cells (10, 43, 45). In addition, LPS pretreatment enhanced
the CpG DNA-induced IL-6 production, while it suppressed the CpG
DNA-mediated production of TNF-, IL-10, and IL-12 (Fig. 4). CpG DNA
pretreatment also suppressed the LPS-induced TNF- and IL-6
production. However, the LPS-induced IL-10 production was dramatically
enhanced in the cells pre-exposed to CpG DNA (Fig. 3). These findings
indicate that hyporesponsiveness of macrophages induced by CpG DNA or
LPS is not simply due to the exhaustion of macrophages, but rather due
to a more complicated reprogramming of cells.
Inhibition of LPS signaling in macrophages pretreated with LPS
occurs very early in the signaling cascade, involving suppressed IRAK
activation, decreased membrane GTP-binding capacity and G protein
content, and altered expression of phospholipase C-1 and
phosphatidylinositol-3' kinase (46, 47, 48).
Endotoxin-tolerant cells also show suppressed activation of MAPKs and
I-B kinase, and decreased degradation of I-B and I-B in
response to LPS stimulation (49, 50, 51, 52, 53). In addition,
endotoxin-tolerant macrophages have been found to express decreased
levels of Jun B and suppressed transcriptional activation of AP-1 and
NF-B after LPS stimulation (49, 54). Our results also
demonstrated that LPS pretreatment partially inhibited LPS-induced
STAT1 and CREB activation (Fig. 5C). Furthermore, LPS
pretreatment prevented degradation of I-B and I-B and
greatly suppressed activation of transcription factors, including
NF-B, AP-1, CREB, and STAT1, in response to subsequent CpG DNA
challenge (Fig. 5). Of note, it has been previously demonstrated that
macrophages pre-exposed to LPS show reduced activation of NF-B in
response to LTA or macrophage-activating lipopeptides 2 kDa (11, 44). Similarly, CpG DNA- or LPS-mediated activation of NF-B,
AP-1, and STAT1 was almost completely abolished in the RAW264.7 cells
pretreated with CpG DNA (Fig. 5). In addition, CpG DNA failed to induce
phosphorylation of JNK and ERK above the background levels in the
RAW264.7 cells pre-exposed to CpG DNA (Fig. 6). However, activation of
CREB in response to CpG DNA or LPS in the same cells was only partially
suppressed (Fig. 5C). Moreover, CpG DNA- or LPS-mediated p38
activation was only minimally affected by CpG DNA pretreatment (Fig. 6). Of interest, we have previously demonstrated that CpG DNA activates
CREB through a p38-dependent manner (24). These results
indicate that both CpG DNA and LPS pretreatment greatly attenuate
activation of all transcription factors and MAPKs we analyzed; however,
the degree of suppression is different for each transcription factor
and MAPK, and it is also dependent on the type of second stimuli. These
results also suggest that inhibited expression of cytokines seen in the
CpG DNA-pretreated RAW264.7 cells in response to CpG DNA or LPS
stimulation is likely to result from decreased activation of the
transcription factors and MAPKs that are pivotal in governing
expression of a variety of cytokine genes, and that pretreatment with
CpG DNA or LPS may, at least partially, lead to the suppression of a
step(s) in the signaling pathway that is commonly shared by CpG DNA
and LPS.
Molecular mechanisms of the bacterial products-mediated induction of macrophage hyporesponsiveness are not completely understood at the present time. CpG DNA- or LPS-induced macrophage hyporesponsiveness could be due to alterations in the expression or function of TLR or signaling molecules in the TLR-mediated signaling pathway. LPS-induced macrophage hyporesponsiveness is not accompanied by decreased expression of CD14 (55, 56). In addition, controversy exists regarding the involvement of TLR4 expression in the induction of tolerance to LPS (44, 57, 58). Similar to the observation by Nomura et al. (57), both mRNA and surface protein expressions of TLR4 are decreased within 8 h after stimulation with either LPS or CpG DNA in RAW264.7 cells (Fig. 7, A–C). However, the levels of both TLR4 mRNA and protein returned to normal by 24 h after stimulation, the actual time of the second challenge. In addition, both CpG DNA and LPS induced slight increases in the expression of TLR9 at both mRNA and protein levels (Fig. 7, E–H). Furthermore, pretreatment of RAW264.7 cells with either CpG DNA or LPS for >4 h induced the hyporesponsiveness of these cells to subsequent challenge with LPS (data not shown). Taken together, our results suggest that the CpG DNA- and LPS-induced hyporesponsiveness of RAW264.7 cells to LPS or CpG DNA may not likely be due to alterations in the TLR4 or TLR9 expression.
After recognition of PAMPs, TLRs recruit MyD88, TIRAP, Tollip and IRAK
complex, and TRAF6, signaling modulators that play a critical role in
the macrophage activation by LPS or CpG DNA (reviewed in Refs
1 and 42). Because CpG DNA and LPS induce
cross-tolerance as well as self-tolerance, it is likely that prolonged
treatment of CpG DNA or LPS might induce alterations in the function
and/or expression of one or more of these downstream signaling
modulators commonly shared by TLR4- and TLR9-signaling pathways. It has
been demonstrated that expression of MyD88 and IRAK is normal in
endotoxin-tolerant peritoneal macrophages (44, 58). Our
results also demonstrated that neither CpG DNA nor LPS inhibits MyD88
expression at both mRNA and protein levels (Fig. 8, A and
C). In addition, either CpG DNA or LPS stimulation shows
little or no effects on the expression of Tollip and TRAF6 (Fig. 8, A and C). However, stimulation of RAW264.7 cells
with either CpG DNA or LPS resulted in the disappearance of IRAK within
1 h (data not shown), which might be due to multiphosphorylation,
ubiquitination, and proteosomal degradation of IRAK following
activation (59). Furthermore, both CpG DNA and LPS induced
suppression of IRAK expression at both mRNA and protein levels in
RAW264.7 cells (Fig. 8, B and C). Of interest,
previous studies revealed that LPS pretreatment leads to the inhibition
of IRAK enzyme activity (48, 57). In addition,
IRAK-deficient mice or macrophages show impaired cytokine production
and septic shock in response to LPS (60, 61, 62). Of note,
during the preparation of this manuscript, Li and colleagues
(63) reported that LPS, but not LTA, induces degradation
and down-regulation of IRAK in THP-1 cells. Furthermore, Adib-Conquy
and Cavaillon (64) found that IRAK expression and kinase
activity are inhibited in the endotoxin-tolerant human monocytes, and
IFN- and GM-CSF prevent endotoxin tolerance by inhibiting IRAK
degradation and by promoting IRAK expression and its association with
MyD88. Collectively, these observations indicate that the CpG
DNA-induced inhibition of IRAK expression may be one of the factors
that contribute to the hyporesponsiveness of RAW264.7 cells to
subsequent challenge with CpG DNA or LPS.
In summary, the present study demonstrates that prolonged treatment with CpG DNA leads to the hyporesponsiveness of macrophages to CpG DNA and LPS. This CpG DNA-mediated refractory of macrophages may, at least partially, be due to dysregulation of IRAK expression.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Ae-Kyung Yi, Department of Pediatrics, University of Tennessee Health Science Center, 50 North Dunlap Street, Room 315, Memphis, TN 38103. E-mail address: ayi{at}utmem.edu
3 Abbreviations used in this paper: PAMP, pathogen-associated molecular pattern; ERK, extracellular signal-regulated kinase; IRAK, IL-1R-associated kinase; JNK, c-Jun NH2-terminal kinase; LTA, lipoteichoic acid; MAPK, mitogen-activated protein kinase; MyD88, myeloid differentiation factor 88; TIRAP, Toll/IL-1R domain-containing adaptor protein; TLR, Toll-like receptor; TRAF6, TNF- receptor-associated factor 6.
Received for publication July 15, 2002. Accepted for publication November 12, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
treatment. Nat. Med. 3:678.[Medline]
B and IB and sustained activation of nuclear factor-B/c-Rel. J. Immunol. 160:1240.B and preventing mitochondrial membrane potential disruption via a chloroquine sensitive pathway. Int. Immunol. 11:2015.. Proc. Natl. Acad. Sci. USA 93:2879. promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J. Immunol. 156:558.[Abstract]
in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
production in vitro. J. Immunol. 163:3642. response to subsequent lipopolysaccharide challenge. Infect. Immun. 69:2123. through a post-transcriptional mechanism. J. Immunol. 166:6855.B and AP-1 activity in mouse T cell blasts. J. Biol. Chem. 274:14400. is constitutively bound to the NF-B site of the interleukin-6 promoter and acts as a negative regulatory factor. Mol. Cell. Biol. 17:3733.[Abstract]
B and Rel proteins: evolutionary conserved mediators of immune responses. Annu. Rev. Immunol. 66:225.
1 and phosphatidylinositol-3'-kinase expression in peritoneal macrophages. J. Surg. Res. 58:592.[Medline]
B cascades, but not lipopolysaccharide-incorporation steps. Biochim. Biophys. Acta 1450:130.[Medline]
B kinase in endotoxin tolerance. Biochem. Biophys. Res. Commun. 232:602.[Medline]
mRNA expression in LPS-primed macrophages occurs at the level of nuclear factor-B activation, but not at the level of protein kinase C or CD14 expression. J. Immunol. 154:4803.[Abstract]
Interferon and granulocyte/monocyte colony-stimulating factor prevent endotoxin tolerance in human monocytes by promoting interleukin-1 receptor-associated kinase expression and its association to MyD88, and not by modulating TLR4 expression. J. Biol. Chem. 277:27927.This article has been cited by other articles:
|
|
 |
|
  A. F. de Vos, J. M. Pater, P. S. van den Pangaart, M. D. de Kruif, C. van 't Veer, and T. van der Poll In Vivo Lipopolysaccharide Exposure of Human Blood Leukocytes Induces Cross-Tolerance to Multiple TLR Ligands J. Immunol., July 1, 2009; 183(1): 533 - 542. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-E. Park, Y.-I. Kim, and A.-K. Yi Protein Kinase D1: A New Component in TLR9 Signaling J. Immunol., August 1, 2008; 181(3): 2044 - 2055. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-I. Kim, J.-E. Park, A. Martinez-Hernandez, and A.-K. Yi CpG DNA Prevents Liver Injury and Shock-mediated Death by Modulating Expression of Interleukin-1 Receptor-associated Kinases J. Biol. Chem., May 30, 2008; 283(22): 15258 - 15270. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Knuefermann, M. Schwederski, M. Velten, P. Krings, H. Ehrentraut, M. Rudiger, O. Boehm, K. Fink, U. Dreiner, C. Grohe, et al. Bacterial DNA induces myocardial inflammation and reduces cardiomyocyte contractility: role of Toll-like receptor 9 Cardiovasc Res, April 1, 2008; 78(1): 26 - 35. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Kumar, L. D. Hazlett, and F.-S. X. Yu Flagellin Suppresses the Inflammatory Response and Enhances Bacterial Clearance in a Murine Model of Pseudomonas aeruginosa Keratitis Infect. Immun., January 1, 2008; 76(1): 89 - 96. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Kumar, J. Yin, J. Zhang, and F.-S. X. Yu Modulation of Corneal Epithelial Innate Immune Response to Pseudomonas Infection by Flagellin Pretreatment Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4664 - 4670. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Kittan, A. Bergua, S. Haupt, N. Donhauser, P. Schuster, K. Korn, T. Harrer, and B. Schmidt Impaired Plasmacytoid Dendritic Cell Innate Immune Responses in Patients with Herpes Virus-Associated Acute Retinal Necrosis J. Immunol., September 15, 2007; 179(6): 4219 - 4230. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Medvedev, I. Sabroe, J. D. Hasday, and S. N. Vogel Invited review: Tolerance to microbial TLR ligands: molecular mechanisms and relevance to disease Innate Immunity, June 1, 2006; 12(3): 133 - 150. [Abstract] [PDF]
|
|
|
|
 |
|
 C. H. Li, J. H. Wang, and H. P. Redmond Bacterial lipoprotein-induced self-tolerance and cross-tolerance to LPS are associated with reduced IRAK-1 expression and MyD88-IRAK complex formation J. Leukoc. Biol., April 1, 2006; 79(4): 867 - 875. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Zhou, S.-X. Zheng, W. Tang, P.-L. He, X.-Y. Li, Y.-F. Yang, Y.-C. Li, J.-G. Geng, and J.-P. Zuo Inhibition of Inducible Nitric-Oxide Synthase Expression by (5R)-5-Hydroxytriptolide in Interferon-{gamma}- and Bacterial Lipopolysaccharide-Stimulated Macrophages J. Pharmacol. Exp. Ther., January 1, 2006; 316(1): 121 - 128. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Jozefowski, M. Arredouani, T. Sulahian, and L. Kobzik Disparate Regulation and Function of the Class A Scavenger Receptors SR-AI/II and MARCO J. Immunol., December 15, 2005; 175(12): 8032 - 8041. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Jiang, R. Sun, H. Wei, and Z. Tian Toll-like receptor 3 ligand attenuates LPS-induced liver injury by down-regulation of toll-like receptor 4 expression on macrophages PNAS, November 22, 2005; 102(47): 17077 - 17082. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. V. Pedchenko, G. Y. Park, M. Joo, T. S. Blackwell, and J. W. Christman Inducible binding of PU.1 and interacting proteins to the Toll-like receptor 4 promoter during endotoxemia Am J Physiol Lung Cell Mol Physiol, September 1, 2005; 289(3): L429 - L437. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Rao, S. Nguyen, K. Ngo, and W.-P. Fung-Leung A Novel Splice Variant of Interleukin-1 Receptor (IL-1R)-Associated Kinase 1 Plays a Negative Regulatory Role in Toll/IL-1R-Induced Inflammatory Signaling Mol. Cell. Biol., August 1, 2005; 25(15): 6521 - 6532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Perry, C. S. Olver, R. C. Burnett, and A. C. Avery Cutting Edge: The Acquisition of TLR Tolerance during Malaria Infection Impacts T Cell Activation J. Immunol., May 15, 2005; 174(10): 5921 - 5925. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. S. Goodridge, F. A. Marshall, K. J. Else, K. M. Houston, C. Egan, L. Al-Riyami, F.-Y. Liew, W. Harnett, and M. M. Harnett Immunomodulation via Novel Use of TLR4 by the Filarial Nematode Phosphorylcholine-Containing Secreted Product, ES-62 J. Immunol., January 1, 2005; 174(1): 284 - 293. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Yang, F. M. Murillo, H. Cui, R. Blosser, S. Uematsu, K. Takeda, S. Akira, R. P. Viscidi, and R. B. S. Roden Papillomavirus-Like Particles Stimulate Murine Bone Marrow-Derived Dendritic Cells To Produce Alpha Interferon and Th1 Immune Responses via MyD88 J. Virol., October 15, 2004; 78(20): 11152 - 11160. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Hatao, M. Muroi, N. Hiki, T. Ogawa, Y. Mimura, M. Kaminishi, and K.-i. Tanamoto Prolonged Toll-like receptor stimulation leads to down-regulation of IRAK-4 protein J. Leukoc. Biol., October 1, 2004; 76(4): 904 - 908. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Siedlar, M. Frankenberger, E. Benkhart, T. Espevik, M. Quirling, K. Brand, M. Zembala, and L. Ziegler-Heitbrock Tolerance Induced by the Lipopeptide Pam3Cys Is Due to Ablation of IL-1R-Associated Kinase-1 J. Immunol., August 15, 2004; 173(4): 2736 - 2745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wongratanacheewin, W. Kespichayawattana, P. Intachote, S. Pichyangkul, R. W. Sermswan, A. M. Krieg, and S. Sirisinha Immunostimulatory CpG Oligodeoxynucleotide Confers Protection in a Murine Model of Infection with Burkholderia pseudomallei Infect. Immun., August 1, 2004; 72(8): 4494 - 4502. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bafica, C. A. Scanga, M. Schito, D. Chaussabel, and A. Sher Influence of Coinfecting Pathogens on HIV Expression: Evidence for a Role of Toll-Like Receptors J. Immunol., June 15, 2004; 172(12): 7229 - 7234. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. McCoy, S. E. Kurtz, F. A. Hausman, D. R. Trune, R. M. Bennett, and S. H. Hefeneider Activation of RAW264.7 Macrophages by Bacterial DNA and Lipopolysaccharide Increases Cell Surface DNA Binding and Internalization J. Biol. Chem., April 23, 2004; 279(17): 17217 - 17223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Stovall, A.-K. Yi, E. A. Meals, A. J. Talati, S. A. Godambe, and B. K. English Role of vav1- and src-related Tyrosine Kinases in Macrophage Activation by CpG DNA J. Biol. Chem., April 2, 2004; 279(14): 13809 - 13816. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Hongkuan Fan and J. A. Cook Review: Molecular mechanisms of endotoxin tolerance Innate Immunity, April 1, 2004; 10(2): 71 - 84. [Abstract] [PDF]
|
|
|
|
|
|
K. S. Kobayashi and R. A. Flavell Shielding the double-edged sword: negative regulation of the innate immune system J. Leukoc. Biol., March 1, 2004; 75(3): 428 - 433. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bafica, C. A. Scanga, O. Equils, and A. Sher The induction of Toll-like receptor tolerance enhances rather than suppresses HIV-1 gene expression in transgenic mice J. Leukoc. Biol., March 1, 2004; 75(3): 460 - 466. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Haase, C. J. Kirschning, A. Sing, P. Schrottner, K. Fukase, S. Kusumoto, H. Wagner, J. Heesemann, and K. Ruckdeschel A Dominant Role of Toll-Like Receptor 4 in the Signaling of Apoptosis in Bacteria-Faced Macrophages J. Immunol., October 15, 2003; 171(8): 4294 - 4303. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), CpG DNA (0.6 µg/ml, 
), or LPS
(10 ng/ml, x) for indicated time periods. Total RNA was isolated, and
the presence of mRNA for GAPDH and TLR4 (C) or TLR9
(G) in each sample was detected by real-time PCR using
SYBR Green. GAPDH was used for endogenous control. Data represent the
mean (% of unstimulated control) ± SD of triplicates.
D, RAW264.7 cells were stimulated with medium, CpG DNA
(0.6 µg/ml), or LPS (10 ng/ml) for 24 h. Total RNA was isolated,
and the presence of mRNA for GAPDH and MD2 in each sample was detected
by real-time PCR using SYBR Green. GAPDH was used for endogenous
control. Data represent the mean (% of unstimulated control) ±
SD of triplicates. H, RAW264.7 cells were stimulated
with medium, LPS (10 ng/ml), CpG DNA (0.6 µg/ml), or non-CpG DNA (0.6
µg/ml) for 24 h. The levels of TLR9, TLR4, or actin in whole
cell lysates (60 µg/lane) were analyzed by Western blot using an Ab
specific for TLR9, TLR4, or actin. Actin was used as loading control.
The experiments were done three times with similar results.