The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Novellino, L.
Right arrow Articles by Castelli, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Novellino, L.
Right arrow Articles by Castelli, C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
Medline Plus Health Information
*Melanoma
The Journal of Immunology, 2003, 170: 6363-6370.
Copyright © 2003 by The American Association of Immunologists

Identification of a Mutated Receptor-Like Protein Tyrosine Phosphatase {kappa} as a Novel, Class II HLA-Restricted Melanoma Antigen1

Luisa Novellino2,*, Nicolina Renkvist2,3,*, Francesca Rini*, Arabella Mazzocchi*, Licia Rivoltini*, Angela Greco{dagger}, Paola Deho*, Paola Squarcina*, Paul F. Robbins{ddagger}, Giorgio Parmiani* and Chiara Castelli4,*

* Unit of Immunotherapy of Human Tumors and {dagger} Unit of Molecular Mechanisms of Tumor Growth and Progression, Istituto Nazionale per lo Studio e la Cura dei Tumori, Milan, Italy; and {ddagger} Surgery Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recent studies increasingly point to a pivotal role of CD4+ T cells in human anti-tumor immune response. Here we show that lymphocytes purified from a tumor-infiltrated lymph node of a melanoma patient that had remained disease free for 10 years after surgical resection of a lymph node metastasis comprised oligoclonal class II HLA-restricted CD4+ T cells recognizing the autologous tumor cells in vitro. In fact, the CD4+ T cell clones isolated from these lymphocytes displayed a tumor-specific, cytotoxic activity in addition to a Th1-like cytokine profile. By a genetic approach, a peptide derived from a mutated receptor-like protein tyrosine phosphatase {kappa} was identified as a novel HLA-DR10-restricted epitope for all the melanoma-specific CD4+ T cell clones. The immunogenic peptide was shown to contain the mutated residue that was crucial for T cell recognition and activation. Moreover, a systemic immunity against the mutated peptide was detectable in the patient’s peripheral blood T lymphocytes obtained during the disease-free period of follow-up. These findings further support the relevance of CD4+ T cells directed against mutated epitopes in tumor immunity and provide the rationale for a possible usage of mutated, tumor-specific Ags for immunotherapy of human cancer.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The identification of tumor Ags has provided immunologists with new tools for an immune intervention in cancer patients. Although peptide-based vaccination still represents a promising approach for tumor therapy, clinical responses were only observed in 10–30% of treated patients (1). Reasons for this partial failure lie in all possible mechanisms operated by tumor cells to evade immune recognition and destruction (2), as well as in the suboptimal T cell stimulation achieved by the peptides so far used in the clinical protocols. In fact, the majority of these peptide-based vaccines preferentially used epitopes potentially able to stimulate tumor-specific CD8+ cytotoxic T cells. Although activated CD8+ T lymphocytes in their final effector phase constitute an essential arm of the immune system for controlling either tumor growth or viral infection, the crucial role of CD4+ T cells in orchestrating an efficient immune response cannot be ignored. In fact, stimulation of CD4+ T cells was found to be crucial for both viral clearance and successful tumor eradication in mice (3, 4, 5, 6). Moreover, vaccination with tumor-specific helper epitopes was indeed critical in inducing tumor-protective immunity in mice (7, 8). CD4+ T cells have been shown to work at different levels in the anti-tumor immunity (9, 10). First, by interacting with cells presenting tumor Ags, CD4+ lymphocytes provide a specific help essential to induce and maintain a tumor-specific CTL response (9). Second, CD4+ T cells can actively participate in controlling tumor growth either by inducing apoptotic death of class II HLA-positive tumors or by recruiting other anti-tumor effector cells at tumor site (10).

Therefore, the characterization of novel MHC class II-restricted tumor-specific Ags appears of primary importance to provide new and more efficient peptide-based vaccines in cancer patients. However, the mechanisms of class II MHC Ag processing/presentation pathways appear rather complex and are not completely understood (11, 12). Technical difficulties have hampered the discovery of class II HLA-restricted tumor Ags, thus limiting the availability of known tumor-specific helper epitopes. For melanoma, only a few examples of T cell-defined class II HLA-restricted tumor Ags are now available (13, 14).

In this context, the CD4+ T cell-mediated anti-tumor response was analyzed in the long-surviving melanoma patient 15392, who remained tumor-free 10 years after surgical resection of a lymph node (LN)5 metastasis. By using CD4+ T lymphocyte clones generated from tumor-infiltrated LNs and by implementing a genetic approach specifically shaped for detecting MHC class II-restricted tumor Ags, we identified a mutated form of the receptor-like protein tyrosine phosphatase {kappa} (Human Genome Mapping Workshop-approved symbol PTPRK) as a novel, immunogenic melanoma-specific Ag.

Moreover, systemic immunity directed against the HLA-DR10-restricted epitope derived from the mutated PTPRK was developed and maintained in this patient during the disease-free period of follow-up, thus supporting the hypothesis that CD4+ T cells directed against a mutated melanoma Ag contributed to an immune-mediated control of tumor growth in vivo.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines

The clinical course of patient 15392 (typed as HLA-A*0301, B*40012, B*1402, C*0602, C*8002, DRB1*0102, DRB1*1001) and the in vitro stabilization of the melanoma cell line Me15392 have already been described (15). By flow cytometry analysis, Me15392 cells were shown to be positive for class I HLA and to constitutively express HLA-DR and DP, but not DQ. Lymphoblastoid EBV-transformed B cell line (LCL) 15392 and LCL3700 are EBV-trasformed B cell lines obtained from PBMCs of patient 15392 and of a healthy donor, respectively. LCL3700 shares with patient 15392 the HLA-DRB1*1001 only. The 293-EBV-encoded nuclear Ag (EBNA) cells (wild-type 293 (wt293); Invitrogen, San Diego, CA) and class II transactivator+293-EBNA cells (CIITA+293) were maintained in DMEM (Euroclone, Devon, U.K.) with 10% FCS. CIITA+293 cells were obtained by transducing wt293 cells with CIITA-encoding retroviral vector. CIITA+293 cells were sorted by using L243, a mAb specific for HLA-DR alleles.

Generation of tumor-specific T cell clones

Tumor-associated T lymphocytes (TALs), collected from an LN metastatic lesion surgically removed from patient 15392 in 1991, were isolated by density-gradient centrifugation. T cells were stored in liquid nitrogen or stimulated twice in vitro with irradiated autologous tumor cells in RPMI 1640 medium supplemented with 300 IU/ml recombinant human IL-2 (EuroCetus, Amsterdam, The Netherlands) and 10% pooled human AB serum. After 3 wk of in vitro culture, T cells were cloned by limiting dilution and the clones were screened for growth at day 15. The specificity of the growing T cell clones was analyzed in a 51Cr-release assay; 140 independent clones displayed a TCR-mediated lytic activity against the autologous tumor. Forty clones displayed an HLA-DR-restricted recognition of the autologous tumor and were selected for further analysis. To confirm the clonality and to classify the clones with identical TCR specificity, the TCR repertoire of each clone was examined by RT-PCR, using a panel of TCR{alpha} variable (TCRAV)- and TCR{beta} variable (TCRBV)-specific primers as previously described (16).

Cytokine release and cytotoxic assays

Lymphocytes were seeded (5 x 103 in 50 µl) in 96-well U-bottom plates with 104/well melanoma cells or with 5 x 103 autologous LCL pulsed for 2 h at 37°C with different doses of peptides, in a final volume of 0.2 ml of RPMI 1640 supplemented with 10% pooled human serum. After overnight incubation at 37°C, supernatants were collected and cytokine content was evaluated by ELISA (Endogen, Woburn, MA). Sensitivity of target cells to lysis was evaluated by a standard 51Cr-release cytotoxic assay at different E:T ratios. 51Cr-release assay was performed as previously described (15).

HLA-DRB1*0102 and DRB1*1001 cloning

Complementary DNA clones encoding the HLA-DRB1*0102 and DRB1*1001 chains of patient 15392 were obtained by RT-PCR starting from poly(A)+ RNA prepared from LCL15392. Amplification was performed using primers specific for conserved 5' and 3' regions of HLA-DR{beta}1 chains (forward, 5'-CGCGGATCCAGCATGGTGTGTCTG-3'; reverse, 5'-GGAATTCCTCAGCTCAGGAATCCTGTT-3'), and the PCR products were cloned into pcDNA3.1/V5-His topoisomerase (TOPO) vector (Invitrogen).

Construction and screening of the tumor-derived cDNA library

Poly(A)+ RNA isolated from Me15392 cells using the FASTRACK kit (Invitrogen) was converted into cDNA with the Superscript Choice System (Life Technologies, Rockville, MD) using an oligo(dT) primer (5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3') containing an XbaI site (underlined). The cDNA was ligated to EcoRI-BstxI adaptors (Stratagene, La Jolla, CA), digested with XbaI, and inserted into the XbaI and BstxI sites of the polylinker located at the 3' end of the invariant chain (Ii) cDNA insert (amino acids 1–80), in the expression vector pEAK8.5-Ii, thus creating an Ii/tumor-derived fusion cDNA library. Escherichia coli DH5{alpha} cells were transformed by electroporation with the recombinant plasmids and were selected with ampicillin (0.1 g/L). The library was divided into 1400 pools of ~100 cDNA recombinant clones each. Pools were grown overnight in Luria-Bertani medium plus ampicillin (0.1 g/L), and plasmid DNA was extracted using the QIAprep 96 plasmid kit (Qiagen, Valencia, CA).

CIITA+293 cells seeded in flat-bottom, 96-microwell plates (5 x 104 cells/well) were cotransfected with 150 ng of one pool of the cDNA library and 150 ng of the plasmid containing either HLA-DRB1 or HLA-DRB10, using lipofectAMINE (Invitrogen). After 24 h, CD4+ T clone TB515 was added to each microculture at 1 x 104 cells/well. Twenty-four hours later, 100 µl of supernatant were collected, and IFN-{gamma} production was measured by ELISA.

Construction and sequencing of minigenes

Complementary DNA #11 sequencing was performed with primers mapping into the regions of the pEAK8.5/Ii vector flanking the insert (forward, 5'-ACCTCGATTAGTTCTCGAGCTT-3'; reverse, 5'-ATTAGGACAAGGCTGGTGGGCACT-3'). The missense point mutation (g->a) was confirmed by sequencing both DNA strands of amplified products from either reverse-transcribed Me15392 poly(A)+RNA (forward primer F2, 5'-GTGCTCCTATCAGTGCTTAT-3'; reverse primer R2, 5'-GCGTACGCACTGGGTTTT-3') or Me15392 genomic DNA (forward primer, 5'-CTGCACCCACACCGAACCAAGAGAGAA-3'; reverse primer, 5'-CGCCTGGAAATAGATGTTGTATCCTTT-3').

Complementary DNA #11 containing the wild-type nucleotide was prepared by RT-PCR using as template mRNA from LCL15392 with the following primers: forward primer F2 and reverse primer exon primer reverse (EPR)0 (5'-GCGACTGGACTCTGCTGTA-3').

Minigenes were prepared from cDNA #11 as PCR amplification products of different lengths. All the amplicons were obtained using the same sense primer F2 coupled with four different antisense primers: EPR1, 5'-CCGATTGTCACCCACAGTGAA-3'; EPR2, 5'-GGGCAGGCTCAGGTA-3'; EPR3, 5'-CTCGGGGGGAGTTCT-3'; and EPR2WT, 5'-GGGCAGGCTCAGGTAGGTTTCCCG-3'. The latter was used for the preparation of the EP2WT minigene containing the wild-type nucleotide (underlined in the EPR2WT primer). PCR products were cloned into pcDNA3.1/V5-His TOPO vector.

The Ii-EP2WT fusion minigene was obtained by excision of EP2WT minigene from TOPO vector with AscI and XbaI enzymes, followed by cloning the insert into the AscI and XbaI sites of pEAK8.5-Ii vector. This reaction gave rise to an in-frame fusion construct.

Northern blot analysis of PTPRK expression

Poly(A)+ RNAs from Me15392, allogenic melanoma lines, and PBMCs were isolated as described above. Total RNA was isolated by using the RNAqueous-4PCR kit (Ambion, Austin, TX). For Northern blot experiments, 10 µg of each RNA sample was subjected to electrophoresis in a 1% formaldehyde agarose gel and transferred to a nylon membrane (Hybond-N+; Amersham Biosciences, Piscataway, NJ). The probes were labeled with [{alpha}-32P]CTP by the random priming method (Amersham Biosciences), and prehybridization and hybridization were performed according to the Hybond-N+ guidelines. Membranes were washed four times with serially diluted solutions of SSC (from 0.03 M to 0.0015 M). Probes A and C were obtained by PCR amplification of Me15392 poly(A)+ RNA with specific primers. Probe A, specific for the 5' region of the gene (bases 241-1110 of the PTPRK gene; GenBank NM 002844), was synthesized with primers forward 5'-GGCGCTGCCTGCTTTTGT-3' and reverse 5'-GGAGGAGCAATGGGTCTT-3'. Probe C, specific for the region encoding the two intracellular phosphatase domains (bases 2925–4547 of the gene), was derived with primers forward 5'-CTTGGGATGTAGCTAAAAAAGATCAAAATA-3' and reverse 5'-CCAACTAAGATGATTCCAGGTACTCCAA-3'. All of the amplification products were sequenced before being used as probes. Complementary DNA clone #11 (bases 2084–2751 of the gene) was used as probe B.

DNA sequencing

DNA sequencing was performed using the Big Dye Terminator Cycle Sequencing Kit (PerkinElmer, Foster City, CA). Sequences were determined with an ABI Prism 310 genetic analyzer (PerkinElmer). Database searches for nucleotide and deduced amino acid sequence similarities were performed with the BLAST program (www.ncbi.nlm.nih.gov/BLAST/).

Peptides synthesis

Peptides were synthesized by conventional solid phase peptide synthesis, using the solid-phase method based on fluorenylmethoxycarbonyl for transient NH2-terminal protection and characterized by mass spectrometry. All of the peptides used were >95% pure (Neosystem, Strasbourg, France). Peptides were dissolved at 5 mg/ml in DMSO, stored at -20°C, and diluted in RPMI 1640 medium (BioWhittaker, Walkersville, MD) supplemented with 10% human serum immediately before use.

Epitope reconstitution assay

To analyze peptide recognition, 5 x 103 LCL15392 or LCL3700 cells were seeded in 96-microwell plates in 100 µl of RPMI 1640/10% pooled human serum and then were pulsed with different concentrations of the relevant peptide. Peptide loading was allowed to proceed for 2 h at 37°C before effector cells were added to give a final E:T ratio of 1:1. Supernatants were collected after 18 h, and IFN-{gamma} content was determined by ELISA (Mabtech, Stockholm, Sweden).

Generation of PTPRK-specific T cells from patient 15392 PBMCs

PBMCs of patient 15392 obtained at 70 mo after surgery, during the disease-free period of follow-up, were stimulated in vitro with PYYFAAELPPRNLPEP peptide as previously described (17). Briefly, PBMCs (2 x 106/well) were stimulated weekly with autologous peptide-pulsed monocytes. At the end of each stimulation, peptide-specific reactivity was monitored by Elispot assay.

IFN-{gamma}-Elispot assay

Ninety-six-well nitrocellulose plates (Millititer; Millipore, Bedford, MA) were coated overnight with 50 µl/well of 8 µg/ml anti-human IFN-{gamma} mAb (Mabtech). Wells were then washed and blocked with Iscove’s modified DMEM (BioWhittaker) and 10% pooled human AB serum for 2 h at 37°C. PBMCs or TALs (2 x 105 or 1 x 104 as indicated in each experiment) were mixed with 4x103 peptide-pulsed autologous LCL cells and then seeded in the 96 precoated wells. T cells incubated with medium alone or with pokeweed mitogen served as negative and positive controls, respectively. After 24 h of incubation at 37°C and 5% CO2, Elispot was then performed according to manufacturer’s instructions. Briefly, plates were washed six times with PBS + 0.05% Tween 20. Wells were incubated for 2 h at 37°C with 50 µl/well of biotinylated mouse anti-human IFN-{gamma} mAb (Mabtech) at a concentration of 2.5 µg/ml. After washing four times with PBS, 100 µl of streptavidin-alkaline phosphatase (150 µg/ml) diluted 1/1000 was added for 2 h at room temperature. After another washing step with PBS, 100 µl/well of 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium substrate (Bio-Rad, Hercules, CA) was added to each well for 10–20 min. Color development was stopped by washing under running tap water. After drying at room temperature, IFN-{gamma}-secreting T cells were counted using the automated image analysis system Elispot Reader (AID, Strassberg, Germany). Each experiment was performed in triplicate.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tumor-specific CD4+T cell clones

Forty tumor-specific CD4+ T cell clones (CD4+T15392) were obtained by limiting dilution of TALs isolated from an LN metastasis of patient 15392 and were stimulated in vitro with the autologous tumor for 2 wk. TCR analysis by RT-PCR revealed that all clones could be grouped into five different subsets according to the TCRAV and TCRBV combination (Table I). Functional studies were performed on a single T cell clone representative of each subset. All of the clones were found to display identical functional activity in response to tumor stimulation (Table I). Data reported in Fig. 1 were obtained with clone TB515 and are representative for all of the T cell clones tested. TB515, upon stimulation with the autologous melanoma, exerted an HLA-DR-restricted lytic activity against Me15392 cells because the lysis detected by a 51Cr-release assay was strongly inhibited in the presence of the mAb L243 directed against HLA-DR molecules (Fig. 1A). In addition, in response to tumor stimulation, TB515 also released a cytokine cocktail, including IFN-{gamma}, GM-CSF, TNF-{alpha}, and IL-2, but not IL-4 and TGF{beta} (data not shown), compatible with a Th1 profile (Fig. 1B).


View this table:
[in this window]
[in a new window]
 
Table I. Functional characterization and TCR expression of tumor-specific CD4+ T lymphocyte clones

 


View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 1. Functional characterization of anti-melanoma T lymphocyte clone TB515. A, Sensitivity of 51Cr-labeled Me15392 and LCL15392 cells to lysis by TB515 clone. 51Cr-release was measured after 5 h. The assay was performed in the absence ({blacksquare}) or in the presence ({blacktriangleup}) of the anti-HLA-DR Ab L243. B, Cytokine release assay. TB515 clone was incubated overnight at a 1:1 cell ratio with LCL15392 or autologous tumor in the presence or absence of the L243. Supernatant was collected, and the content of IFN-{gamma}, GM-CSF, TNF-{alpha}, and IL-2 was evaluated by commercially available ELISA. SD <= 5%.

 
Mutated PTPRK gene encodes the TB515 epitope

Due to its in vitro growth capacity, TB515 was further selected and used to molecularly characterize the recognized melanoma-specific Ag. The 293-EBNA cells stably transfected with CIITA cDNA (CIITA+293) were used as recipients for a chimeric Ii/tumor cDNA library derived from mRNA extracted from Me15392. The cDNA library divided into pools was then transfected into CIITA+293 cells together with 100 ng of plasmid containing the HLA-DRB1*0102 or DRB1*1001 alleles cloned from the same patient.

The screening of transfectants led to the isolation of one positive cDNA clone (cDNA #11) that was recognized by TB515 T cells when cotransfected into CIITA+293 with HLA-DRB1*1001 (CIITA+-DRB10+293), but not when cotransfected with the HLA-DRB1*0102 allele (CIITA+-DRB1+293) (Fig. 2). No recognition occurred when cDNA #11 and HLA-DRB1*1001 were transfected into 293 not modified by CIITA (wt293), thus further confirming the requirement of an active class II-HLA processing machinery for TB515 activation.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 2. Complementary DNA of clone #11 codes for the TB515-recognized Ag. CIITA+293 were transfected with pEAK8.5-Ii vector containing cDNA #11 (Ii-cDNA#11 in the figure) either alone or together with plasmids containing HLA-DRB1*0102 (DRB1) or HLA-DRB1*1001 (DRB10), respectively. CIITA+293 singly transfected with DRB1 or DRB10 and CIITA+293 cotransfected with DRB10 and pcDNA3.1 encoding green fluorescent protein (GFP) were used as negative controls. Clone TB515 (1 x 105 lymphocytes/well) was added to each transfectant, and after 24 h supernatants were collected and the content of IFN-{gamma} was evaluated by ELISA. Me15392 was used as positive control. SD <= 5%.

 
DNA sequencing analysis indicated that cDNA #11 was homologous to a partial region of the PTPRK (GenBank NM 002844), a type II protein-tyrosine phosphatase (PTP), which is one of the five subfamilies of transmembrane receptor-like PTPs (18). Tumor-derived cDNA #11 extended from 2084 bp to 2751 bp of the published NM 002844 PTPRK cDNA sequence, encompassing the region coding for the fourth, C-most extracellular fibronectin type III-like domain (FNIII), the whole transmembrane domain, and the very initial intracellular sequence. The clone presented a g->a point mutation at nucleotide 2249 in the fourth FNIII of the gene, which led to a glycine-to-arginine substitution (G->R) in the corresponding protein (the GenBank accession number for the sequence of PTPRK cDNA derived from Me15392 is AF533875). To confirm that this amino acid change did not account for a single nucleotide polymorphism, but represented a somatic mutation occurring in tumor tissue, the region encompassing the mutation was amplified and sequenced starting from either genomic DNA or cDNA obtained from both PBL and LCL of patient 15392. None of the analyzed samples showed the g->a transition, and only the wild-type sequence was found (Fig. 3). Moreover, DNA and cDNA derived from 10 additional melanoma cell lines were similarly analyzed, but none of them displayed any mutation at nucleotide 2249 (data not shown).



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 3. The mutated PTPRK is detectable in tumor tissue but not in PBMCs of patient 15392. Genomic DNA purified from melanoma cells (upper panel) or from PBMCs of patient 15392 (lower panel) was amplified by PCR using PTPRK specific primers. The amplified DNA region encompassing the mutation was then directly sequenced. The g->a transition (shown by arrows in the figure) was detectable in the melanoma tissue, whereas only the wild-type sequence was found in normal tissue of patient 15392.

 
Ii sequence is not necessary for the HLA-class II presentation of PTPRK-derived epitope

Sequence analysis of the recombinant plasmid containing the cDNA clone # 11 revealed that the Ii translation was shifted with respect to the frame corresponding to the proper translation of PTPRK protein. Therefore, we postulated the existence in the recombinant plasmid of an additional open reading frame directed by an additional internal ATG. By analyzing the sequence of cDNA #11, we found a Kozak-like sequence ((g/a)nnatgg) whose ATG (position 2165 in the GenBank NM 002844 sequence) was in frame with the authentic first starting methionine of the PTPRK gene. To verify the self-sufficient translation capacity of this inner ATG codon, cDNA #11 was excised from pEAK8.5/Ii vector and inserted into the Ii-lacking expression vector pcDNA3.1. The new recombinant plasmid was then evaluated for the capacity to trigger the TB515 activation when transfected into CIITA+293 cells together with the HLA-DRB1*1001. As expected, the cDNA #11 cloned in the absence of the Ii induced IFN-{gamma} release by TB515 clone in a specific HLA-DRB1*1001-restricted fashion (Fig. 4). The recognition was as efficient as that of cDNA #11 in pEAK8.5-Ii vector or of Me15392, indicating that, in the absence of Ii start codon, cDNA #11 could be translated from its own internal ATG and, moreover, that cDNA #11 could be naturally processed and presented in a class II HLA pathway per se with no need for an Ii-mediated intracellular redirection.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 4. Ii sequence is not necessary for the HLA-class II presentation of PTPRK-derived epitope. Complementary DNA #11 was subcloned in pcDNA3.1 in absence of Ii (recombinant plasmid indicated as cDNA#11 in the figure) and cotransfected in CIITA+293 with plasmid containing HLA-DRB1*1001 (DRB10). Clone TB515 (1 x 105 lymphocytes/well) was added to each transfectant, and after 24 h, supernatants were collected and the content of IFN-{gamma} was evaluated by ELISA. Me15392 and CIITA+293 transfected with pEAK8.5-Ii-cDNA#11 (indicated as Ii-cDNA #11 in the figure) were used as positive controls. SD <= 5%.

 
Expression patterns of PTPRK mRNA

To obtain more information about the PTPRK-specific transcripts in Me15392, Northern blot analysis was performed (Fig. 5). To encompass the whole PTPRK mRNA, hybridization was conducted using an equimolar mixture of three specific probes that mapped in different regions of PTPRK gene. The examined samples also included PBMC poly(A)+RNA as a negative control of PTPRK expression and the transformed epidermal cell line A431 as a positive control of the full-length transcript because this cell line is known to have a high level of PTPRK gene expression (19). As expected, no significant hybridization band was observed in PBMC, thus confirming previous data (19), whereas both A431 and Me15392 poly(A)+ RNAs presented an intense signal at ~5600 bp, corresponding to the full-length transcript, although additional specific bands around 1800 bp and 1000 bp were clearly detectable (Fig. 5). Moreover, these lower bands were both detectable when NH2 or COOH terminal probes were used separately (data not shown), suggesting that alternative splicing events may occur that lead to final transcripts with different length preserving the extracellular and the phosphatase catalytic domains of the protein. All together, these results indicate that Me15392 may express a complete PTPRK protein, whereas the biological significance of the partial mRNA transcripts remains to be addressed.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 5. PTPRK mRNA expression in Me15392 cells. Ten micrograms of poly(A)+ mRNA obtained from Me15392 was analyzed by Northern blot. Hybridization was performed using an equimolar mixture of three 32P-labeled probes spanning the extracellular, transmembrane, and intracellular regions of the PTPRK cDNA (see Materials and Methods for details). Lanes were loaded with a comparable amount of mRNA as checked by {beta}-actin housekeeping gene hybridization (data not shown). Samples: mRNAs obtained from Me15392 cell line, pooled PBMCs from four healthy donors, and A431 epidermoid tumor cell line.

 
Identification of PTPRK-derived peptide reconstituting the epitope for TB515

To assess the importance of the G->R mutation for T cell recognition, a wild-type (not mutated) version of cDNA #11 was synthesized by PCR and cotransfected with HLA-DRB1*1001 cDNA into CIITA+293 cells. No recognition of the wild-type sequence by the tumor-specific CD4+T15392 clones was observed (Fig. 6), thus suggesting a direct role of the mutated amino acid in the epitope formation. To further sharpen the epitope-coding region of cDNA #11, a series of mini-genes was synthesized by PCR of cDNA #11 using an identical forward primer (F2) coupled with different nested reverse primers mapping the mutation downstream (Fig. 6). The minigenes, which all contained the ATG starting codon of cDNA #11, were cloned into the expression vector pcDNA3.1/TOPO (Invitrogen), then were transfected in CIITA+293 expressing either HLA-DRB1*0102 or DRB1*1001, and finally were evaluated for TB515 recognition. The EP2 minigene was the shortest construct being recognized (Fig. 6). As expected, the wild-type version of the EP2 minigene (EP2WT), obtained using reverse primer EPR2WT bearing the wild-type nucleotide (a/g mismatch) was not recognized by TB515 lymphocytes when cloned into the expression vector with or without the invariant chain.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 6. Characterization of cDNA #11. Complementary DNA #11 and related minigenes are represented as boxes aligned to a schematic structure of PTPRK protein. Filled square in each minigene indicates the position of an ATG codon in frame with the starting ATG of the full-length gene (GenBank NM 002844). The mutated nucleotide (g->a) occurring at position 2249 is indicated. Complementary DNA #11wt containing the wild-type nucleotide was prepared by RT-PCR using as template mRNA from LCL15392 with F2 forward primer and EPR0 reverse primer. Minigenes were synthesized by PCR amplification of cDNA #11 using an identical forward primer (F2) coupled with different nested reverse primers mapping the mutation downstream (EPR1, EPR2, EPR2WT, and EPR3 reverse primers, indicated by arrows). Minigenes were cloned into expression vector pcDNA3.1/TOPO and then cotransfected into CIITA+-293 cells with plasmids containing HLA-DRB1*1001 or HLA-DRB1*0102. Clone TB515 (1x105 cells/well) was added to each transfectant, and after 24 h supernatants were evaluated for the content of IFN-{gamma} by ELISA. In the table: +, positive recognition by TB515; -, no recognition by TB515. EP2WT minigene contained the nonmutated (g) nucleotide. Amino acid sequence at the bottom of the figure was deduced from the sequencing of cDNA #11. MAM, meprin/A5/R-PTPµ motif; Ig, immunoglobulin-like domain; TM, transmembrane; R, arginine deriving from the nucleotide g->a mutation.

 
These transfection experiments narrowed the potentially immunogenic amino acid region to a 22-aa-long peptide, shown in Fig. 6, that contained the mutation. To identify the TB515 epitope, several overlapping peptides spanning the identified 22-aa region were synthesized and evaluated for their ability to sensitize in vitro autologous LCL cells to recognition by the anti-melanoma TB515 clone (Fig. 7). The pattern of reactivity of the first set of hexadecamer peptides identified the sequence YFAAELPPRN as a possible core sequence for the TB515 epitope. To confirm these data, reconstitution assays with peptides progressively losing an amino acid residue at NH2 or COOH end were then performed. In particular, the omission of Y669 and N678 (amino acid positions of protein sequence deduced from GenBank NM 002844) completely abrogated the capacity of the PTPRK-derived peptides to stimulate TB515 clone (Fig. 7), thus confirming the YFAAELPPRN as the core epitope recognized by TB515.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 7. Identification of the TB515 epitope. LCL15392 cells (4 x 103 cells/well) pulsed for 2 h at 37°C with 0.3 µM synthetic peptides were used to stimulate TB515 T lymphocytes. T cells (5 x 103 cells/well) were added, and after 18 h the medium was collected and IFN-{gamma} was measured by ELISA. Hexadecamer overlapping peptides encompassing the immunogenic PTPRK region defined in Fig. 6 were tested, and a core peptide sequence (YFAAELPPRN) was defined based on T cell reactivity. Further truncations of the reactive peptides were synthesized to define the minimal peptide determinant. Identical results were obtained using LCL3700 cells, sharing only the HLA-DRB1*1001 allele with patient 15392 (data not shown).

 
Among the hexadecamer peptides tested, PYYFAAELPPRNLPEP (PTPRK667–682), which extends from amino acid 667 to 682 of the protein and contains the mutation (Fig. 8; in bold), was the one giving rise to the strongest IFN-{gamma} release by TB515 clone. Indeed, titration experiments showed that this peptide could be detected by TB515 cells at a concentration as low as 10 nM, reaching its half-maximum effect at 100 nM (Fig. 8). The substitution in the immunogenic peptide of the mutated arginine residue with the wild-type glycine (Fig. 8) completely abrogated stimulatory ability, thus definitely showing the relevance of the mutation for T cell-mediated recognition.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 8. The PYYFAAELPPRNLPEP reconstituted the epitope of TB515 at a dose as low as 10 nM. LCL15392 cells (4 x 103) were incubated with various concentrations of PYYFAAELPPRNLPEP or PYYFAAELPPGNLPEP peptides. The TB515 clone (5 x 103 cells/well) was added, and after 18 h medium was collected and IFN-{gamma} was measured by ELISA. The mutated peptide PYYFAAELPPRNLPEP efficiently reconstituted the TB515 epitope, whereas no reactivity was induced by the wild-type peptide PYYFAAELPPGNLPEP (data not shown). Identical results were obtained using LCL3700 cells sharing only the HLA-DRB1*1001 allele with patient 15392. Mutated amino acid is written in bold; substituted amino acid is underlined.

 
The other four T lymphocyte clones described as having different TCRs were indeed directed against the same epitope, they did not recognize the wild-type peptide, and all of them displayed a similar affinity for the mutated peptide as that observed for TB515 (data not shown).

Patient 15392 developed in vivo local and systemic immunity against the PTPRK-derived, HLA-DR10-presented epitope

To establish whether patient 15392 also developed in vivo an epitope-specific T cell immunity, cryopreserved TALs freshly isolated from the metastatic lesion and PBMCs obtained 70 mo after the surgical resection of the LN metastasis during the disease-free follow-up period were thawed and directly used in an Elispot assay as effector cells. Although a background reactivity directed against the autologous LCL alone or pulsed with 1µM irrelevant peptide was detectable, the addition of 1µM PYYFAAELPPRNLPEP significantly increased the number of IFN-{gamma}-producing cells in both TALs and PBMCs (Fig. 9, A and B). The recognition of the mutated peptide was HLA-DR-restricted because the presence of anti-HLA-DR Ab L243 significantly diminished the number of IFN-{gamma}-producing T cells. The anti-HLA-DR Ab L243 was specific and it did not affect the general reactivity of T cells. The number of T cells releasing IFN-{gamma} in response to autologous LCL pulsed with irrelevant peptide remained unchanged in the presence of this Ab (Fig. 9A). Moreover, PBMCs stimulated in vitro with the immunogenic peptide for 3 wk showed an increase in peptide-specific recognition that paralleled a complete abrogation of the background cytokine release (Fig. 9C). Freshly isolated TALs or in vitro peptide-stimulated PBMCs were also able to recognize the autologous tumor in an HLA-DR-dependent fashion (Fig. 9, A and C). PBMCs from HLA-DRB1*1001-positive healthy donors stimulated in vitro with the mutated peptide did not acquire any specific reactivity (data not shown).



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 9. Ex vivo analysis of PTPRK epitope-specific reactivity in TALs and PBMCs of patient 15392. TALs purified from tumor-invaded LN (A), PBMCs obtained 70 mo after surgery during the disease-free period (B), or PBMCs after 3 wk of in vitro sensitization with PYYFAAELPPRNLPEP peptide (C) were used as effector cells in an IFN-{gamma} Elispot assay. TALs (1 x 104), PBMCs (2 x 105), or in vitro-cultured PBMCs (1 x 104) were incubated with medium or with autologous LCL in the following conditions: not pulsed (medium), pulsed with 2 µM irrelevant human papillomavirus peptide (HLDKKQRFH), or pulsed with PTPRK mutated peptide PYYFAAELPPRNLPEP in the absence or presence of 10 µg/ml HLA-DR-specific mAb L243. Recognition of autologous tumor (Me15392) in the absence or presence of HLA-DR-specific mAb L243 was also included. *, p < 0.05 (evaluated by Student’s t test for unpaired samples) compared with the recognition of unpulsed LCL or LCL pulsed with the irrelevant peptide; **, p < 0.05 (evaluated by Student’s t test for unpaired samples) compared with the same target in the absence of L243 mAb.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Using a tumor-specific CD4+ T cell clone isolated from a tumor-infiltrated LN of a long-surviving melanoma patient and implementing a genetic approach, we identified a novel, class II HLA-restricted tumor Ag. The immunogenic epitope presented by the HLA-DR{alpha}/DRB1*1001 allele results from a mutation of PTPRK, a receptor protein with tyrosine phosphatase activity likely involved in regulating cell proliferation in response to cell-cell contact (20, 21).

Although the reversible protein phosphorylation is one of the major systems operating in the regulation of cell functions, the knowledge concerning the nature and the functional activity of PTPs is still limited (18, 22, 23). PTPRK is known to be expressed in normal tissues such as spleen, prostate, ovary, and keratinocyte epidermal cell lines, but not in PBL and hematological cell lines (19). PTPRK belongs to the family of the receptor-like plasma membrane-spanning PTP molecules, and it is characterized by the presence in its extracellular portion of FNIII repeats, immunoglobulin, and meprin/A5/µ domains (24, 25). Though the precise physiological role of PTPRK is still unclear, its structural features and the ability to mediate homophilic interaction among cells, together with the observation that the expression of PTPRK is induced by cell density, strongly suggests a crucial role of this protein in the regulation of cell-cell contact formation (24). Moreover, it has been recently demonstrated that in humans, PTPRK colocalizes and is associated with {beta}- and {gamma}-catenin at the cell-cell contact area of adjacent cells (20). These findings strongly support the involvement of this protein in negatively regulating the action of tyrosine kinase-induced events at cell junctions, possibly through the dephosphorylation of {beta}- and {gamma}-catenin.

These functional roles, and the finding that human PTPRK gene has been mapped to the putative tumor suppressor gene region 6q22.2-q22.3 (26), which is frequently deleted in melanomas (27, 28), overall support the hypothesis that loss of expression (29) as well as mutations occurring in functional domains of the PTPRK protein could directly affect the phenotype of normal growing cells and could play a role in tumor transformation and progression.

The PTPRK molecule isolated from Me15392 contained a g->a mutation at nucleotide 2249 that leads to a glycine-to-arginine substitution in the fourth FNIII. The presence of this mutation that is included in the immunogenic epitope was also analyzed in 10 additional melanoma lines expressing PTPRK, but none of them showed the mutated sequence (data not shown). Although other cell lines need to be examined, our data suggest that the mutated PTPRK could be operationally considered as a unique melanoma Ag and therefore could be endowed with limited, if any, therapeutic applicability as a cancer vaccine. Whether the mutation that created a T cell epitope in the long-surviving melanoma patient 15392 affects the physiological functions of PTPRK protein is currently under evaluation. Moreover, with the aim of identifying other relevant mutations, we are currently sequencing the entire PTPRK gene in a large panel of primary and metastatic melanoma cell lines.

As for the previously described melanoma-associated Ag EphA3 (30), our epitope is derived from a cell surface expressed receptor-like molecule that may therefore enter a class II processing pathway, likely throughout an endocytosis-mediated process. Although our molecular approach involved the construction of a recombinant library where tumor-derived proteins are forced to enter the class II HLA processing pathway by the presence of the Ii-derived endosomal targeting sequence, nevertheless the stimulation activity of cDNA #11 was maintained to the same extent also when its expression was driven by a plasmid lacking the Ii sorting signal. The cDNA #11 isolated from the primary screening of the tumor library did not contain any known targeting signals, such as di-leucine sequences of Ii and lysosomal-associated membrane protein LAMP-1, or any melanosomal protein signal (31), which could have been responsible of the specific transport to the lysosomal compartments. Thus, both the partial protein encoded by cDNA # 11 and the whole protein may take advantage of the same mechanism for entering the class II HLA processing pathway.

The minimal recognition core for the TB515 epitope is represented by the decamer peptide YFAAELPPRN contained within the hexa-decamer epitope PYYFAAELPPRNLPEP, which gave rise to the best dose-response curve. Substitution of arginine with wild-type glycine led to loss of recognition ability. The natural processed immunogenic epitope derived from PTPRK is presented by the HLA-DR{alpha}/DRB1*1001. No binding motif has been identified for such HLA-DR10 allele, and only one additional T cell epitope presented by HLA-DR10 has been described so far (32). However, no obvious homology could be found between our epitope and the HLA-DRB1*1001-presented peptide derived from the hepatitis {delta} virus (32). Conversely, some putative HLA-DR10 binding peptides previously described (33) all showed a Y residue in their initial position, supporting the hypothesis that the Y669 located in the first position of the minimal core epitope may work as an HLA-DRB1*1001 anchor residue.

All of the 40 T cell clones generated from T lymphocytes obtained from tumor-invaded LN of patient 15392 were directed against this mutated epitope. These tumor-specific CD4+ T cell clones could be grouped in five different subsets according to the expressed TCR, and one clone representative for each subset was shown to specifically recognize the mutated PYYFAAELPPRNLPEP peptide. The TCR of these CD4+ T cells used a restricted TCRAV and TCRBV repertoire, and in particular they do share TCRBV21, TCRAV3, or TCRVA13, indicating that a selection for peptide-specific T cells may have occurred. Moreover, the nominal epitope Ag PYYFAAELPPRNLPEP was still effective in inducing cytokine release by all T cell clones at a dose as low as 10 nM, with half-maximal activity detectable at 100 nM, suggesting that the selected TCR displayed a high affinity/avidity for the MHC/peptide complex. For the majority of the previously described HLA-class II epitopes derived from wild-type proteins, the peptide concentration required to achieve T cell activation was usually higher (30, 34) than that found for our and other mutated epitopes (35). Mutated peptides may be able to induce T cells that, by expressing high-affinity TCR, are more efficient in the recognition of their nominal MHC/peptide complexes when expressed at the cell surface of tumor cells (36).

Epitope-specific reactivity could be detected by Elispot also in freshly isolated TALs, indicating that a PTPRK-specific immunity was present at tumor site at the time of surgery.

Moreover, we showed that this local immunity was also associated with a systemic immunity, because epitope-specific T cells were present in patient’s peripheral blood during the follow-up period when the disease was clinically no longer detectable. In fact, PBMCs obtained 70 mo after the surgical resection of tumor metastasis showed a specific HLA-DR-restricted reactivity directed against the mutated PTPRK-derived peptide, as detected by Elispot analysis. Upon in vitro peptide sensitization, the frequency of epitope-specific T cells was greatly enhanced and paralleled by the acquisition of tumor-specific recognition.

Although in only one case the mutation generating a unique melanoma Ag has been proven to also have a direct role in tumor metastasis (37), in the majority of the previously described unique melanoma Ags (38, 39, 40) and in our patient 15392, the mutations generating the immunogenic epitopes occurred in genes whose functions are relevant for tumor viability. Such a type of immune response, targeting proteins crucial for tumor cell survival, may have a better chance to lead to a clinical benefit.

These data, together with previous findings showing a correlation between T cell-mediated immunity involving mutated Ags and positive clinical evolution in vaccinated cancer patients (41, 42), encourage novel efforts for the development of a cancer vaccine based on the usage of tumor-specific and class II-HLA-restricted Ags.


    Acknowledgments
 
We express our gratitude to Drs. Rong-Fu Wang (Center for Cell and Gene Therapy and Department for Immunology, Baylor College of Medicine, Houston, TX) and Pierre Coulie (Cellular Genetics Unit, Université Catholique de Louvain, Brussels, Belgium) for critical discussions. We also gratefully acknowledge Dr. Jeremy M. Boss (Department of Microbiology and Immunology, Emory University School of Medicine, Atlanta, GA) for providing the CIITA cDNA. We are grateful to Drs. Flavio Arienti and Andrea Maurichi for clinical collaboration. We also thank Agata Cova for her skillful technical work and Grazia Barp and Simona Galuzzi for editorial help.


    Footnotes
 
1 This work was supported in part by a coordinated grant from Associazione Italiana per la Ricerca sul Cancro (Milan, Italy) and by European Community Grant QLK3-CT-1999-00064. Back

2 L.N. and N.R. contributed equally to this work. Back

3 Current address: Cellular Genetics Unit, Université Catholique de Louvain, Brussels, Belgium. Back

4 Address correspondence and reprint requests to Dr. Chiara Castelli, Unit of Immunotherapy of Human Tumors, Istituto Nazionale Tumori, Via Venezian 1, 20133 Milan, Italy. E-mail address: chiara.castelli{at}istitutotumori.mi.it Back

5 Abbreviations used in this paper: LN, lymph node; PTPRK, receptor-like protein tyrosine phosphatase {kappa}; LCL, lymphoblastoid EBV-trasformed B cell line; EBNA, EBV-encoded nuclear Ag; CIITA, class II transactivator; TAL, tumor-associated T lymphocyte; TCRAV, TCR{alpha} variable; TCRBV, TCR{beta} variable; TOPO, topoisomerase; Ii, invariant chain; EPR, exon primer reverse; PTP, protein-tyrosine phosphatase; FNIII, fibronectin type III-like domain; wt293, wild-type 293. Back

Received for publication January 30, 2003. Accepted for publication April 9, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Parmiani, G., C. Castelli, P. Dalerba, R. Mortarini, L. Rivoltini, F. M. Marincola, A. Anichini. 2002. Cancer immunotherapy with peptide-based vaccines: what have we achieved? Where are we going?. J. Natl. Cancer Inst. 94:805.[Abstract/Free Full Text]
  2. Marincola, F. M., E. M. Jaffee, D. J. Hicklin, S. Ferrone. 2000. Escape of human solid tumors from T-cell recognition: molecular mechanisms and functional significance. Adv. Immunol. 74:181.[Medline]
  3. Hung, K., R. Hayashi, A. Lafond-Walker, C. Lowenstein, D. Pardoll, H. Levitsky. 1998. The central role of CD4+ T cells in the antitumor immune response. J. Exp. Med. 188:2357.[Abstract/Free Full Text]
  4. Kalams, S. A., B. D. Walker. 1998. The critical need for CD4 help in maintaining effective cytotoxic T lymphocyte responses. J. Exp. Med. 188:2199.[Free Full Text]
  5. Overwijk, W. W., D. S. Lee, D. R. Surman, K. R. Irvine, C. E. Touloukian, C. C. Chan, M. W. Carroll, B. Moss, S. A. Rosenberg, N. P. Restifo. 1999. Vaccination with a recombinant vaccinia virus encoding a "self" Ag induces autoimmune vitiligo and tumor cell destruction in mice: requirement for CD4+ T lymphocytes. Proc. Natl. Acad. Sci. 96:2982.[Abstract/Free Full Text]
  6. Ossendorp, F., R. E. Toes, R. Offringa, S. H. van der Burg, C. J. Melief. 2000. Importance of CD4+ T helper cell responses in tumor immunity. Immunol. Lett. 74:75.[Medline]
  7. Ossendorp, F., E. Mengede, M. Camps, R. Filius, C. J. Melief. 1998. Specific T helper cell requirement for optimal induction of cytotoxic T lymphocytes against major histocompatibility complex class II negative tumors. J. Exp. Med. 187:693.[Abstract/Free Full Text]
  8. van Bergen, J., M. Camps, R. Offringa, C. J. Melief, F. Ossendorp, F. Koning. 2000. Superior tumor protection induced by a cellular vaccine carrying a tumor-specific T helper epitope by genetic exchange of the class II-associated invariant chain peptide. Cancer Res. 60:6427.[Abstract/Free Full Text]
  9. Toes, R. E., S. P. Schoenberger, E. I. van der Voort, R. Offringa, C. J. Melief. 1998. CD40-CD40 ligand interactions and their role in cytotoxic T lymphocyte priming and anti-tumor immunity. Semin. Immunol. 10:443.[Medline]
  10. Cohen, P. A., L. Peng, G. E. Plautz, J. A. Kim, D. E. Weng, S. Shu. 2000. CD4+ T cells in adoptive immunotherapy and the indirect mechanism of tumor rejection. Crit. Rev. Immunol. 20:17.[Medline]
  11. Hiltbold, E. M., P. A. Roche. 2002. Trafficking of MHC class II molecules in the late secretory pathway. Curr. Opin. Immunol. 14:30.[Medline]
  12. Lennon-Duménil, A. M., A. H. Bakker, P. Wolf-Bryant, H. L. Ploegh, C. Lagaudrière-Gesbert. 2002. A closer look at proteolysis and MHC-class-II-restricted antigen presentation. Curr. Opin. Immunol. 14:15.[Medline]
  13. Renkvist, N., C. Castelli, P. F. Robbins, G. Parmiani. 2001. A listing of human tumor antigens recognized by T cells. Cancer Immunol. Immunother. 50:3.[Medline]
  14. Wang, R. F.. 2001. The role of MHC class II-restricted tumor antigens and CD4+ T cells in antitumor immunity. Trends Immunol. 22:269.[Medline]
  15. Mazzocchi, A., W. J. Storkus, C. Traversari, P. Tarsini, M. J. Maeurer, L. Rivoltini, C. Vegetti, F. Belli, A. Anichini, G. Parmiani, C. Castelli. 1996. Multiple melanoma-associated epitopes recognized by HLA-A3-restricted CTLs and shared by melanomas but not melanocytes. J. Immunol. 157:3030.[Abstract]
  16. Castelli, C., A. Mazzocchi, S. Salvi, A. Anichini, M. Sensi. 1992. Use of the V{delta}1 variable region in the functional T-cell receptor {alpha} chain of a WT31+ cytotoxic T lymphocyte clone which specifically recognizes HLA-A2 molecule. Scand. J. Immunol. 35:487.[Medline]
  17. Castelli, C., A. Mazzocchi, F. Rini, P. Tarsini, L. Rivoltini, M. Maio, G. Gallino, F. Belli, G. Parmiani. 1998. Immunogenicity of the ALLAVGATK (gp100[17–25]) peptide in HLA-A3.1 melanoma patients. Eur. J. Immunol. 28:1143.[Medline]
  18. Zhang, Z. Y.. 2002. Protein tyrosine phosphatases: structure and function, substrate specificity, and inhibitor development. Annu. Rev. Pharmacol. Toxicol. 42:209.[Medline]
  19. Yang, Y., M. C. Gil, E. Y. Choi, S. H. Park, K. H. Pyun, H. Ha. 1997. Molecular cloning and chromosomal localization of a human gene homologous to the murine R-PTP-{kappa}, a receptor-type protein tyrosine phosphatase. Gene 186:77.[Medline]
  20. Fuchs, M., T. Muller, M. M. Lerch, A. Ullrich. 1996. Association of human protein-tyrosine phosphatase {kappa} with members of the armadillo family. J. Biol. Chem. 271:16712.[Abstract/Free Full Text]
  21. Neel, B. G., N. K. Tonks. 1997. Protein-tyrosine phosphatases in signal transduction. Curr. Opin. Cell Biol. 9:193.[Medline]
  22. Hunter, T.. 1995. Protein kinases and phosphatases: the yin and yang of protein phosphorylation and signalling. Cell 80:225.[Medline]
  23. Petrone, A., J. Sap. 2000. Emerging issues in receptor protein tyrosine phosphatase function: lifting fog or simply shifting?. J. Cell Sci. 113:2345.[Abstract]
  24. Sap, J., Y. P. Jiang, D. Friedlander, M. Grumet, J. Schlessinger. 1994. Protein receptor tyrosine phosphatase R-PTP-{kappa} mediates homophilic binding. Mol. Cell. Biol. 14:1.[Abstract/Free Full Text]
  25. Zondag, G. C., G. M. Koningstein, Y. P. Jiang, J. Sap, W. H. Moolenaar, M. F. Gebbink. 1995. Homophilic interactions mediated by receptor tyrosine phosphatases µ and {kappa}: a critical role for the novel extracellular MAM domain. J. Biol. Chem. 270:14247.[Abstract/Free Full Text]
  26. Zhang, Y., R. Siebert, P. Matthiesen, Y. Yang, H. Ha, B. Schlegelberger. 1998. Cytogenetical assignment and physical mapping of the human R-PTP-{kappa} gene (PTPRK) to the putative tumor suppressor gene region 6q22.2-q22.3. Genomics 51:309.[Medline]
  27. Guan, X. Y., H. E. Zhang, H. Zhou, J. S. Sham, J. M. Fung, J. M. Trent. 2002. Characterization of a complex chromosome rearrangement involving 6q in a melanoma cell line by chromosome microdissection. Cancer Genet. Cytogenet. 134:65.[Medline]
  28. Maitra, A., A. F. Gazdar, T. O. Moore, A. Y. Moore. 2002. Loss of heterozygosity analysis of cutaneous melanoma and benign melanocytic nevi: laser capture microdissection demonstrates clonal genetic changes in acquired nevocellular nevi. Hum. Pathol. 33:191.[Medline]
  29. McArdle, L., M. Rafferty, G. M. Maelandsmo, O. Bergin, C. J. Farr, P. A. Dervan, S. O’Loughlin, M. Herlyn, D. J. Easty. 2001. Protein tyrosine phosphatase genes downregulated in melanoma. J. Invest. Dermatol. 117:1255.[Medline]
  30. Chiari, R., G. Hames, V. Stroobant, C. Texier, B. Maillère, T. Boon, P. G. Coulie. 2000. Identification of a tumor-specific shared antigen derived from an Eph receptor and presented to CD4+ T cells on HLA class II molecules. Cancer Res. 60:4855.[Abstract/Free Full Text]
  31. Wang, S., S. Bartido, G. Yang, J. Qin, Y. Moroi, K. S. Panageas, J. J. Lewis, A. N. Houghton. 1999. A role for a melanosome transport signal in accessing the MHC class II presentation pathway and in eliciting CD4+ T cell responses. J. Immunol. 163:5820.[Abstract/Free Full Text]
  32. Nisini, R., M. Paroli, D. Accapezzato, F. Bonino, F. Rosina, T. Santantonio, F. Sallusto, A. Amoroso, M. Houghton, V. Barnaba. 1997. Human CD4+ T-cell response to hepatitis {delta} virus: identification of multiple epitopes and characterization of T-helper cytokine profiles. J. Virol. 71:2241.[Abstract]
  33. Hickling, J. K., C. M. Fenton, K. Howland, S. G. Marsh, J. B. Rothbard. 1990. Peptides recognized by class I restricted T cells also bind to MHC class II molecules. Int. Immunol. 2:435.[Abstract/Free Full Text]
  34. Topalian, S. L., M. I. Gonzales, M. Parkhurst, Y. F. Li, S. Southwood, A. Sette, S. A. Rosenberg, P. F. Robbins. 1996. Melanoma-specific CD4+ T cells recognize nonmutated HLA-DR-restricted tyrosinase epitopes. J. Exp. Med. 183:1965.[Abstract/Free Full Text]
  35. Pieper, R., R. E. Christian, M. I. Gonzales, M. I. Nishimura, G. Gupta, R. E. Settlage, J. Shabanowitz, S. A. Rosenberg, D. F. Hunt, S. L. Topalian. 1999. Biochemical identification of a mutated human melanoma antigen recognized by CD4+ T cells. J. Exp. Med. 189:757.[Abstract/Free Full Text]
  36. Yang, S., G. P. Linette, S. Longerich, F. G. Haluska. 2002. Antimelanoma activity of CTL generated from peripheral blood mononuclear cells after stimulation with autologous dendritic cells pulsed with melanoma gp100 peptide G209-2M is correlated to TCR avidity. J. Immunol. 169:531.[Abstract/Free Full Text]
  37. Wang, R. F., X. Wang, S. A. Rosenberg. 1999. Identification of a novel MHC class II restricted tumor antigen resulting from a chromosomal rearrangement recognized by CD4+ T cells. J. Exp. Med. 189:1659.[Abstract/Free Full Text]
  38. Wolfel, T., M. Hauer, J. Schneider, M. Serrano, C. Wolfel, E. Klehmann-Hieb, E. De Plaen, T. Hankeln, K. H. Meyer zum Buschenfelde, D. Beach. 1995. A p16INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma. Science 269:1281.[Abstract/Free Full Text]
  39. Robbins, P. F., M. El-Gamil, Y. F. Li, Y. Kawakami, D. Loftus, E. Appella, S. A. Rosenberg. 1996. A mutated {beta}-catenin gene encodes a melanoma-specific antigen recognized by tumor infiltrating lymphocytes. J. Exp. Med. 183:1185.[Abstract/Free Full Text]
  40. Wang, H. Y., J. Zhou, K. Zhu, A. I. Riker, F. M. Marincola, R. F. Wang. 2002. Identification of a mutated fibronectin as a tumor antigen recognized by CD4+ T cells: its role in extracellular matrix formation and tumor metastasis. J. Exp. Med. 195:1397.[Abstract/Free Full Text]
  41. Baurain, J. F., D. Colau, N. van Baren, C. Landry, V. Martelange, M. Vikkula, T. Boon, P. G. Coulie. 2000. High frequency of autologous anti-melanoma CTL directed against an antigen generated by a point mutation in a new helicase gene. J. Immunol. 164:6057.[Abstract/Free Full Text]
  42. Karanikas, V., D. Colau, J. F. Baurain, R. Chiari, J. Thonnard, I. Gutierrez-Roelens, C. Goffinet, E. V. Van Schaftingen, P. Weynants, T. Boon, P. G. Coulie. 2001. High frequency of cytolytic T lymphocytes directed against a tumor-specific mutated antigen detectable with HLA tetramers in the blood of a lung carcinoma patient with long survival. Cancer Res. 61:3718.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
C. Casati, C. Camisaschi, L. Novellino, A. Mazzocchi, F. Triebel, L. Rivoltini, G. Parmiani, and C. Castelli
Human Lymphocyte Activation Gene-3 Molecules Expressed by Activated T Cells Deliver Costimulation Signal for Dendritic Cell Activation
J. Immunol., March 15, 2008; 180(6): 3782 - 3788.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Maccalli, D. Nonaka, A. Piris, D. Pende, L. Rivoltini, C. Castelli, and G. Parmiani
NKG2D-Mediated Antitumor Activity by Tumor-Infiltrating Lymphocytes and Antigen-Specific T-Cell Clones Isolated from Melanoma Patients
Clin. Cancer Res., December 15, 2007; 13(24): 7459 - 7468.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Parmiani, A. De Filippo, L. Novellino, and C. Castelli
Unique Human Tumor Antigens: Immunobiology and Use in Clinical Trials
J. Immunol., February 15, 2007; 178(4): 1975 - 1979.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Sensi and A. Anichini
Unique Tumor Antigens: Evidence for Immune Control of Genome Integrity and Immunogenic Targets for T Cell-Mediated Patient-Specific Immunotherapy
Clin. Cancer Res., September 1, 2006; 12(17): 5023 - 5032.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Sensi, G. Nicolini, M. Zanon, C. Colombo, A. Molla, I. Bersani, R. Lupetti, G. Parmiani, and A. Anichini
Immunogenicity without Immunoselection: A Mutant but Functional Antioxidant Enzyme Retained in a Human Metastatic Melanoma and Targeted by CD8+ T Cells with a Memory Phenotype
Cancer Res., January 15, 2005; 65(2): 632 - 640.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Parmiani, A. Testori, M. Maio, C. Castelli, L. Rivoltini, L. Pilla, F. Belli, V. Mazzaferro, J. Coppa, R. Patuzzo, et al.
Heat Shock Proteins and Their Use as Anticancer Vaccines
Clin. Cancer Res., December 15, 2004; 10(24): 8142 - 8146.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Novellino, L.
Right arrow Articles by Castelli, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Novellino, L.
Right arrow Articles by Castelli, C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
Medline Plus Health Information
*Melanoma


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS