The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, N.
Right arrow Articles by West, D. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, N.
Right arrow Articles by West, D. B.
The Journal of Immunology, 2003, 170: 6307-6319.
Copyright © 2003 by The American Association of Immunologists

An Inducible Nitric Oxide Synthase-Luciferase Reporter System for In Vivo Testing of Anti-inflammatory Compounds in Transgenic Mice1

Ning Zhang2,*, Aneil Weber*, Bonnie Li*, Richard Lyons{dagger}, Pamela R. Contag*, Anthony F. Purchio* and David B. West*

* Xenogen Corporation, Alameda, CA 94501; and {dagger} CRF 321, University of New Mexico, Health Science Center, Albuquerque, NM 87131


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The inducible NO synthase gene (iNOS) plays a role in a number of chronic and acute conditions, including septic shock and contact hypersensitivity autoimmune diseases, such as rheumatoid arthritis, gastrointestinal disorders, and myocardial ischemia. The iNOS gene is primarily under transcriptional control and is induced in a variety of conditions. The ability to monitor and quantify iNOS expression in vivo may facilitate a better understanding of the role of iNOS in different diseases. In this study, we describe a transgenic mouse (iNos-luc) in which the luciferase reporter is under control of the murine iNOS promoter. In an acute sepsis model produced by injection of IFN-{gamma} and LPS, we observed an induction of iNOS-driven luciferase activity in the mouse liver. This transgene induction is dose and time dependent and correlated with an increase of liver iNOS protein and iNOS mRNA levels. With this model, we tested 11 compounds previously shown to inhibit iNOS induction in vitro or in vivo. Administration of dexamethasone, epigallocatechin gallate, {alpha}-phenyl-N-tert-butyl nitrone, and ebselen significantly suppressed iNOS transgene induction by IFN-{gamma} and LPS. We further evaluated the use of the iNos-luc transgenic mice in a zymosan-induced arthritis model. Intra-articular injection of zymosan induced iNos-luc expression in the knee joint. The establishment of the iNos-luc transgenic model provides a valuable tool for studying processes in which the iNOS gene is induced and for screening anti-inflammatory compounds in vivo.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nitric oxide is a mediator of many cellular events, and is produced by one of three NO synthases (NOS):3 neuronal NOS, endothelial NOS, and inducible or iNOS. iNOS is expressed in a variety of cell types and is a key mediator of several immunologic responses (1, 2, 3). iNOS-mediated NO release plays an important role in the pathogenesis of septic shock. In response to LPS and cytokines, host cells release many inflammatory cytokines and have increased iNOS expression, resulting in the formation of a large quantity of NO (4, 5, 6, 7). Endogenous IFN-{gamma} significantly enhances the LPS-mediated induction of iNOS mRNA in vivo (8). The production of NO in lungs and liver contributes to the systemic hypotension and myocardial depression that characterizes septic shock (9).

In addition to the production of iNOS in macrophages and a role in innate immunity and septic shock, iNOS is also produced in other cell types and is implicated in a variety of disease processes. For example, a role for iNOS has been proposed in contact hypersensitivity (10), in gastric and intestinal mucosal response to damage and inflammation (11), and it may serve a protective role in cardiac tissue following myocardial ischemia (12). In autoimmune disorders, the role of iNOS includes tissue destruction due to locally recruited lymphocytes, and the production of NO leading to cell death; however, iNOS may also play other roles in autoimmune diseases (see Weinberg (13) for a review of the role of iNOS in autoimmunity).

Inducible NOS activity during an inflammatory response is predominantly regulated at the transcriptional level, although there can be posttranscriptional and posttranslational regulation as well (14, 15). A number of transcription factors, including NF-{kappa}B, IRF-1, Stat1{alpha}, and Oct-1, induced or activated by LPS and cytokines, act upon the iNOS gene promoter to activate transcription.

Given that iNOS plays a role in many disease states, and the regulation of iNOS is primarily through induction of gene expression, one approach to study the role of iNOS in disease development and progression in animal models is to use a reporter system to report on the transcriptional activity of the iNOS gene. Such a reporter system would be useful for better understanding the role of iNOS in disease and also for understanding the response of iNOS to drug treatment. Recently, an in vivo reporting system has been described by Contag et al. (16, 17) that allows for the real-time assessment of gene induction by driving luciferase expression with promoter elements of specific genes. This bioluminescent imaging allows for the noninvasive monitoring of gene induction using a sensitive camera system.

In this study, we describe a transgenic mouse model with the murine iNOS promoter driving expression of a luciferase reporter. This iNos-luc transgenic mouse provides a model system to noninvasively monitor the induction of the iNOS gene in vivo. We used this model to evaluate the induction of iNOS following treatment with LPS and IFN-{gamma} and to screen the effects of anti-inflammatory agents on iNOS gene induction. In addition, we show that the iNos-luc mice can be used to monitor acute arthritis induced by intra-articular injection of zymosan A, a yeast cell wall extract.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture

The mouse macrophage-like cell line RAW264.7 and the hepatocyte cell line Hepa1-6 were obtained from American Type Culture Collection (Manassas, VA). Cells were cultured in DMEM (Invitrogen, Carlsbad, CA), supplemented with 2 mM L-glutamine, antibiotics (100 U/ml penicillin G and 100 U/ml streptomycin), and 10% heat-inactivated FCS (Invitrogen). The cells were cultured at 37°C in a humidified incubator under a 5% CO2 (RAW264.7) or 10% CO2 (Hepa1-6) atmosphere.

Reagents

Bacterial LPS (from Salmonella abortus equi) and zymosan A (a cell wall preparation from Saccharomyces cerevisiae) were purchased from Sigma-Aldrich (St. Louis, MO). Mouse rIFN {gamma} was purchased from R&D Systems (Minneapolis, MN). Dexamethasone, epigallocatechin gallate (EGCG), N-tert-butyl-{alpha}-phenylnitrone (PBN), ebselen, genistein, aminoguanidine, acetaminophen, apigenin, pyrrolidinedithiocarbamate (PDTC), resveratrol, and pentoxifylline were purchased from Sigma-Aldrich. Luciferin (Biosyth, Basel, Switzerland) was dissolved in PBS at 28.6 mg/ml and stored at -20°C. The renilla luciferase vector, pRL-TK was purchased from Promega (Madison, WI).

Luciferase assay

Luciferase activity was assayed using the Luciferase Assay System (Promega) and a Turner Design, TD 20/20, Luminometer (Sunnyvale, CA).

Transient transfection

Approximately 1–3 x 107 RAW264.7 cells were washed with PBS and resuspended in 0.5 ml DMEM (without FCS or antibiotics). A total of 50 µg of iNos-luc DNA (as described below) plus 5 µg of pRL-TK renilla luciferase vector was added to the cells, and the mixture was electroporated (95 kµF capacitance, 0.32 kv) in a 0.4-cm electroporation cuvette. The cells were plated in a 24-well plate to 40–60% confluence. Hepa1-6 cells were transfected with iNos-luc DNA and the pRL-TK renilla luciferase vector using lipofectamin, as directed in the manufacturer’s protocol (Invitrogen). After 6 h, the cells were washed twice with PBS and stimulated with IFN-{gamma} and LPS for 16 h. The cells were lysed with 1x passive lysis buffer (Promega) and assayed for luciferase activity using the dual luciferase assay kit (Promega). The signal from the iNos-luc construct was normalized to the signal from the renilla luciferase to control for variation in transfection efficiency.

Generation of iNos-luc transgenic mice

A 1.24-kb HindIII-BglII fragment of the murine iNOS promoter was isolated (5). The promoter fragment was cloned into the polylinker site of pGL3-Basic (Promega) that was linearized with SmaI and BglII. This iNos-luc reporter construct was tested by transient transfection in RAW264.7 and Hepa1-6 cells. This same construct was linearized with NotI and SalI to release the iNos-luc transgenic cassette, and used to generate transgenic mice in the FVB/N background strain using standard microinjection techniques. The transgenic mice were bred to homozygosity before testing. The transgenic model described in this work is named FVB/N-Tg (iNos-luc) Xen. This conforms to the standard nomenclature for mouse genetic models. Throughout this work, the transgene and the transgenic mouse are abbreviated as iNos-luc, while the endogenous gene, mRNA, and protein are abbreviated iNOS.

In vivo and ex vivo imaging of luciferase activity

In vivo imaging of the iNos-luc transgenic mice was performed, as previously described (17, 18). Mice were anesthetized with isoflurane, and 4.3 mg of luciferin dissolved in 150 µl of PBS (28.6 mg/ml) was injected i.p. Five minutes later, the mice were placed in a ventral recumbent position in the IVIS imaging system chamber (Xenogen, Alameda, CA) and imaged for 5 min with the camera set at the highest sensitivity. When imaging, first a black and white image of the animal is taken in low light conditions, then the photons emitted from the animal are collected by a sensitive cooled charge-coupled device camera. Photons emitted from the liver region were quantified using LivingImage software (Xenogen). Luciferase activity is presented as the photons emitted/s.

For ex vivo imaging, the luciferase signal was induced with IFN-{gamma} and LPS. Six hours following the LPS injection, the mice were anesthetized and injected with luciferin i.v. Three minutes following luciferin injection, the animal was sacrificed and the tissues were rapidly excised. Tissues were placed on a heated stage in the IVIS system and imaged with the same settings used for the in vivo studies.

Acute iNOS induction by IFN-{gamma} and LPS in transgenic animals

The induction of acute sepsis by the combination of bacterial endotoxin and IFN-{gamma} has been shown to induce endotoxemia in mice (19) and to induce the expression of the iNOS gene in vitro (5). Mouse IFN-{gamma} was reconstituted in sterile PBS with 0.1% BSA to give a final concentration of 0.333 µg/µl. LPS was dissolved in sterile PBS to a concentration of 10 mg/ml. Each mouse was injected i.p. with 1 µg of IFN-{gamma} (diluted in 100 µl of PBS), followed 2 h later with an i.p. injection of LPS (0.1–3.0 mg/kg body weight). Control mice were injected with PBS. At various time points after the LPS or sham injection, mice were injected i.p. with 150 µl of luciferin (28.6 mg/ml PBS). Five minutes following luciferin injection, the mice were imaged using the IVIS imaging system with a 5-min camera exposure. In some experiments, following collection of the image, mice were sacrificed and tissues were collected for Western and Northern blot analysis and in vitro luciferase assay.

In vivo screening of anti-inflammatory compounds

Mice were predosed with the compounds the day before treatment with IFN-{gamma} and LPS (see Table I for doses). On the second day, mice were treated with two half doses of the compounds: 1 h before the IFN-{gamma} injection (1 µg/mouse, i.p.), and 2 h following the IFN-{gamma} (at the same time as the LPS injection (3 mg/kg body weight, i.p.)). At 6 h after LPS injection, mice were injected i.p. with 150 µl of luciferin and imaged using the IVIS imaging system with a 5-min camera exposure. After imaging, mice were sacrificed and tissues were collected for Western and Northern blot analysis and in vitro luciferase assay (see below).


View this table:
[in this window]
[in a new window]
 
Table I. Compounds tested for ability to inhibit LPS-induced iNos-lucactivity

 
Acute arthritis model by intra-articular administration of zymosan

Zymosan A was suspended in sterile PBS containing 5% glucose at 30 mg/ml. The mice were anesthetized with an i.m. injection of ketamine (80 mg/kg) and xylazine (16 mg/kg), and the hind legs of iNos-luc female mice were decontaminated with 70% ethanol. A 4-mm incision was made directly below the patella. The right knee tendon was exposed, and 10 µl containing 300 µg of zymosan A suspension was injected intra-articularly through the tendon with a 25 G insulin syringe. The skin was fastened with tissue glue. The left rear knees of the control mice were injected with 5% glucose in PBS (sham control). Mice were i.p. injected with 150 µl (28.6 mg/ml PBS) of luciferin at various time points following intra-articular injection and imaged with the IVIS imaging system with a 5-min data collection period.

Western and Northern blot analysis

Mouse tissue was homogenized in 3 vol of PBS plus protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN; catalogue 1836170) and lysed with passive lysis buffer (Promega; catalogue E1941). After spinning at 14,000 rpm for 10 min at 4°C, the supernatant was collected. Protein concentration was estimated by Bradford reagent (Sigma-Aldrich). Luciferase activity was measured with a luminometer, as described above. For Western blot analysis, equal amounts of protein (10 µg) were loaded onto SDS-PAGE gels. After transfer, the membrane was probed with a specific anti-iNOS rabbit polyclonal Ab (Santa Cruz Biotechnology, Santa Cruz, CA). The blots were developed using the ECL Plus Western Blotting Detection System (Amersham Biosciences, Piscataway, NJ).

Total RNA was isolated from mouse liver using RNAqueous kit (Ambion, Austin, TX). A total of 5 µg of RNA was analyzed by Northern blot using NorthernMax system (Ambion). iNOS cDNA was cloned into the pGEM-3 vector and verified by sequence analysis. A 1.06-kb iNOS PCR product was amplified from this clone (forward primer, GCTCTAGAGAGAAGCTGAGGCCCAGGAGGAG; reverse primer, CGGAATTCCTGCCTATCCGTCTCGTCCGTG).

The amplified PCR product was cloned into the pBlueScript SK vector (Stratagene, La Jolla, CA) that was linearized with XbaI and EcoRI. The iNOS cDNA vector was then linearized with XbaI. Single strand RNA probe was prepared by transcription with T7 polymerase using Strip-EZ (Ambion). After hybridization, the signals were detected using BrightStarBioDetect kit (Ambion).

In situ hybridization with luciferase RNA probes

To assess the cellular localization of the luciferase RNA in livers from control and LPS + IFN-{gamma}-treated mice, livers were removed 6 h following treatment and processed for in situ hybridization with either sense or antisense probes against firefly luciferase mRNA. Briefly, tissues were fixed in 4% paraformaldehyde in PBS overnight, dehydrated, and infiltrated with paraffin. Serial sections (5–7 µm) were mounted on gelatinized slides. One to three sections were mounted on each slide, deparaffinized in xylene, rehydrated, and postfixed. The sections were digested with proteinase K, postfixed, treated with triethanolamine/acetic anhydride, washed, and dehydrated. RNA probes for the luciferase gene were synthesized using pGEM-3zf+-luc as a template following the manufacturer’s recommendations (Ambion). Probes were labeled with 35S-UTP (>1000 Ci/mmol; Amersham). Antisense probe was synthesized using NcoI-linearized pGEM-3zf+-luc with T7 RNA polymerase, and sense probe was synthesized using KpnI-linearized pGEM-3zf+-luc with SP6 RNA polymerase. RNA transcripts were subjected to alkali hydrolysis to give a mean size of 70 bases for efficient hybridization. Hybridization was performed overnight at 52°C in 50% deionized formamide, 0.3 M NaCl, 20 mM Tris-HCl, pH 7.4, 5 mM EDTA, 10 mM NaPO4, 10% dextran sulfate, 1x Denhardt’s, 50 µg/ml total yeast RNA, and 50,000-75,000 cpm/µl 35S-labeled cRNA probe. The tissue was subjected to stringent washing at 65°C in 50% formamide, 2x SSC, and 10 mM DTT, and washed in PBS before treatment with 20% µg/ml RNase A at 37°C for 30 min. Following washes in 2x SSC and 0.1x SSC for 10 min at 37°C, the slides were dehydrated and dipped in Kodak NTB-2 nuclear track emulsion and exposed for 1 wk in light-tight boxes with dessicant at 4°C. Photographic development was conducted with a Kodak D-19 developer. Slides were counterstained lightly with toluidine blue and analyzed using both light and dark field optics with a Zeiss (Oberkochen, Germany) Axiophot microscope. The in situ hybridization work was performed by qualified histopathologists at Phylogeny (Columbus, OH) using tissues provided for them.

Immunohistochemistry

To demonstrate that LPS + IFN-{gamma} treatment increased iNOS protein content in liver Kupffer cells and hepatocytes, livers were removed 6 h following LPS + IFN-{gamma}, or control injections, and were processed for immunohistochemical staining with an anti-iNOS Ab. Mice were perfused with 4% paraformaldehyde before liver removal. Liver tissues were collected and fixed in 4% paraformaldehyde for 6 h and stored in 15% sucrose at 4°C until processing. Paraffin sections (4 µm) were deparaffinized, and endogenous peroxidase was quenched with 3% hydrogen peroxide. Presence of iNOS protein was determined by overnight incubation of the sections with mouse anti-iNOS polyclonal rabbit Abs (Santa Cruz Biotechnology; catalogue SC-650) at 4°C. The sections were then incubated with Envision+, peroxidase rabbit ready-to-use peroxidase staining reagent (DAKO, Carpenteria, CA; catalogue K4002). The immunohistochemical work was performed by qualified histopathologists at Bolderpath (Boulder, CO).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Induction of iNos-luc transgene expression in RAW264.7 and Hepa1-6 cells by IFN-{gamma} and LPS

The iNos-luc vector was transiently transfected into murine macrophage-like cell line RAW264.7, and luciferase activity was measured 16 h after exposure of the cells to LPS (doses 0.01–1.0 µg/ml with or without IFN-{gamma} (20 ng/ml)). Luciferase activity was induced in a dose-dependent manner when LPS (without IFN-{gamma}) was administered in the range of 0–1.0 µg/ml (data not shown). IFN-{gamma}, in addition to LPS, increased the response ~10-fold. In another experiment, Hepa1-6 cells, transiently transfected with the iNos-luc construct, were minimally responsive to LPS (1 µg/ml) and IFN-{gamma} (20 ng/ml) compared with the response of the RAW264.7 cells treated with these agents (Fig. 1).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 1. iNos induction by IFN-{gamma} and LPS in transfected RAW264.7 and Hepa1-6 cells. The response of both RAW264.7 and Hepa1-6 cells to 1.0 µg/ml LPS and IFN-{gamma} (20 ng/ml) was compared. RAW264.7 cells responded to LPS or IFN-{gamma} alone, and showed a dramatic response to the combination of LPS and IFN-{gamma}. Hepa1-6 cells were minimally responsive to LPS or the combination of LPS and IFN-{gamma}, and did not respond to IFN-{gamma} alone.

 
Induction of transgene expression in iNos-luc transgenic mice by IFN-{gamma} and LPS

We generated a number of iNos-luc transgenic founders whose progeny were screened for the luciferase signal in response to IFN-{gamma} and LPS, as described in Materials and Methods. One founding line with strong induction of the luciferase reporter in the liver was selected and bred to homozygosity and characterized, as described in this study. In this line (FVB/N-Tg(iNos-luc)Xen), the luciferase signal was strongly induced in the liver by the combination of IFN-{gamma} (1 µg/mouse) and LPS (3 mg/kg body weight), compared with control mice that were injected with PBS (Fig. 2A). Treatment of the iNos-luc mice with LPS or IFN-{gamma} alone produced very little induction of luciferase activity. Using the LivingImage software to analyze the IVIS images, the luciferase signal from the liver region was quantified (Fig. 2B), and this correlated well with luciferase signal measured in liver lysates by luminometer (Fig. 2C). iNOS mRNA measured by Northern blot (Fig. 2D) and protein measured by Western blot (Fig. 2E) in the livers of mice treated with both IFN-{gamma} and LPS were significantly increased and correlated with the intensity of the bioluminescent image. In PBS-injected mice, the iNOS mRNA and protein were undetectable. Mice treated with LPS alone had a small increase of iNOS mRNA and protein, while mice treated with IFN-{gamma} had no measurable iNOS mRNA or protein (Fig. 2, D and E). As shown in Fig. 2A, male mice showed stronger luciferase signals in response to IFN-{gamma} and LPS compared with the females. However, Western blot analysis did not show this gender difference.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 2. iNOS induction by IFN-{gamma} and LPS in iNos-luc transgenic mice. A, Both male and female iNos-luc mice (n = 4 for each gender) were i.p. injected with either IFN-{gamma} (1 µg/mouse), LPS (3 mg/kg), or both IFN-{gamma} and LPS, as described in Materials and Methods. As treatment controls, transgenic mice were injected with PBS. These experiments were repeated three times with separate groups of mice. The mice were imaged at 6 h after LPS treatment, and representative images from one mouse from each treatment group are presented for both genders. The color overlay on the image represents the photons/s emitted from the animal with a range of 0–30,000 photons/s for the male, and a range of 0–10,000 photons/s for the female images, as indicated by the color scales. B, Liver luciferase activity measured by LivingImage software. Data represent mean and SD (n = 4). C, Luciferase activity in the liver lysate measured with luminometer. D, Northern blot analysis for iNOS in male liver. Lane 1, Control; lane 2, IFN-{gamma} + LPS; lane 3, LPS; lane 4, IFN-{gamma}. E, Western blot analysis of male liver lysate with anti-iNOS polyclonal Ab. Lane 1, Control; lane 2, IFN-{gamma} + LPS; lane 3, LPS; lane 4, IFN-{gamma}.

 
Induction of luciferase expression in mouse liver was confirmed by ex vivo image analysis of selected organs rapidly removed from mice injected with IFN-{gamma} (1 µg/mouse) and LPS (3 mg/kg). A strong signal was induced in the liver, while other organs such as intestine, lung, brain, kidney, heart, and spleen produced either very low or undetectable luciferase signals (Fig. 3A). Western blot analysis, however, revealed that treatment with LPS and IFN-{gamma} increased the endogenous iNOS protein in liver, spleen, lung, and intestine (Fig. 3B). In a separate experiment, we measured luciferase expression in a number of tissues from both saline-treated control mice and LPS + IFN-{gamma}-treated mice using a luminometer. The data indicate that low basal level of luciferase expression was detectable in all these tissues from control mice (Fig. 3C). Significant induction of luciferase expression was detected in the liver of LPS + IFN-{gamma}-treated mice. In lung, spleen, and kidney, there was a slight luciferase induction after LPS + IFN-{gamma} treatment. However, these tissues exhibited high variability among different individuals. No induction of luciferase expression was observed in brain, heart, and intestine after LPS + IFN-{gamma} treatment.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 3. Ex vivo study of iNos-luc expression and iNOS protein in specific organs. A, Male iNos-luc mice (n = 4) were treated with IFN-{gamma} and LPS (3 mg/kg). At 6 h after LPS injection, mice were injected with 150 µl of luciferin (i.v.). After 3 min, the mice were sacrificed and selected organs were rapidly excised and imaged with IVIS imaging system. Representative images for each organ are presented in A. The luciferase signal was only detected in the liver. These experiments were repeated three times in three separate groups of mice with consistent results. B, Western analysis for the presence of iNOS protein in liver, brain, kidney, heart, spleen, lung, and intestine 6 h following induction in control-treated mice and mice injected with IFN-{gamma} + LPS. INOS protein was detected in liver, spleen, lung, and intestine. C, Mice were treated with IFN-{gamma} + LPS. Organs were rapidly harvested 6 h following treatment and homogenized for luciferase activity measurement with a luminometer. Saline-treated mice were used as controls.

 
Dose- and time-dependent induction of iNos-luc transgene expression by LPS

Mice were pretreated with IFN-{gamma} (1 µg/mouse, i.p.), followed 2 h later by i.p. injection of 0.1–3.0 mg/kg of LPS. We observed dose- and time-dependent induction of iNos-luc transgene expression, as shown in Fig. 4, A and B. Induction of iNos-luc transgene expression in the mouse liver was readily detectable as soon as 4 h after LPS injection. The peak time of maximum transgene induction varied among the doses tested. At an LPS dose of 0.3 mg/kg, the peak induction was at 6 h after LPS injection, while the peak luciferase signal for the 1.0 and 3.0 mg/kg was at or beyond the 9-h time point. At the early time points tested (2 and 4 h), there were no significant differences in the luciferase signal intensity among the three groups given the higher LPS doses. At 9 h, mice treated with 1.0 and 3.0 mg/kg LPS have significant higher luciferase signals than mice given the lower LPS doses. The signal in all of the treated mice, except the mice in the 3.0 mg/kg group, declined to basal level at 24 h. Two mice of the 3.0 mg LPS/kg group diedbefore the 24-h imaging point, suggesting that the 3.0 mg/kg dose was close to the LD50. No death occurred in the other dosage groups. Both of the dead mice had significantly higher level of transgene induction than the other mice in this dosage group.



View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 4. Dose effect of LPS on iNos-luc induction. A, Male iNos-luc mice (n = 4 for each LPS dose) were treated with IFN-{gamma} (1 µg/mouse) and a range of LPS doses (0–3 mg/kg). At 0, 2, 4, 6, 9, and 24 h following LPS injection, luciferin was injected i.p. and the mice were imaged. The color overlay on the image represents the photons/s emitted from the animal with a range of up to 50,000 photons/s, as indicated by the color scale next to the images. B, Quantification of luciferase activity of the liver region with LivingImage software. Data presented are mean and SD (n = 4/group). These experiments were repeated three times in three separate groups of mice.

 
We also evaluated the response to repeated dosing of LPS (1 mg/kg) + IFN-{gamma} (1.0 µg/mouse) in four iNos-luc transgenic mice. Eight days following an initial injection at these doses, we repeated the injections and determined the image intensity 9 h later. The relative amount of light following the second dosage regiment was less than 10% that of the response to the first experiment, suggesting that there is some adaptive response to this treatment (data not shown).

Localization of iNos-luc signal to Kupffer cells

Treatment with LPS + IFN-{gamma} significantly increased the iNOS-positive cells found in mouse liver assessed by histochemical staining with a polyclonal rabbit anti-mouse iNOS Ab (Fig. 5). Staining for iNOS was observed in Kupffer cells, bile duct cells, and also in hepatocytes.



View larger version (117K):
[in this window]
[in a new window]
 
FIGURE 5. Immunohistochemical staining for iNOS. Photomicrographs of liver sections from iNos-luc mice 6 h after treatment with vehicle or LPS + IFN-{gamma}. The immunohistochemical stain for the presence of iNOS protein revealed a diffuse pattern of staining at x100 magnification in the LPS-treated liver, and much lower background staining in the control liver. Magnification of x400 revealed that the iNOS-positive signal in liver from LPS-treated mice came from Kupffer cells, large bile ducts, and hepatocytes.

 
An antisense RNA probe against firefly luciferase mRNA detected a significant induction of the luciferase in liver following treatment by LPS + IFN-{gamma} (Fig. 6). Based upon the morphological characteristics of the cells overlayed by silver granules, Kupffer cells located at or near the sinusoids, along with some hepatocytes, expressed the luciferase transgene.



View larger version (99K):
[in this window]
[in a new window]
 
FIGURE 6. Detection of hepatic luciferase mRNA by in situ hybridization. Dark field illumination of x10 of a liver section from an LPS + IFN-{gamma}-treated iNos-luc mouse 6 h after treatment, and a section from a control liver, probed with sense and antisense radiolabeled probes for luciferase mRNA. In these images, the accumulation of silver grains over cells appears white on a black background. The signal from the sense probe indicates background signal and is diffuse and uniform over the liver from the LPS-treated iNos-luc mouse, and the liver section from the control iNos-luc mouse. The antisense probe detected numerous foci of luciferase-expressing cells in the liver section from the LPS-treated mouse. The signal from the control liver probed with the antisense probe revealed few or any foci of luciferase expression. Bright field illumination of x40 of a liver section from an LPS-treated mouse showed black silver grains on a pink background. Cells with large nuclei are hepatocytes, while endothelial cells in the sinusoids and blood vessels have thin, dark nuclei. The silver granules overlay cells with intermediate nuclei that are located near sinusoids, indicating that they are neither hepatocytes nor endothelial cells, and suggesting that they are Kupffer cells. In all sections, PV indicates a portal vessel, while CV indicates the location of a central vein.

 
Compound screening for inhibition of iNos-luc transgene expression

We evaluated the effect of dexamethasone and EGCG on IFN-{gamma}- and LPS-induced iNos-luc transgene expression. Treatment of mice with dexamethasone (3 mg/kg) or EGCG (100 mg/kg) dramatically inhibited IFN-{gamma}- and LPS-induced iNos-luc transgene expression in mouse liver, compared with positive control mice that were treated with IFN-{gamma} and LPS (Fig. 7, A and B). These results are supported with Western blot data using anti-iNOS Abs (Fig. 7C) and by Northern blot (Fig. 7D). At a lower EGCG dose of 10 mg/kg, there was no effect on iNos-luc induction by imaging, or on the accumulation of iNOS protein by Western blot (results not shown).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 7. Dexamethasone and EGCG inhibit IFN-{gamma}- and LPS-induced iNOS expression. A, Three groups (n = 4/group) of male iNos-luc mice were treated with IFN-{gamma} and LPS (3 mg/kg) The mice were cotreated with either vehicle, dexamethasone (3 mg/kg), or EGCG (100 mg/kg), as described in Materials and Methods. Another group of four mice was not injected with either LPS or drug and served as the untreated control. All the mice were imaged and sacrificed at 6 h after LPS injection. A representative image from one mouse per treatment group is presented (group 1, untreated control; group 2, IFN-{gamma} and LPS; group 3, IFN-{gamma}, LPS, and dexamethasone; group 4, IFN-{gamma}, LPS, and EGCG). The color overlay on the image represents the photons/s emitted from the animal with a range of 0–30,000 photons/s, as indicated by the color scale next to the images. B, Quantification of luciferase activity of the liver region with LivingImage software. Data are mean and SD (n = 4/group). C, Western blot analysis of liver lysate with anti-iNOS polyclonal Ab. Lane 1, Control; lane 2, IFN-{gamma} + LPS; lane 3, IFN-{gamma} + LPS + Dex; lane 4, IFN-{gamma} + LPS + EGCG. D, Northern blot analysis of livers. Lane 1, Control; lane 2, IFN-{gamma} + LPS; lane 3, IFN-{gamma} + LPS + Dex; lane 4, IFN-{gamma} + LPS + EGCG. These experiments were repeated three times in three separate groups of mice.

 
Additional compounds that have previously been shown to inhibit iNOS induction by LPS in vitro were also evaluated in iNos-luc transgenic mice. The dosing conditions for all these compounds are listed in Table I. In addition to dexamethasone and EGCG, we identified two additional compounds, ebselen and PBN, that inhibited iNos-luc transgene induction in mice treated with IFN-{gamma} and LPS. As shown in Fig. 8A, treatment with 100 mg/kg ebselen or 300 mg/kg PBN significantly inhibited iNos-luc transgene induction by IFN-{gamma} and LPS. Other compounds we tested, such as genistein (100 mg/kg) or aminoguanidine (200 mg/kg), had little or no effect on the iNos-luc transgene induction in our experimental model (Fig. 8A, Table I). Quantification of luciferase signals from the liver region using the LivingImage software and measurements of luciferase activity in liver lysates confirmed the significant effects of ebselen and PBN on transgene induction (Fig. 8, B and C). Western blot analysis showed a significant decrease of iNOS protein level in mice treated with either ebselen or PBN, as compared with the positive control mice that were treated with IFN-{gamma} and LPS only (Fig. 8D). Both genistein and aminoguanidine had no significant effect on the iNOS protein level.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 8. Effect of ebselen, PBN, genistein, and aminoguanidine on iNOS induction. A, Groups of four male iNos-luc mice were treated with IFN-{gamma} and LPS (3 mg/kg). The mice were cotreated with ebselen (100 mg/kg), PBN (300 mg/kg), genistein (100 mg/kg), or aminoguanidine (200 mg/kg), according to Materials and Methods. A group of four iNos-luc that were not injected with LPS served as an untreated control. All the mice were imaged and sacrificed at 6 h after LPS injection. An image from a representative animal from each treatment group is presented in the figure (group 1, untreated control; group 2, IFN-{gamma} and LPS; group 3, IFN-{gamma}, LPS, and ebselen; group 4, IFN-{gamma}, LPS, and PBN; group 5, IFN-{gamma}, LPS, and genistein; group 6, IFN-{gamma}, LPS, and aminoguanidine). The color overlay on the images represents the photons/s emitted from the animal with a range of 0–50,000 photons/s, as indicated by the color scale next to the images. B, Luciferase activity of the liver region measured by LivingImage software. Data presented are mean and SD (n = 4/group). C, Luciferase activity in the liver lysate measured with luminometer. D, Western blot analysis of liver lysate with anti-iNOS polyclonal Ab. Lane 1, Control; lane 2, IFN-{gamma} + LPS; lane 3, IFN-{gamma} + LPS + ebselen; lane 4, IFN-{gamma} + LPS + PBN; lane 5, IFN-{gamma} + LPS + genistein; lane 6, IFN-{gamma} + LPS + aminoguanidine. These experiments were repeated three times in three separate groups of mice.

 
Induction of iNOS-luc transgene expression during acute arthritis

The inducibility of iNOS expression during acute inflammatory arthritis was studied using the iNos-luc model. The data show that intra-articular injection of zymosan into the right knee joints of iNos-luc mice caused a local induction of luciferase signal at 2 h, with a peak of induction at 4–6 h after the injection (Fig. 9, A and B). The signals started to decline at 8 h, and were almost undetectable 24 h following zymosan injection. The left knee joints that were injected with vehicle had no induction of the iNos-luc reporter. The induction of luciferase signal was correlated with an increase of knee joint volume, as measured across lateral/medial axis and the anterior/posterior axis of the knee joints (results not shown).



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 9. Monitoring iNos-luc expression during zymosan-induced acute arthritis. A, One group (n = 3) of female iNos-luc mice was injected with zymosan (300 µg/knee) into the right rear knee joint, and vehicle (5% glucose in PBS) into the left rear knee joint. The mice were imaged at 0, 2, 4, 6, 8, and 24 h following injection. The color overlay on the images represents the photons/s emitted from the animal with a range of 2000–5000 photons/s, as indicated by the color scale next to the images. B, Luciferase activity of the knee region measured by LivingImage software. Data presented are mean and SD (n = 3/group). These experiments were repeated twice.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have generated an iNOS promoter-luciferase transgenic mouse for monitoring iNOS transcriptional activity during inflammation. Using the IVIS Imaging System, we demonstrated that luciferase signals in the iNos-luc transgenic mice are dramatically induced in the liver, but not in other tissues following treatment with IFN-{gamma} + LPS. The luciferase activity correlated with both the iNOS mRNA and iNOS protein in the liver. Direct quantification of luciferase signals using the LivingImage software showed results comparable to the conventional luminometer assay performed on excised and homogenized liver tissue.

The induction of iNOS mRNA in mouse liver following treatment with cytokines and LPS is consistent with previous reports (19). However, induction of the endogenous iNOS gene following the production of septic shock has been reported for other tissues, including lung, heart, and kidney (20), as well as spleen (21) and intestine (22). We confirmed this induction in other tissues by Western blot analysis showing that the iNOS protein was detected at significantly higher levels in liver, spleen, lung, and intestine following LPS + IFN-{gamma} injection. However, significant induction of the luciferase reporter by LPS + IFN-{gamma} was observed only in the liver by in vivo and ex vivo imaging. Measurement of luciferase activity in the tissue extract with a luminometer showed a large induction in liver, and a slight induction in spleen, kidney, and lung. There are a number of explanations for this discrepancy. Failure to detect significant luciferase induction in spleen, kidney, lung, and intestine may be due to the limited sensitivity of the reporter system. One might expect that imaging of the organs ex vivo would be more sensitive than the in vivo measurements, because there is no overlying tissue that would attenuate the signal. However, for the ex vivo assay, the tissues are removed from their supply of oxygen and luciferin for up to 7–8 min during the process of organ removal and during the 5-min imaging period. Therefore, substrate and ATP may be limiting in ex vivo assessments of luciferase activity. The luminometer assay of rapidly excised and quick frozen tissue did reveal a low baseline activity in most tissues and a slight, but variable induction of luciferase by LPS + IFN-{gamma} in the spleen, kidney, and lung. The luminometer assay eliminates the issues of substrate and ATP availability and is probably the most precise method for determining actual tissue luciferase activity. The low levels of induction in spleen, kidney, and lung as measured by luminometer may reflect relatively low levels of luciferase enzyme in the tissue because of rapid turnover of the luciferase protein in those tissues compared with the iNOS protein. In addition, we cannot rule out the possibility that the relative short mouse iNOS promoter used in generating the transgenic mice lacked regulatory elements necessary for optimized luciferase induction and caused a more limited tissue expression than the endogenous gene. It is also possible that insertional effects of the transgene may contribute to this discrepancy.

LPS and cytokines can induce iNOS expression in liver in three main cell types: hepatocytes, Kupffer (macrophage-like cells), and stellate cells (8, 23, 24). Kupffer cells are located in the venous sinusoids, serve to sequester bacterial fragments and endotoxin, and are highly activated by LPS. Therefore, it is likely that the liver luciferase signal is coming primarily from the Kupffer cells. Our in vitro study showed that iNos-luc transgene induction by LPS and IFN-{gamma} is more robust in the RAW264.7 macrophage cell line compared with the hepatocyte cell line Hepa1-6. This supports the inference that the luciferase signal following stimulation by LPS in the in vivo model is coming from the Kupffer cells. In addition, the in situ hybridization analysis confirmed that luciferase mRNA was highly induced in Kupffer cells compared with hepatocytes of the liver.

Our in vivo experiments showed that exogenous IFN-{gamma} is necessary to maximize the LPS-mediated iNos-luc transgene induction because the addition of IFN-{gamma} increased LPS-stimulated expression ~10-fold in vivo and in vitro. Interestingly, IFN-{gamma} treatment alone had no effect. The cis-regulatory elements required for the activation of the murine iNOS promoter include two NF-{kappa}B sites, an IFN-{gamma}-activated site and IFN-stimulated responsive elements. These elements are located within 1 kb of the transcriptional start of the iNOS gene (25, 26, 27, 28) and are most likely responsible for the synergistic effect of iNos-luc induction by IFN-{gamma} and LPS. The kinetics of production of endogenous IFN-{gamma} in response to LPS may be limiting, and this could explain why we observe a significant greater induction of the luciferase signal when high doses of exogenous IFN-{gamma} are injected.

The induction of the luciferase reporter in response to LPS showed a clear dose-response relationship, with a small response seen with 0.1 mg LPS/kg body weight and the maximal response observed at ~1.0–3.0 mg LPS/kg. Kinetics of iNos-luc transgene induction by IFN-{gamma} and LPS differed with various LPS doses (Fig. 4). Mice treated with higher LPS doses (1 and 3 mg/kg) not only have stronger iNos-luc transgene induction, but the peak induction occurred at 9 h compared with the 4- to 6-h time for the peak response seen at lower LPS doses. Two of the mice at the LPS dose of 3 mg/kg died within 24 h after LPS administration. This dose is close to the LD50 for LPS in mice. Both of the dead mice had higher luciferase signals than the other two surviving mice given the same LPS dose. Assuming that the iNos-luc transgene mimics the induction of the endogenous iNOS gene, the sustained and strong induction of iNOS expression in these two mice may have led to massive production of NO and subsequent mortality.

It has been reported that some components of the acute-phase response to LPS administration, such as fever and mortality, are reduced with repeated administration of the stimulus (29). We note in this work that the induction of iNos-luc transgene expression is significantly attenuated when IFN-{gamma} + LPS was given at the same dose 8 days following initial treatment. The attenuation of iNOS induction may be one of the mechanisms for the reduction of fever and mortality with repeated dosing of LPS.

There is a clear gender difference in the transgene response to IFN-{gamma} + LPS, with the male response 3- to 4-fold greater than the female luciferase response in an identical paradigm. The luciferase data showing a gender difference are supported by Northern data for iNOS mRNA; however, there are no differences in protein mass assessed by Western blot (data not shown). We have completed some preliminary studies in the female iNos-luc mouse showing that treatment of intact female transgenic mice with testosterone increases the magnitude of the luciferase signal following treatment with IFN-{gamma} + LPS, suggesting that iNOS is regulated by gonadal hormones. Indeed, a report by Hayashi et al. (30), using a macrophage cell line (J774) in culture, showed that estrogen would inhibit the induction of iNOS by LPS + IFN-{gamma}. However, Friedl et al. (31) reported that testosterone inhibited the induction of iNOS in the murine macophage RAW264.7 cell line. These in vitro data by Friedl showing that testosterone inhibited iNOS induction contradict our in vivo data and could reflect in vivo vs in vitro differences in macrophage function. The fact that the gender difference in the iNos-luc transgene induction is not observed at the protein level indicates the complexity of iNOS regulation. Although the regulation of iNOS during the inflammatory response is predominantly at the transcriptional level, there has been evidence of posttranscriptional and posttranslational regulation of this gene (14, 15).

The iNos-luc mouse may be a useful model for evaluating anti-inflammatory compounds. A number of the compounds tested, including dexamethasone, EGCG, ebselen, and PBN, were shown in vivo to reduce induction in the iNos-luc mouse. Dexamethasone, a synthetic glucocorticoid, has been well characterized for its ability to inhibit iNOS production. EGCG, the major polyphenol present in green tea, has been reported to inhibit the induction of iNOS expression in the RAW264.7 murine macrophage cell line (32). Ebselen, an organic selenium compound, can inhibit LPS-induced NO production in rat liver Kupffer cells (33). Ebselen and dexamethasone reportedly protect mice from galactosamine and Salmonella-LPS-induced hepatitis (34). Dexamethasone, EGCG, and ebselen may reduce iNOS gene expression through NF-{kappa}B signaling, either by up-regulating I-{kappa}B{alpha} or inhibiting NF-{kappa}B (32, 33, 35, 36).

Another compound that reduced induction of the iNos-luc reporter in vivo was PBN. PBN is a nitrone spin-trap molecule that scavenges free radicals and has neuroprotective properties (37). Chronic administration of PBN has been shown to reverse age-related oxidative damage in Mongolian gerbils (38), prolong the life span of the senescence-accelerated mouse model (39), and also decrease ischemia-reperfusion injury in the brain (40). These physiological effects of PBN may be mediated by its ability to block iNOS induction through an unknown mechanism (41).

A number of other compounds that we tested had little or no effect on LPS + IFN-{gamma}-induced iNos-luc transgene expression. Both apigenin and genistein belong to a group of polyphenolic compounds that reportedly inhibit iNOS expression in vitro in mouse macrophages (42, 43), but had no effect in the iNos-luc mouse. PDTC is an NF-{kappa}B inhibitor and was previously reported to inhibit LPS-induced iNOS expression by 48% in a rat model of septic shock (44), but did not inhibit induction of the iNos-luc reporter following LPS treatment. Acetaminophen did not suppress the luciferase signal in response to LPS + IFN-{gamma} administration in the iNos-luc mouse. Previous results from in vitro studies of acetaminophen in RAW264.7 cells gave contradictory results, with one study showing that acetaminophen inhibited iNOS induction (45), while another report showed no effect (46). The failure of some of these compounds to inhibit transgene induction in the iNos-luc model could reflect differences in the in vivo response vs the macrophage cell lines tested in vitro (apigenin, genistein, acetaminophen), species differences (PDTC), or dosage/bioavailability effects because only a single dose for each drug was tested in the iNos-luc model. Additional dose-range tests of these compounds in the iNos-luc model are needed to more fully evaluate their in vivo effects. Aminoguanidine inhibits iNOS enzymatic activity and reportedly attenuates the circulatory failure caused by endotoxic shock in the rat and improves survival in a murine model of endotoxemia (47). It is not surprising that aminoguanidine did not reduce iNos-luc induction in our model because it acts primarily by inhibiting enzyme activity and not by inhibiting gene induction.

It is clear that dexamethasone, EGCG, ebselen, and PBN do not inhibit iNos-luc transgene expression completely at the concentrations selected. However, partial suppression of iNOS may be sufficient to inhibit an inflammatory response. For example, in the LPS dose-response experiment presented in this work, the two mice that survived 24 h in the 3.0 mg/kg LPS dose group had luciferase signals ~40% of that observed in the two mice that did not survive. These findings suggest that even a moderate difference in induction can profoundly influence the severity of endotoxic shock. In another study, partial inhibition of iNOS by NOS inhibitors in rats with induced adjuvant arthritis was sufficient to reduce paw swelling without significantly affecting the elevated excretion of nitrite in the urine (48). Thus, small reduction of iNOS expression may profoundly affect the inflammation process.

The utility of the iNos-luc model for monitoring inflammatory processes and drug responses may not be restricted to the LPS sepsis model. We showed that intra-articular injection of zymosan, a yeast cell wall preparation, into the knee joint provided enough of an inflammatory stimulus to generate a clear luciferase signal in the joints compared with vehicle-injected controls. We also observed induction of luciferase signal in the footpad after local injection of the irritant Formalin and in s.c. air pouch following administration of zymosan into the air pouch (unpublished data). These data suggest that the iNos-luc mouse may be applied to other inflammatory disease models, such as inflammatory bowel disease, rheumatoid arthritis, or asthma, for tracking and monitoring the disease process and response to treatment.

It is certainly possible to monitor some aspects of NOS activity by measuring circulating levels of nitrate + nitrite in the blood, because this measure is thought to reflect the production of NO (8). However, the bioluminescent reporter described in this study has certain significant advantages. Measurement of the circulating nitrate/nitrite does not provide any information of the specific NOS producing NO. Although it is generally believed that most of the NO generated under inflammatory conditions is produced by iNOS, recent studies have shown that both endothelial NOS (49, 50) and neuronal NOS (51) can also be regulated in some disease conditions. In addition, the luciferase reporter provides information about the anatomical site of induction of iNOS. Induction was observed in the liver in the LPS-sepsis model, while the induction was restricted to the joints in the zymosan-arthritis model.

In summary, the iNos-luc transgenic mouse provides a useful tool for tracking inflammatory processes in vivo. The liver luciferase signal in the iNos-luc transgenic mouse following iNos-luc induction by LPS + IFN-{gamma} correlated with iNOS mRNA measured by Northern blot, and with iNOS protein level measured by Western blot. Induction of the luciferase signal by LPS + IFN-{gamma} is robust and is confined to the liver, primarily in the Kupffer cells. The in vivo luciferase signal in this transgenic mouse showed a dose response to LPS with some luciferase signal detected at a dose of 0.1 mg/kg LPS and a peak response at 1.0–3.0 mg/kg LPS. In vivo the luciferase signal in the liver is highly correlated with ex vivo measures taken by luminometer from excised and homogenized liver. The iNos-luc transgenic model may also be useful for tracking the course of localized inflammation, as demonstrated in the zymosan model of arthritis presented in this work. This model may be useful for screening anti-inflammatory compounds that act through inhibition of iNOS induction.


    Acknowledgments
 
We thank Dr. Weisheng Zhang (Xenogen) for his kind gift of pGEM-3zf+-luc, and Zexu Fang for technical assistance. We thank E. Reynolds (Xenogen) for assistance with graphics and drawings.


    Footnotes
 
1 Supported in part by National Institutes of Health Grant RO1 HL64548-03 awarded to R.L. Back

2 Address correspondence and reprint requests to Dr. Ning Zhang, Xenogen Corporation, 860 Atlantic Avenue, Alameda, CA 94501. E-mail address: ning.zhang{at}xenogen.com Back

3 Abbreviations used in this paper: NOS, NO synthase; EGCG, epigallocatechin gallate; iNOS, inducible NOS; PBN, N-tert-butyl-{alpha}-phenylnitrone; PDTC, pyrrolidinedithiocarbamate. Back

Received for publication August 22, 2002. Accepted for publication April 28, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nathan, C., Q. W. Xie. 1994. Nitric oxide synthases: roles, tolls, and controls. Cell 78:915.[Medline]
  2. Vane, J. R., J. A. Mitchell, I. Appleton, A. Tomlinson, D. Bishop-Bailey, J. Croxtall, D. A. Willoughby. 1994. Inducible isoforms of cyclooxygenase and nitric-oxide synthase in inflammation. Proc. Natl. Acad. Sci. USA 91:2046.[Abstract/Free Full Text]
  3. Kroncke, K. D., K. Fehsel, V. Kolb-Bachofen. 1997. Nitric oxide: cytotoxicity versus cytoprotection: how, why, when and where?. Nitric Oxide-Biol. Chem. 1:107.
  4. Liao, W.. 1996. Endotoxin: possible roles in initiation and development of atherosclerosis. J. Lab. Clin. Med. 128:452.[Medline]
  5. Lyons, C. R., G. J. Orloff, J. M. Cunningham. 1992. Molecular cloning and functional expression of an inducible nitric oxide synthase from murine macrophage cell line. J. Biol. Chem. 267:6370.[Abstract/Free Full Text]
  6. Lorsbach, R. B., W. J. Murphy, C. J. Lowenstein, S. H. Snyder, S. W. Russell. 1993. Expression of the nitric oxide synthase gene in mouse macrophages activated for tumor cell killing: molecular basis for the synergy between interferon-{gamma} and lipopolysaccharide. J. Biol. Chem. 268:1908.[Abstract/Free Full Text]
  7. Nathan, C.. 1992. Nitric oxide as a secretory product of mammalian cells. FASEB J. 6:3051.[Abstract]
  8. Salkowski, C. A., G. Detore, R. McNally, N. van Rooijen, S. N. Vogel. 1997. Regulation of inducible nitric oxide synthase messenger RNA expression and nitric oxide production by lipopolysaccharide in vivo: the roles of macrophages, endogenous IFN-{gamma}, and TNF receptor-1-mediated signaling. J. Immunol. 158:905.[Abstract]
  9. Szabo, C., C. Thiemermann, C. C. Wu, M. Perretti, J. R. Vane. 1994. Attenuation of the induction of nitric oxide synthase by endogenous glucocorticoids accounts for endotoxin tolerance in vivo. Proc. Natl. Acad. Sci. USA 91:271.[Abstract/Free Full Text]
  10. Ross, R., A. B. Reske-Kunz. 2001. The role of NO in contact hypersensitivity. Int. Immunopharm. 1:1469.
  11. Calatayud, S., D. Barrachina, J. V. Esplugues. 2001. Nitric oxide: relation to integrity, injury and healing of the gastric mucosa. Microsc. Res. Tech. 53:325.[Medline]
  12. Bolli, R.. 2001. Cardioprotective function of inducible nitric oxide synthase and role of nitric oxide in myocardial ischemia and preconditioning: an overview of a decade of research. J. Mol. Cell. Cardiol. 33:1897.[Medline]
  13. Weinberg, J. B.. 1999. Nitric oxide and inflammation in autoimmune disorders. J. D. Laskin, and D. L. Laskin, eds. Cellular and Molecular Biology of Nitric Oxide 199.-224. Marcel Dekker, New York.
  14. Kinugawa, K., T. Shimizu, A. Yao, O. Kohmoto, T. Serizawa, T. Takahashi. 1997. Transcriptional regulation of inducible nitric oxide synthase in cultured neonatal rat cardiac myocytes. Circ. Res. 81:911.[Abstract/Free Full Text]
  15. Park, S. K., S. Murphy. 1996. Nitric oxide synthase type II mRNA stability is translation- and transcription-dependent. J. Neurochem. 67:1766.[Medline]
  16. Contag, C. H., P. R. Contag, J. I. Mullins, S. D. Spilman, D. K. Stevenson, D. A. Benaron. 1995. Photonic detection of bacterial pathogens in living hosts. Mol. Microbiol. 18:593.[Medline]
  17. Contag, P. R., I. N. Olomu, D. K. Stevenson, C. H. Contag. 1998. Bioluminescent indicators in living mammals. Nat. Med. 4:245.[Medline]
  18. Zhang, W., J. Q. Feng, S. E. Harris, P. R. Contag, D. K. Stevenson, C. H. Contag. 2001. Rapid in vivo functional analysis of transgenes in mice using whole body imaging of luciferase expression. Transgenic Res. 10:423.[Medline]
  19. Heinzel, F. P.. 1990. The role of IFN-{gamma} in the pathology of experimental endotoxemia. J. Immunol. 145:2920.[Abstract]
  20. Buttery, L. D., T. J. Evans, D. R. Springall, A. Carpenter, J. Cohen, J. M. Polak. 1994. Immunochemical localization of inducible nitric oxide synthase in endotoxin-treated rats. Lab. Invest. 71:755.[Medline]
  21. Khan, S. A., P. J. Strijbos, P. Everest, D. Moss, R. Stratford, P. Mastroeni, J. Allen, S. Servos, I. G. Charles, G. Dougan, D. J. Maskell. 2001. Early responses to Salmonella typhimurium infection in mice occur at focal lesions in infected organs. Microb. Pathog. 30:29.[Medline]
  22. Hoffman, R. A., G. Zhang, N. C. Nussler, S. L. Gleixner, H. R. Ford, R. L. Simmons, S. C. Watkins. 1997. Constitutive expression of inducible nitric oxide synthase in the mouse ileal mucosa. Am. J. Physiol. 272:G383.
  23. Muriel, P.. 2000. Regulation of nitric oxide synthesis in the liver. J. Appl. Toxicol. 20:189.[Medline]
  24. Milosevic, N., H. Schawalder, P. Maier. 1999. Kupffer cell-mediated differential down-regulation of cytochrome P450 metabolism in rat hepatocytes. Eur. J. Pharmacol. 368:75.[Medline]
  25. Lowenstein, C. J., E. W. Alley, P. Raval, A. M. Snowman, S. H. Snyder, S. W. Russell, W. J. Murphy. 1993. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon {gamma} and lipopolysaccharide. Proc. Natl. Acad. Sci. USA 90:9730.[Abstract/Free Full Text]
  26. Xie, Q. W., C. Nathan. 1993. Promoter of the mouse gene encoding calcium-independent nitric oxide synthase confers inducibility by interferon-{gamma} and bacterial lipopolysaccharide. Trans. Assoc. Am. Physicians 106:1.[Medline]
  27. Weisz, A., L. Cicatiello, H. Esumi. 1996. Regulation of the mouse inducible-type nitric oxide synthase gene promoter by interferon-{gamma}, bacterial lipopolysaccharide and NG-monomethyl-L-arginine. Biochem. J. 316:209.
  28. Murphy, W. J.. 1999. Transcription regulation of genes encoding nitric oxide synthase. J. D. Laskin, and D. L. Laskin, eds. Cellular and Molecular Biology of Nitric Oxide 1.-56. Marcel Dekker, New York.
  29. Zeisberger, E., J. Roth. 1998. Tolerance to pyrogens. Ann. NY Acad. Sci. 856:116.[Abstract/Free Full Text]
  30. Hayashi, T., K. Yamada, T. Esaki, E. Muto, G. Chaudhuri, A. Iguchi. 1998. Physiological concentrations of 17{beta}-estradiol inhibit the synthesis of nitric oxide synthase in macrophages via a receptor-mediated system. J. Cardiovasc. Pharmacol. 31:292.[Medline]
  31. Friedl, R., M. Brunner, T. Moseslinger, P. G. Spieckermann. 2000. Testosterone inhibits expression of inducible nitric oxide synthase in murine macrophages. Life Sci. 68:417.[Medline]
  32. Lin, Y. L., J. K. Lin. 1997. (-)-Epigallocatechin-3-gallate blocks the induction of nitric oxide synthase by down-regulating lipopolysaccharide-induced activity of transcription factor nuclear factor-{kappa}B. Mol. Pharmacol. 52:465.[Abstract/Free Full Text]
  33. Shimohashi, N., M. Nakamuta, K. Uchimura, R. Sugimoto, H. Iwamoto, M. Enjoji, H. Nawata. 2000. Selenoorganic compound, ebselen, inhibits nitric oxide and tumor necrosis factor-{alpha} production by the modulation of jun-N-terminal kinase and the NF-{kappa}B signaling pathway in rat Kupffer cells. J. Cell. Biochem. 78:595.[Medline]
  34. Wendel, A., G. Tiegs. 1986. A novel biologically active seleno-organic compound. VI. Protection by ebselen (PZ 51) against galactosamine/endotoxin-induced hepatitis in mice. Biochem. Pharmacol. 35:2115.[Medline]
  35. De Vera, M. E., B. S. Taylor, Q. Wang, R. A. Shapiro, T. R. Billiar, D. A. Geller. 1997. Dexamethasone suppresses iNOS gene expression by up-regulating I-{kappa}B{alpha} and inhibiting NF-{kappa}B. Am. J. Physiol. 273:G1290.
  36. Walker, G., J. Pfeilschifter, D. Kunz. 1997. Mechanisms of suppression of inducible nitric-oxide synthase (iNOS) expression in interferon (IFN)-{gamma}-stimulated RAW264.7 cells by dexamethasone: evidence for glucocorticoid-induced degradation of iNOS protein by calpain as a key step in post-transcriptional regulation. J. Biol. Chem. 272:16679.[Abstract/Free Full Text]
  37. Floyd, R. A.. 1999. Antioxidants, oxidative stress, and degenerative neurological disorders. Proc. Soc. Exp. Biol. Med. 222:236.[Abstract/Free Full Text]
  38. Carney, J. M., P. E. Starke-Reed, C. N. Oliver, R. W. Landum, M. S. Cheng, J. F. Wu, R. A. Floyd. 1991. Reversal of age-related increase in brain protein oxidation, decrease in enzyme activity, and loss in temporal and spatial memory by chronic administration of the spin-trapping compound N-tert-butyl-{alpha}-phenylnitrone. Proc. Natl. Acad. Sci. USA 88:3633.[Abstract/Free Full Text]
  39. Edamatsu, R., A. Mori, L. Packer. 1995. The spin-trap N-tert-{alpha}-phenyl-butylnitrone prolongs the life span of the senescence accelerated mouse. Biochem. Biophys. Res. Commun. 211:847.[Medline]
  40. Folbergrova, J., Q. Zhao, K. Katsura, B. K. Siesjo. 1995. N-tert-butyl-{alpha}-phenylnitrone improves recovery of brain energy state in rats following transient focal ischemia. Proc. Natl. Acad. Sci. USA 92:5057.[Abstract/Free Full Text]
  41. Miyajima, T., Y. Kotake. 1997. Optimal time and dosage of phenyl N-tert-butyl nitrone (PBN) for the inhibition of nitric oxide synthase induction in mice. Free Radical Biol. Med. 22:463.[Medline]
  42. Liang, Y. C., Y. T. Huang, S. H. Tsai, S. Y. Lin-Shiau, C. F. Chen, J. K. Lin. 1999. Suppression of inducible cyclooxygenase and inducible nitric oxide synthase by apigenin and related flavonoids in mouse macrophages. Carcinogenesis 20:1945.[Abstract/Free Full Text]
  43. Faure, V., C. Hecquet, Y. Courtois, O. Goureau. 1999. Role of interferon regulatory factor-1 and mitogen-activated protein kinase pathways in the induction of nitric oxide synthase-2 in retinal pigmented epithelial cells. J. Biol. Chem. 274:4794.[Abstract/Free Full Text]
  44. Liu, S. F., X. Ye, A. B. Malik. 1997. In vivo inhibition of nuclear factor-{kappa}B activation prevents inducible nitric oxide synthase expression and systemic hypotension in a rat model of septic shock. J. Immunol. 159:3976.[Abstract]
  45. Ryu, Y. S., J. H. Lee, J. H. Seok, J. H. Hong, Y. S. Lee, J. H. Lim, Y. M. Kim, G. M. Hur. 2000. Acetaminophen inhibits iNOS gene expression in RAW264.7 macrophages: differential regulation of NF-{kappa}B by acetaminophen and salicylates. Biochem. Biophys. Res. Commun. 272:758.[Medline]
  46. Amin, A. R., P. Vyas, M. Attur, J. Leszczynska-Piziak, I. R. Patel, G. Weissmann, S. B. Abramson. 1995. The mode of action of aspirin-like drugs: effect on inducible nitric oxide synthase. Proc. Natl. Acad. Sci. USA 92:7926.[Abstract/Free Full Text]
  47. Wu, C. C., S. J. Chen, C. Szabo, C. Thiemermann, J. R. Vane. 1995. Aminoguanidine attenuates the delayed circulatory failure and improves survival in rodent models of endotoxic shock. Br. J. Pharmacol. 114:1666.[Medline]
  48. Stefanovic-Racic, M., K. Meyers, C. Meschter, J. W. Coffey, R. A. Hoffman, C. H. Evans. 1994. N-monomethyl arginine, an inhibitor of nitric oxide synthase, suppresses the development of adjuvant arthritis in rats. Arthritis Rheum. 37:1062.[Medline]
  49. Guillot, P. V., J. Guan, L. Liu, J. A. Kuivenhoven, R. D. Rosenberg, W. C. Sessa, W. C. Aird. 1999. A vascular bed-specific pathway. J. Clin. Invest. 103:799.[Medline]
  50. Luth, H. J., M. Holzer, U. Gartner, M. Staufenbiel, T. Arendt. 2001. Expression of endothelial and inducible NOS-isoforms is increased in Alzheimer’s disease, in APP23 transgenic mice and after experimental brain lesion in rat: evidence for an induction by amyloid pathology. Brain Res. 913:57.[Medline]
  51. Sasaki, M., J. Yamaoka, Y. Miyachi. 2000. The effect of ultraviolet B irradiation on nitric oxide synthase expression in murine keratinocytes. Exp. Dermatol. 9:417.[Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
S. M. Houten, D. H. Volle, C. L. Cummins, D. J. Mangelsdorf, and J. Auwerx
In Vivo Imaging of Farnesoid X Receptor Activity Reveals the Ileum as the Primary Bile Acid Signaling Tis